CN117088948A - Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof - Google Patents

Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof Download PDF

Info

Publication number
CN117088948A
CN117088948A CN202311067601.XA CN202311067601A CN117088948A CN 117088948 A CN117088948 A CN 117088948A CN 202311067601 A CN202311067601 A CN 202311067601A CN 117088948 A CN117088948 A CN 117088948A
Authority
CN
China
Prior art keywords
protein
phytophthora
coding gene
pcmesa
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202311067601.XA
Other languages
Chinese (zh)
Other versions
CN117088948B (en
Inventor
刘西莉
周鑫
薛昭霖
王为镇
张博瑞
张思聪
黄中乔
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Agricultural University
Original Assignee
China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Agricultural University filed Critical China Agricultural University
Priority to CN202311067601.XA priority Critical patent/CN117088948B/en
Publication of CN117088948A publication Critical patent/CN117088948A/en
Application granted granted Critical
Publication of CN117088948B publication Critical patent/CN117088948B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses zoospore development regulatory protein MesA from Phytophthora spp containing Afil and SPA structural domains, and a coding gene and application thereof. Wherein the phytophthora capsici leonian (Phytophthora capsici) growth and development regulating protein PcMesA has an amino acid sequence shown as SEQ ID No.2, and the encoding gene has a nucleotide sequence shown as SEQ ID No. 1. The main function of the MesA protein is necessary for zoospore formation of phytophthora, and after the MesA protein is deleted, the zoosporangium of the phytophthora cannot differentiate to form normal zoospores. The gene of the invention has high application value in controlling epidemic diseases caused by phytophthora, and the novel bactericide developed based on the protein as an action target has important practical significance in controlling the occurrence and epidemic of epidemic diseases caused by phytophthora.

Description

Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to phytophthora capsici regulating zoospore development related protein, and a coding gene and application thereof; in particular to a zoospore development regulating MesA containing Afil and SPA structural domains from Phytophthora pathogen (Phytophthora spp.) in plant pathogen oomycetes, and a coding gene and application thereof.
Background
Oomycetes (Oomycetes) are a huge number of eukaryotes, the number of which is currently known to be more than 1800, are widely distributed worldwide and can cause various animal and plant diseases. Although the oomycetes and fungi are similar in mycelium morphology, nutrient absorption mode and the like, the oomycetes and fungi are far in relation and the diatom is close in relation, and belong to the antler whip biology kingdom. Plant pathogenic oomycetes account for about 60% of the total oomycetes and can be classified into Phytophthora (Phytophthora), pythum (Pythum), peronospora (Peronospora), and the like. Among these Phytophthora pathogens (Phytophthora spp.) are serious hazards in agricultural production, and 6 Phytophthora pathogens are listed as ten important plant pathogen oomycetes in the world, including Phytophthora infestans (Phytophthora infestans), phytophthora sojae (Phytophthora sojea), phytophthora capsici (Phytophthora capsici) and the like. The phytophthora capsici (Phytophthora capsici) has wide hosts and can infect more than 70 vegetable crops of 26 families such as hot pepper, tobacco, leguminous plants and cucurbitaceae in the Solanaceae. Phytophthora capsici can cause plant diseases from seedling stage to fruit stage, and cause rot of root and stem parts and fruits of crops, and serious plant wilting and even damping-off can be caused when serious, so that the influence on the yield and quality of crops is great, and serious economic loss is caused.
The life history of phytophthora capsici comprises a sexual stage and an asexual stage, wherein the sexual stage generates oospores through heterogeneous cooperation; asexual stage is to release zoospores from the aperture through mature sporangia under low temperature and humidity condition, zoospores reach the surface of the host to form resting spores, and the mycelia germinate under proper condition invade directly or invade plants through wounds or apertures, which is the main infection source. Sporangia and zoospores are spread along with wind and rain and irrigation water remotely, and are the main reasons for causing outbreaks of plant epidemic diseases. Thus, inhibiting zoospore production can further inhibit pathogen infection and pathogenicity to achieve the purposes of cutting off disease circulation and controlling epidemic of plant epidemic diseases caused by phytophthora capsici.
The MesA protein is a polar axis stability related protein which is preserved in pathogenic bacteria and plays an important role in maintaining the normal form of hyphae of corn black powder bacteria (Utililagomaydis), fusarium graminearum (Fusarium graminearum) and aspergillus nidulans (Aspergillus nidulans) and infecting pathogenic bacteria. The MesA homologous proteins are ubiquitous in oomycetes, but their biological functions have not been reported yet.
Disclosure of Invention
The inventors have previously studied that although both the MesA protein of Phytophthora capsici and the MesA protein of filamentous hyphae have Afil (Avl superfamily) and SPA (stabilization ofpolarity axis) domains, the protein homology is less than 25%, which indicates that the oomycete MesA protein may have functional characteristics that are different from the fungal MesA protein. Further bioinformatics analysis shows that the homology of the phytophthora capsici MesA protein and other oomycete MesA proteins is very high and is above 60%. Phylogenetic relation analysis shows that the relatedness of the Phytophthora MesA proteins is closer, the homology of the Phytophthora capsici MesA proteins with the Phytophthora capsici MesA proteins is more than 70%, and the homology of the Phytophthora capsici MesA proteins with the Phytophthora acori (Phytophthora ramorum) MesA proteins is 91.11%. In conclusion, the MesA protein has a high homology in oomycetes, in particular Phytophthora.
Based on this, the inventors found that PcMESA containing the MesA protein conserved domains Afil and SPA was present in Phytophthora capsici. The protein regulates the formation of zoospores, so that the normal infection of oomycetes can be blocked by controlling zoospore development protein PcMesA, and the large-scale spread and epidemic of diseases caused by oomycetes can be controlled (inhibited or blocked).
Thus, the invention provides zoospore development regulatory protein containing Afil and SPA domains in phytophthora, named MesA, which is A1) or A2) or A3) or A4) as follows:
a1 Amino acid sequence is protein shown as SEQ ID NO. 2;
a2 A fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of a protein shown in SEQ ID NO. 2;
a3 A protein derived from a protein shown as SEQ ID NO.2, which has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown as SEQ ID NO. 2;
a4 Amino acid sequence having the same function as the amino acid sequence shown in SEQ ID NO.2 with an amino acid sequence similarity of 60% or more, preferably 70% or more, more preferably 90% or more with SEQ ID NO. 2.
In order to facilitate purification of the protein in A1), a fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein shown in SEQ ID No. 2; the tag may be a tag such as Poly-Arg (RRRRR), poly-His (HHHHH), FLAG (DYKDDDDK), strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.
The growth regulating proteins in A1) -A4) are generally derived from Phytophthora in nature, namely generally, natural products, or can be artificially expressed or synthesized, or can be obtained by synthesizing encoding genes and then biologically expressing the genes. The coding gene of the protein in the A2) -A4) can be obtained by deleting one or more amino acid residues in the DNA sequence shown in SEQ ID No.2 of the sequence list and/or carrying out missense mutation of one or more nucleotide pairs and/or connecting the coding sequences of the tags at the 5 'end and/or the 3' end. Wherein, the sequence of PcMesA of phytophthora capsici (Phytophthora capisici) is shown as SEQ ID NO.2, and SEQ ID NO.2 (MesA) in the sequence table consists of 560 amino acid residues.
It is a further object of the present invention to provide nucleic acid molecules encoding said MesA proteins comprising Afil and SPA domains. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be an RNA, such as mRNA, hnRNA, tRNA or the like.
Wherein the above-mentioned coding gene of the MesA protein is B1) or B2) or B3) as follows:
b1 A DNA molecule shown in a nucleotide sequence shown in SEQ ID NO.1 of the sequence table;
b2 A cDNA molecule or a DNA molecule having 60% or more, 70% or more, or 90% or more identity with the nucleotide sequence shown in B1) and encoding the above PcMesA protein;
b3 Under stringent conditions with a nucleotide sequence defined in B1) or B2), and a cDNA molecule or DNA molecule encoding the above-mentioned PcMesA protein.
In the invention, the DNA sequence (coding gene and cDNA) of the pathogenic regulatory protein can be specifically shown as SEQ ID No.1, wherein SEQ ID No.1 in the sequence table consists of 2028 nucleotides, and the 1 st to 2028 th nucleotides at the 5' end of the sequence 1 are the coding sequences, so as to code the protein (PcMesA) shown as SEQ ID No.2 in the sequence table.
The third invention provides an RNA sequence transcribed from any DNA sequence as described above, preferably the sequence of the RNA molecule is C1) or C2) as follows:
c1 A RNA sequence having the same function as the RNA sequence transcribed from the DNA sequence shown as SEQ ID NO.1 or SEQ ID NO.1, wherein the similarity of the RNA sequence transcribed from the DNA sequence shown as SEQ ID NO.1 is 60% or more, more preferably 70% or more, still more preferably 90% or more;
c2 Most preferably the RNA sequence is transcribed from the DNA sequence shown in SEQ ID NO. 1.
The fourth aspect of the present invention provides a biological material related to the growth regulating protein, the coding gene, or the RNA molecule, which is any one of the following D1) to D10):
d1 An expression cassette containing the coding gene;
d2 A recombinant vector containing the coding gene or a recombinant vector containing the expression cassette of D1);
d3 A recombinant microorganism containing the coding gene, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2);
d4 A transgenic plant cell line comprising said coding gene, or a transgenic plant cell line comprising D1) said expression cassette;
d5 A transgenic plant tissue comprising said coding gene, or a transgenic plant tissue comprising D2) said expression cassette;
d6 A transgenic plant organ comprising said coding gene, or a transgenic plant organ comprising D2) said expression cassette;
d7 A nucleic acid molecule that inhibits expression of the encoding gene; preferably, the nucleic acid molecule is a nucleic acid molecule for knocking out the coding gene, or silencing the coding gene, and can be a coding sequence for expressing an sgRNA fragment targeting the target gene to be knocked out, such as an sgRNA sequence (coding sequence) AACATCCCACCATTCCCTCT targeting the PcMesA gene;
d8 Expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing or expressing D7) the nucleic acid molecule, the recombinant vector may include a CRISPR/Cas 9-based gene knock-out method is to express the gene of interest on the Donor vector and sgRNA and Cas9 protein plasmid; the Donor vector is a recombinant vector containing a sequence of 800-1500bp upstream of a target gene to be knocked out, a Donor DNA sequence (can be a gene sequence such as NPTII, GFP or RFP) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are connected in sequence. The sgRNA and Cas9 protein coexpression plasmid is a vector for encoding and expressing a target gene to be knocked out sgRNA fragment and a DNA sequence for expressing Cas9 protein, wherein the target gene to be knocked out is a PcMESA gene, and the target gene to be knocked out has a sgRNA sequence (encoding sequence) of AACATCCCACCATTCCCTCT. Preferably, the sgRNA and Cas9 coexpression plasmid is prepared by taking pYF515 carrier as a starting carrier, inserting double-chain sgRNA coding sequence obtained by annealing the sgRNA of PcMesA gene between Nhe I and Bsa I enzyme recognition sites of pYF carrier to obtain the sgRNA and Cas9 coexpression plasmid;
d9 A nucleic acid molecule that inhibits translation of the RNA molecule;
d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing D9) said nucleic acid molecule.
The fifth object of the present invention is to provide phytophthora capsici PcMesA protein and the use of nucleic acid molecules encoding the PcMesA protein or biological materials containing nucleic acid molecules encoding the PcMesA protein.
The application is any one or more of the following 1) -5):
1) The application in regulating (increasing or decreasing) the yield of oomycete zoospores;
2) Use in modulating (increasing or decreasing) the ability of oomycetes to infect a host;
3) Use in inhibiting and/or killing oomycetes.
Preferably, among said uses, use is made of 1) to 3) by inhibiting transcription or inactivating the coding gene of sequence 1, or inhibiting translation of said RNA molecule, or inhibiting and/or inactivating the activity of the pcmasa protein of sequence 2.
In such applications, zoospore production of oomycetes and the ability to regulate the infecting host is affected by inhibiting transcription of the coding gene as described above, or inhibiting translation of the RNA sequence as described above, or inhibiting and/or inactivating the activity of the PcMesA protein as described above.
The sixth purpose of the invention is to provide the application of the PcMESA protein shown in SEQ ID NO.2 in the sequence table, the coding gene shown in SEQ ID NO.1 in the sequence table, or the RNA molecule, the biological material or the protein or DNA as claimed in claim 5 in screening oomycete bacteriostasis and/or bactericide as a bacteriostasis or bactericide target; the antibacterial or bactericidal agent can inhibit the generation of zoospores by inhibiting or inactivating PcMesA protein shown in the oomycete SEQ ID NO.2, so that the oomycete can be inhibited or killed. Preferably, the cDNA sequence of the pathogenic regulatory protein is a DNA sequence shown as SEQ ID No. 1. Preferably, the method is used for inhibiting and/or killing oomycete-induced oomycete diseases on production.
The oomycete is preferably phytophthora, more preferably phytophthora capsici (Phytophthora capsici).
The seventh object of the present invention is to provide a method for screening or assisting in screening of an antibacterial and/or bactericidal agent against oomycetes (such as phytophthora capsici, in particular phytophthora capsici), which comprises applying a test substance to said oomycetes, wherein said test substance is a candidate plant oomycete antibacterial and/or bactericidal agent when said test substance is capable of inhibiting transcription of the above DNA sequence, or inhibiting translation of the above RNA sequence, or inhibiting and/or inactivating the activity of the above measa protein.
The eighth object of the present invention is to provide a method for reducing the activity of oomycetes, comprising the steps of: inhibiting transcription of a coding gene as described above, or inhibiting translation of said RNA molecule, or inhibiting and/or inactivating the activity of a measa protein as described above;
the invention also provides a method for reducing the infection capability of oomycetes, which is to reduce the infection capability of oomycetes by inhibiting the generation of zoospores of oomycetes (such as phytophthora capsici, in particular phytophthora capsici).
In the method, the generation of zoospores of oomycetes is inhibited by knocking out any one of the DNA sequences. The oomycete is preferably phytophthora, more preferably phytophthora capsici, such as phytophthora capsici BYA strain (Phytophthora capsici).
In one embodiment of the present invention, wherein the above described methods of gene knockout and back-filling employ CRISPR/Cas 9-based gene knockout methods.
Specifically, the CRISPR/Cas 9-based gene knockout and anaplerotic method is to select a Donor vector of a target gene, sgRNA and Cas9 co-expression plasmid transfection oomycetes to obtain recombinant bacteria inactivated by the target knockout protein.
The knockout related vector is a recombinant vector containing a sequence of 800-1500bp upstream of a target gene to be knocked out (a gene sequence of NPTII, GFP, RFP or the like) and a sequence of 800-1500bp downstream of the target gene to be knocked out, which are sequentially connected; the repair related vector is a recombinant vector which sequentially contains a sequence of 800-1500bp upstream of the target gene, a Donor DNA (PcMesA gene sequence) and a sequence of 800-1500bp downstream of the target gene.
The sgRNA and Cas9 protein coexpression plasmid is a vector for encoding and expressing a sgRNA fragment of a target gene to be knocked out and a DNA sequence for expressing Cas9 protein, wherein the target gene to be knocked out is PCMesA gene and GFP gene, the sgRNA sequence (encoding sequence) of the target PcMesA gene is AACATCCCACCATTCCCTCT, and the sgRNA sequence (encoding sequence) of the target GFP gene is CCACGGAACAGGGAGCTTTC.
Preferably, the sgRNA and Cas9 coexpression plasmid is obtained by taking pYF515 vector as a starting vector, respectively inserting double-stranded sgRNA coding sequences obtained by annealing the PcMesA gene and the GFP gene between Nhe I and Bsa I enzyme recognition sites of pYF vector, and obtaining the sgRNA and Cas9 coexpression plasmid.
In the above application, the substance that inhibits the expression and/or activity of PcMesA is a substance that inhibits the expression and/or transcription of its encoding gene and/or translation of an RNA molecule resulting from transcription of the encoding gene of PcMesA.
Experiments prove that the MesA protein provided by the invention plays a role in the zoospore development process of phytophthora. By PEG-CaCl 2 The knockdown mutant obtained by combining a mediated protoplast transformation technology and a CRISPR/Cas9 gene editing technology has obviously changed zoospore growth and development compared with a wild type parent strain, and mainly comprises the following components: the sporangia content was unable to divide normally after the loss of the measa protein and form zoospores of normal morphology. Therefore, the phytophthora zoospore development regulatory protein MesA can play an important role in the asexual propagation process of the phytophthora, and further cut off disease circulation to influence infection of oomycetes on plants. The invention provides technical support for further exploring zoospore formation process and pathogenic mechanism of phytophthora and oomycetes, and provides technical foundation for prevention and treatment of plant epidemic diseases caused by oomycetes and research and development of novel bactericides.
Drawings
FIG. 1 is a schematic representation of the PcMesA domain of Phytophthora capsici, comprising Afil and SPA domains.
FIG. 2 is a cluster analysis of MesA proteins from different species. (note: the numbers on the branch lines represent the evolutionary branch lengths, shorter branch lengths represent smaller differences and closer evolutionary distances).
FIG. 3 shows the growth rate of mycelia, the number of sporangia and the pathogenic symptoms of infection of tobacco leaves, sporangia and zoospore morphology of the wild Phytophthora capsici strain BYA (WT), the PcMesA gene knockout mutants ΔMesA-T1, ΔMesA-T2 and the PcMesA gene knockout anaplerotic strain ΔMesA-T1. Wherein a in fig. 3 is the morphological characteristics of pathogenic bacteria or symptoms of infection; b in fig. 3 is a histogram of data statistics.
Detailed Description
The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Phytophthora capsici wild-type strain BYA is stored by the seed pathology and bactericide pharmacology laboratory at the university of agriculture, china, and is disclosed in the literature, "Wang, W., et al, pcmuoP 1, an Oxathiapiprolin-Resistance Gene, functions as aNovel Selection Marker for Phytophthora Transformation and CRISPR/Cas 9-Mediated Genome edition, front in Microbiology,2019.10," and is publicly available from the university of agriculture.
The culture medium and the reagent formula used in the study:
commonly used V8 medium: 340mL V8,4.76g CaCO 3 Deionized water is fixed to 3.4L, and 51g of agar is added to prepare a solid culture medium, and the culture medium is sterilized by high-pressure moist heat at 121 ℃ for 20min.
PM medium (Pea Mannitol): adding 125g pea into 1L deionized water, sterilizing at 121deg.C for 20min, filtering with gauze to obtain pea soup, adding Mannitol 91.1g, caCO 3 2 g，CaCl 2 1, g, distilled water to a constant volume of 1L, adding 15g of agar powder into the solid culture medium, and sterilizing at 121 ℃ for 20min.
The media used for the knockout transformation experiments were as follows:
NPB medium (Nutrient pea broth): adding 125g pea into 1L deionized water, sterilizing at 121deg.C for 20min, filtering with gauze to obtain pea soup, adding Yeast Extract 2.0g, glucose 5.0g, mannitol 5.0g, sorbitol 5.0g, caCO 3 2.0 g、CaCl 2 0.1 g、MgSO 4 0.5g、MgSO 4 0.5 g、KNO 3 3.0 g、K 2 HPO 4 1.0 g、KH 2 PO 4 1.0 g, the volume is fixed to 1L by deionized water. If the solid culture medium is prepared, 15g of agar powder is added, and the culture medium is sterilized at 121 ℃ for 20min. After sterilization, the filtered Vitamin stock 2mL (Folic acid 6.7X10) was added to the solution -7 g/mL；Pyridoxine-HCl 6.0×10 -4 g/mL；Biotin 6.7×10 -7 g/mL；Thiamine-HCl1.3×10 -3 g/mL；L-inositol 4.0×10 -5 g/mL；Nicotinic acid 4.0×10 -5 g/mL；Riboflavin 5.0×10 -5 g/mL) and Vitamin stock 2mL (FeC 6 H 5 O 7 ·3H 2 O 5.4×10 -4 g/mL；Na 2 MoO 4 ·H 2 O 3.0×10 - 5 g/mL；ZnSO 4 ·7H 2 O 3.8×10 -4 g/mL；
MgSO 4 ·H 2 O 3.8×10 -5 g/mL；H 3 BO 3 2.5×10 -5 g/mL；CuSO 4 ·5H 2 O 7.5×10 -4 g/mL)
The knockout conversion test reagents were formulated as follows:
enzymolysis liquid: in the present preparation, lyase (Lysing Enzymes from Trichoderma harzianum, L1412, sigam) 0.12g, cellulase (yakult R10) 0.12g,0.8M Mannitol 10mL, ultrapure water 8mL,0.5M KCl 800. Mu.L, 0.5M MES (pH 5.7) 800. Mu.L, 0.5M CaCl 2 400. Mu.L, 0.22. Mu.M filter membrane.
W5 solution: KCl 0.1g, caCl 2 ·2H 2 O4.6g,NaCl 2.25g,Glucose 7.8g, the ultrapure water is dissolved to 250mL and the volume is fixed, and a 0.22 mu m filter membrane is used for filtration sterilization.
PEG-CaCl 2 Solution (40% w/v): ready-to-use, 6g PEG4000,0.8M Mannitol3.75mL, 3mL of ultrapure water, 0.5M CaCl 2 3mL, 0.22 μm filter and sterilize.
MMG solution (250 mL): mannitol 18.22g,0.5M MES (pH 5.7) 2.0mL, mgCl 2 ·6H 2 O0.76 g, ultrapure water to 250mL, and 0.22 μm filter membrane filtration sterilization.
Example 1 acquisition of growth and development regulatory protein PcMESA in Phytophthora capsici and its coding Gene and homology comparison of PcMESA protein with MesA protein in plant pathogenic bacteria
In this example, the zoospore development regulatory protein PcMesA of Phytophthora capsici and its coding gene (or cDNA) can be obtained by amplifying the DNA (or cDNA) of Phytophthora capsici strain BYA5 as a template by the primers shown in Table 1. Wherein the DNA or RNA extracted material can be mycelium of Phytophthora capsici strain BYA. Wherein, the DNA of phytophthora capsici strain BYA is used as a template, pcMESA-F and PcMESA-R are used for amplifying to obtain the PcMESA coding gene PcMESA, as shown by SEQ ID NO.1 in a sequence table, SEQ ID NO.1 is composed of 2028 nucleotides, the 5' -end 1-2028 nucleotides of SEQ ID NO.1 are taken as coding sequences, the protein (PcMESA) shown by SEQ ID NO.2 in the sequence table is coded, and the protein comprises an Afi1 domain and an SPA domain, wherein the sequence of the Afi1 domain is the amino acid residue sequence from the 13 th to 111 th amino acid residues of the amino terminal of SEQ ID NO.2, and the sequence of the SPA domain is the amino acid residue sequence from the 242 th to 364 amino terminal of SEQ ID NO. 2. The cDNA of phytophthora capsici strain BYA is used as template and amplified with PcMESA-F and PcMESA-R to obtain PcMESA cDNA with the sequence the same as the encoding gene sequence shown in SEQ ID NO. 1. The above proteins or genes may also be synthesized artificially.
TABLE 1 PcMESA full-length coding gene amplification primers
Cluster analysis and homology comparison showed that although both the lysa protein of phytophthora capsici and the lysa protein of filamentous hyphae had Afil (Avl superfamily) and SPA (stabilization ofpolarity axis) domains, both the PcMesA protein and the lysa protein of oomycetes were less than 25% homologous, as shown in table 2, indicating that the oomycete lysa protein may have functional characteristics that are different from the fungal lysa protein. Further bioinformatics analysis shows that the phytophthora capsici MesA protein and other oomycete MesA proteins have high homology, which is above 60%. Phylogenetic relationship analysis As shown in FIG. 2, the phylogenetic relationship of the Phytophthora MesA proteins was found to be more recent. The homology of the phytophthora capsici MesA and the protein thereof is above 70%, wherein the homology of the phytophthora capsici MesA and the protein of the phytophthora acori (Phytophthora ramorum) MesA is 91.11%. In conclusion, the MesA protein has a high homology in oomycetes, in particular Phytophthora.
TABLE 2 comparison of the homology of the PcMESA protein and the MesA protein in fungi
TABLE 3 comparison of homology of the PcMESA protein with the MesA protein in oomycetes
EXAMPLE 2 construction of Phytophthora capsici PcMESA Gene knockout and anaplerotic vector
CRISPR/Cas 9-based gene knockout and complementation vector construction methods and related vector sequences and GFP gene sequences in this example are disclosed in the literature "Fang, y., andTyler, b.m. (2016) Efficient disruption and replacement ofan effector gene inthe oomycete Phytophthora sojaeusing CRISPR/cas9.molecular plan, 17 (1), 127-139," and "Fang, y., cui, l., gu, b., arrendo, f., and Tyler, b.m. (2017), efficient genome editing inthe oomycete Phytophthora sojae using CRISPR/cas9.curr. Protoc. Microbiol.44,21a.1.1-21a.1.26. The pBluescript II SK + homology arm vector plasmid (doser vector) used in this example, sgRNA and Cas9 co-expression plasmid PYF515 were both given by the brettm.tyler professor of oregon state university, usa.
The Gene sequences of the insert pcmeuop 1 used in this example are disclosed in the literature "Wang, w., xue, z., miao, j., cai, m., zhang, c, li, t., zhang, b., tyler, b.m. and Liu, x. (2019) pcmeuop 1, an Oxathiapiprolin-Resistance Gene, functions as aNovel Selection Marker forPhytophthoraTransformation and CRISPR/Cas 9-Mediated Genome enhancement.front.
The knockout related Donor vectors pBS-GFP-MesA, sgRNA and Cas9 used in this embodiment are coexpression plasmids pYF515-MesA, and the coexpression plasmid pYF515-PcMUORP1-MesA with a fluorothiazolyl pyrithione selection marker; the vector related to the back filling is the Donor vector pBS-MesA, and the co-expression plasmid pYF-PcMUORP 1-GFP with the fluorothiazole pyraflidone screening marker. The specific construction method is as follows:
the Donor vectors pBS-GFP-MesA, pBS-MesA used in this embodiment; the specific construction methods of the sgRNA and Cas9 coexpression plasmids pYF-MesA and pYF-GFP are as follows:
1) Construction of pBS-GFP-MesA: the DNA of phytophthora capsici strain BYA5 was used as a template, and the target gene Pcmesa upstream 1000bp sequence (shown In sequence 3 In the sequence table, obtained by amplifying primers shown In Table 2, pBS-GFP-MesA-F1 and pBS-GFP-MesA-R1) was amplified using primers designed for TaKaRa-In-fusion_tools on-line website (http:// www.clontech.com/US/Products/cloning_and_component_cells/cloning_resources/online_in-fusion_tools) and GFP gene sequence (shown In sequence table 5, GFP gene was obtained by amplifying primers shown In Table 2, pBS-GFP-MesA-F2 and pBS-GFP-MesA-R2 using pTOR backbone plasmids as templates), and Pcmesa downstream 1000bp sequence (shown In sequence 4 In the sequence table, obtained by amplifying primers shown In Table 2, pBS-GFP-MesA-F3 and pBS-MesA-R3) was amplified using primers shown In Table 2HD Cloning Kit sequentially fusion-links three amplified fragments into Cloning vector pBluescript II SK + (EcoRI and BamHI double cleavage), the ligation product was transferred into E.coli DH 5. Alpha. Competent cells, and after overnight incubation at 37℃was picked up and the monoclonal was amplified using the universal primer M13F (sequence:
5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') amplified and sequenced to verify cloning, and the recombinant expression vector containing the 1000bp upstream of PcMesA, the GFP gene sequence and the 1000bp downstream of PcMesA, which are connected in sequence, which is verified to be correct, was named pBS-GFP-MesA.
2) Construction of pYF 515-MesA: the website EuPaGDT was designed with sgRNA (http: the nucleotide sequence 1051-1070 of SEQ ID No.1 targeted to the Pcmesa gene was transferred to a company's synthesis kit (http:// rn. Url. Catheter. Edu/RNAstructureWeb/Servers/Prerect 1.Ht mL), a double-stranded sRNA sequence was synthesized by annealing with sterile water, a 3. Mu.l sense strand solution, 3. Mu.l 10 XT 4 DNA Ligase Buffer (NEB), 4. Mu.l 0.5M, 21. Mu.l ultra-sterile water at 100℃and 2 XF 5 XF 35, a solution of 35. Mu.l ultra-sterile water was used to mix the Pcmesa gene, and a solution of 35. Mu.l of 5 XF was used to verify that the PCR kit was carried out, and the PCR kit was carried out by diluting the DNA sequence of the DNA sequence to a solution of 35. Mu.l 35F, 35. Mu.l of 35F, and allowing the PCR kit to be carried out with sterile water to obtain a solution of 100. Mu.M, 3. Mu.l 10 XT 4 (NEB) and a solution of 3. Mu.l sense strand, 3. Mu.l 10 XT 4 (NEB) to obtain a solution of 3. Mu.l, 4. Mu.l ultra-sterile water, and a solution of 3. Mu.l 10 XT 4. Mu.l 5 XT 4. Mu.L 5. Mu.5 to be used to mix the DNA sequence, and to verify that the PCR kit was carried out after the PCR kit was carried out, and the PCR kit was carried out after the PCR kit was carried out to verify that the PCR kit was carried out to a solution was carried out to obtain a solution with a solution of Pcmelam 35. Mu.35. 35. And a solution with a solution of PcmeI and a solution of PcP, and a solution of HH solution, and a solution was diluted solution was prepared by a solution.
3) Construction of pBS-MesA: the DNA of Phytophthora capsici strain BYA5 was used as a template, and primers were designed to amplify the 1000bp upstream sequence of the desired gene PcMESA (shown In SEQ ID NO: 3 In the sequence Listing, obtained by amplifying primers shown In Table 2 as pBS-MesA-F1 and pBS-MesA-R1), the PcMESA gene sequence (shown In SEQ ID NO: 1 In the sequence Listing, obtained by amplifying fragments shown In Table 2 as pBS-MesA-F2 and pBS-MesA-R2), and the 1000bp downstream sequence of PcMESA (shown In SEQ ID NO: 4 In the sequence Listing, obtained by amplifying primers shown In Table 2 as pBS-MesA-F3 and pBS-MesA-R3) were usedHD Cloning Kit sequentially fusion-links three amplified fragments into Cloning vector pBluescript II SK +
(EcoRI and BamHI double cleavage), the ligation product was transferred into E.coli DH 5. Alpha. Competent cells, and after overnight incubation at 37℃was picked up and the monoclonal was amplified using the universal primer M13F (sequence:
5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3') amplified and sequenced to verify cloning, the recombinant expression vector containing the 1000bp upstream, the PcMESA gene sequence and the 1000bp downstream of the PcMESA sequence, which are connected in sequence, which is verified to be correct, was named pBS-MesA.
4) Construction of pYF 515-GFP: the website EuPaGDT was designed with sgRNA (http: v/grna.ctegd.uga.edu /) and RNA structure online analysis tool (http: the// RNA. Urmc. Rochester. Edu/RNAstructureWeb/Servers/pretreatment 1.Ht mL), selects for specific targeting of the GFP gene and forms a sgRNA sequence with weaker secondary structure (sgGFP: CCACGGAACAGGGAGCTTTC targeting GFP gene at position 152-171 of SEQ ID No.5 was transferred to a company to synthesize forward and reverse sgRNA sequence primers with NheI and BsaI cleavage sites and HH ribozyme, and dissolved in sterile water to 100. Mu.M solution, annealing to synthesize double-stranded sgRNA sequence, 3. Mu.L sense strand solution, 3. Mu.L antisense strand solution, 3. Mu.L 10 XT 4 DNA Ligase Buffer (NEB), 4. Mu.L 0.5M NaCl, 21. Mu.L ultrapure sterile water, pipetting and mixing, allowing 2min at 100℃to cool naturally to room temperature, diluting the reaction solution 500 times, taking 2. Mu.L 10 XT 4 DNA Ligase Buffer (NEB), 50ng pYF515 vector (NheI/Bsa I double cleavage), 4. Mu.L double-stranded sgRNA solution after dilution, 1. Mu. l T DNA Ligase, ultrapure water to 20. Mu.L, allowing room temperature reaction to transfer GFP to 5. Mu.L of 5 XT 4 (NEB), allowing the PCR product to stand in 35. Mu.L of 5 XT, allowing the PCR to stand for 35. Mu.L 5 XdF to be carried out, and verifying that the PCR sequence was positive for PCR sequence expression of the PCR-35. Mu.L of the PCR-35. Mu.C cell-35 g of the PCR-35-5. Mu.L cloning vector.
TABLE 4 primer sequences for vector construction
EXAMPLE 3 obtaining of Phytophthora capsici PcMESA Gene knockout and anaplerotic transformant
PEG-CaCl is adopted 2 Methods of mediated protoplast transformation to prepare PcMesA knock-out transformants and PcMesA gene-complemented transformants, methods of genetic transformation of oomycetes are disclosed in the literature "Wang, Z., tyler, B.M., liu, X.protocol ofPhytophthoracapsici transformation using the CRISPR-Cas9 system.plant Pathogenic Fungi and Oomycetes Humana Press, newYork, NY, 2018:265-274".
The obtaining of the PcMESA knock-out transformant specifically comprises transferring the Donor vector, sgRNA and Cas9 coexpression plasmid (pBS-GFP-MesA and pYF-MesA) of the knock-out gene PcMESA obtained in example 1 into protoplast of Phytophthora capsici BYA, culturing and screening the grown transformant by using OX-resistant V8 solid medium plate at 25 ℃, collecting mycelium of suspected transformant, extracting DNA for PCR sequencing verification, and re-extracting RNA from positive transformant for qPCR verification. PcMESA knockout transformants (. DELTA.MesA-T1,. DELTA.MesA-T2) were obtained.
The obtaining of the PcMESA gene anaplerotic transformant comprises transferring the Donor vector, sgRNA and Cas9 coexpression plasmid (pBS-MesA and pYF 515-GFP) of the gene GFP to be knocked out obtained in example 1 into protoplast of PcMESA knocked out mutant strain ΔMesA-T1 of Phytophthora capsici, culturing and screening the grown transformant by using OX-resistant V8 solid medium flat plate at 25 ℃, collecting mycelium of suspected transformant, extracting DNA for PCR sequencing verification, re-extracting RNA from positive transformant for qPCR verification. PcMESA back-knockdown transformants (. DELTA.MesA-T1:: mesA) were obtained.
EXAMPLE 4 biological trait analysis of Phytophthora capsici PcMesA knockout and anaplerotic transformants
1. Hypha growth rate assay
Wild Phytophthora capsici strain BYA and the knockout transformants obtained in example 3, namely, the PcMESA knockout transformants (. DELTA.MesA-T1,. DELTA.MesA-T2) and the anaplerotic transformants (. DELTA.MesA-T1:: mesA) were inoculated into a V8 solid medium (15 mL of the medium was poured into a 9cm dish) and cultured for 4 days at 25℃in the dark, and the colony diameters of the respective strains were measured by the crisscross method and repeated 3 times per strain.
The results showed that all the measured mycelial growth rates of the PcMesA knockout transformant strains were not significantly different from that of the wild-type phytophthora capsici strain BYA (fig. 3).
2. Sporangium quantity detection
The wild phytophthora capsici strain BYA and the knockout transformants ΔMesA-T1, ΔMesA-T2 and the reintegration transformant ΔMesA-T1 obtained in example 3 were inoculated with a V8 solid medium (15 mL medium was poured into a 9cm dish), cultured for 4d in the dark at 25℃and cultured for 5d under light at 25℃to induce sporulation, and the morphology of sporangia on the dish was observed by a microscope and counted, and each strain was repeated 3 times.
The results showed that the knockdown transformants ΔMesA-T1, ΔMesA-T2 obtained in example 3 produced no significant difference in sporangia numbers and wild type compared to the wild type Phytophthora capsici strain BYA.
3. In vitro leaf pathogenicity detection of transformants
The tobacco plant variety to be tested is Benshi tobacco, which is planted in a seedling tray, the culture medium is turfy soil, and the tobacco plant variety to be tested grows to 4 to 6 weeks for standby. The wild Phytophthora capsici strain BYA and the knockout transformants ΔMesA-T1, ΔMesA-T2 and the complementation transformant ΔMesA-T1 obtained in example 3 were inoculated with a V8 solid medium (15 mL of the medium was poured into a 9cm dish), cultured for 4 days at 25℃in the dark, and 5mm cakes were removed from the edges of the colonies by a puncher. Tobacco leaves with the same leaf position are collected, a bacterial cake is inoculated in the center of the leaf vein, 5 leaves are inoculated in each bacterial strain, and after the tobacco leaves are cultured for 4 days in the dark at 25 ℃ and moisture preservation (RH=60% -80%), the diameter (mm) of the lesions of the phytophthora capsici infected pepper leaves is measured by a crisscross method. The results showed that the knock-out transformants ΔMesA-T1, ΔMesA-T2 obtained in example 3 were not significantly different in hyphae pathogenicity and wild type compared to wild type Phytophthora capsici strain BYA.
4. Zoospore quantity detection
The wild type Phytophthora capsici strain BYA (WT) and the knockout transformants ΔMesA-T1, ΔMesA-T2 and the reintegration transformant ΔMesA-T1 obtained in example 3 were inoculated with MesA respectively in the center of a sterile dish (diameter 9 cm) to which 15ml of V8 solid medium was added, cultured in the dark at 25℃for 3 days, cultured in the light at 25℃for 5 days to induce sporulation, after which 10ml of deionized water was added, placed at 4℃for 30 minutes, and then transferred at 25℃for 30 minutes to release zoospores, the zoospore suspension was vortexed for 1 minute to stop the zoosis, and the number of zoospores was counted by microscopic observation using a hemocytometer, and each strain was set 3 times.
The results show that the PcMESA knock-out transformant obtained in example 3 does not release zoospores of normal morphology compared to the wild type Phytophthora capsici strain BYA (WT) and the anaplerotic transformant ΔMesA-T1:: mesA, indicating that the PcMESA protein affects the number of zoospores of Phytophthora capsici. Therefore, the zoospore regulation egg PcMesA of the phytophthora capsici is a key protein for the development of zoospores, and the infection process of the phytophthora capsici can be controlled, the disease circulation can be cut off and the large-scale occurrence of the diseases can be controlled by inhibiting the function of the protein.

Claims (9)

1. Zoospore development regulating measa proteins containing Afil and SPA domains from Phytophthora (Phytophthora spp.) are proteins of the following A1) or A2) or A3) or A4):
a1 A protein consisting of the amino acid sequence shown in SEQ ID No. 2;
a2 Fusion proteins obtained by ligating tags at the N-terminal and/or C-terminal of the protein shown in SEQ ID No. 2;
a3 Protein which is derived from A1) by substitution and/or deletion and/or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID No.2 and is related to phytophthora capsici growth and development;
a4 Amino acid sequence having the same function as the amino acid sequence shown in SEQ ID No.2, with the similarity to the amino acid sequence shown in SEQ ID No.2 being 60% or more, preferably 70% or more, more preferably 90% or more.
2. A coding gene encoding the zoospore development regulatory protein PcMesA shown in claim 1; preferably, the coding gene is B1) or B2) or B3) as follows:
b1 A DNA molecule represented by the nucleotide sequence shown in SEQ ID No. 1;
b2 A cDNA molecule or a DNA molecule having 60% or more, or 70% or more, or 90% or more identity with the nucleotide sequence shown in B1) and encoding the protein of claim 1;
b3 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in B1) or B2) and which codes for a protein according to claim 1.
3. An RNA molecule transcribed from the coding gene of claim 2;
preferably, the sequence of the RNA molecule is C1) or C2) as follows:
c1 A RNA sequence having a similarity of 60% or more, more preferably 70% or more, still more preferably 90% or more, to the RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 1;
c2 RNA sequence transcribed from the DNA sequence shown in SEQ ID No. 1.
4. The biological material related to the growth and development regulatory protein PcMesA as set forth in claim 1, the coding gene as set forth in claim 2, or the RNA molecule as set forth in claim 3 is any one of the following D1) to D10):
d1 An expression cassette comprising the coding gene of claim 2;
d2 A recombinant vector comprising the coding gene of claim 2 or a recombinant vector comprising the expression cassette of D1);
d3 A recombinant microorganism comprising the coding gene of claim 2, or a recombinant microorganism comprising the expression cassette of D1), or a recombinant microorganism comprising the recombinant vector of D2);
d4 A transgenic plant cell line comprising the coding gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);
d5 A transgenic plant tissue comprising the coding gene of claim 2, or a transgenic plant tissue comprising the expression cassette of D2);
d6 A transgenic plant organ comprising the coding gene of claim 2, or a transgenic plant organ comprising the expression cassette of D2);
d7 A nucleic acid molecule which inhibits the expression of the coding gene of claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the encoding gene of claim 2, or that silences the encoding gene of claim 2;
d8 An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing or expressing D7) said nucleic acid molecule;
d9 A nucleic acid molecule that interferes with translation of the RNA molecule of claim 3;
d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing D9) said nucleic acid molecule.
5. Use of the growth and development regulatory protein PcMesA of claim 1, the coding gene of claim 2, or the RNA molecule of claim 3, or the biological material of claim 4, for regulating zoospore formation or regulating oomycete pathogenicity;
preferably, the oomycete is preferably phytophthora, preferably phytophthora capsici (Phytophthora capsici).
6. Use of the growth and development regulatory protein PcMesA of claim 1, the coding gene of claim 2, or the RNA molecule of claim 3, or the biological material of claim 4 as a screening inhibitor in pesticide formulations for regulating zoospore production and/or development of oomycetes;
preferably, this use is achieved by inhibiting transcription in or inactivating the coding gene according to claim 2, or inhibiting translation of the RNA molecule according to claim 3, or inhibiting and/or inactivating PcMesA that modulates zoospore development according to claim 1.
7. Use of the PcMesA protein of claim 1, the coding gene of claim 2, or the RNA molecule of claim 3, or the biomaterial of claim 4 as a bacteriostatic or bacteriocidal target for screening oomycetes for bacteriostasis or bacteriocidal.
8. A method of screening or assisting in the screening of an oomycete for a bacteriostatic and/or bactericidal agent, the method comprising applying an agent to be detected to the oomycete, wherein the agent to be detected is a bacteriostatic and/or bactericidal agent for the oomycete when the agent is capable of inhibiting transcription of the coding gene according to claim 2, or inhibiting translation of the RNA molecule according to claim 3, or inhibiting or inactivating the pcmasa protein according to claim 1.
9. A method for reducing the capability of oomycetes to infect a host is to cut off disease circulation and reduce the capability of oomycetes to infect the host by inhibiting the formation of zoospores; the host is Capsici fructus, tobacco, and crop of Leguminosae or Cucurbitaceae.
CN202311067601.XA 2023-08-23 2023-08-23 Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof Active CN117088948B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311067601.XA CN117088948B (en) 2023-08-23 2023-08-23 Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311067601.XA CN117088948B (en) 2023-08-23 2023-08-23 Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN117088948A true CN117088948A (en) 2023-11-21
CN117088948B CN117088948B (en) 2024-05-14

Family

ID=88781709

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311067601.XA Active CN117088948B (en) 2023-08-23 2023-08-23 Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN117088948B (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000053762A2 (en) * 1999-03-09 2000-09-14 Syngenta Participations Ag Plant disease resistance associated genes and uses thereof
US20020022012A1 (en) * 2000-06-09 2002-02-21 Cooper Stuart L. Dendrimer biocide-silver nanocomposites: their preparation and applications as potent antimicrobials
DE10221725A1 (en) * 2001-09-13 2003-04-03 Bayer Cropscience Ag Glyoxal oxidases from fungi
WO2013056307A1 (en) * 2011-10-17 2013-04-25 Deakin University Phytophthora phospholipase c
CN104117072A (en) * 2014-07-18 2014-10-29 山东大学 Multivalent adenovirus vaccine for preventing toxoplasmosis
US20180148708A1 (en) * 2014-08-12 2018-05-31 Purdue Research Foundation Composites material with suspended particles and method of using the same
WO2020007646A1 (en) * 2018-07-02 2020-01-09 Basf Se Pesticidal mixtures
CN115925838A (en) * 2021-08-17 2023-04-07 中国农业大学 Phytophthora capsici STT3B protein and coding gene and application thereof
CN116425843A (en) * 2022-04-19 2023-07-14 中国农业大学 Phytophthora capsici growth and development regulation protein PcAGO1, and coding gene and application thereof
CN116574161A (en) * 2022-04-19 2023-08-11 中国农业大学 Phytophthora capsici growth and development regulation protein PcAGO5, and encoding gene and application thereof

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000053762A2 (en) * 1999-03-09 2000-09-14 Syngenta Participations Ag Plant disease resistance associated genes and uses thereof
US20020022012A1 (en) * 2000-06-09 2002-02-21 Cooper Stuart L. Dendrimer biocide-silver nanocomposites: their preparation and applications as potent antimicrobials
DE10221725A1 (en) * 2001-09-13 2003-04-03 Bayer Cropscience Ag Glyoxal oxidases from fungi
WO2013056307A1 (en) * 2011-10-17 2013-04-25 Deakin University Phytophthora phospholipase c
CN104117072A (en) * 2014-07-18 2014-10-29 山东大学 Multivalent adenovirus vaccine for preventing toxoplasmosis
US20180148708A1 (en) * 2014-08-12 2018-05-31 Purdue Research Foundation Composites material with suspended particles and method of using the same
WO2020007646A1 (en) * 2018-07-02 2020-01-09 Basf Se Pesticidal mixtures
CN115925838A (en) * 2021-08-17 2023-04-07 中国农业大学 Phytophthora capsici STT3B protein and coding gene and application thereof
CN116425843A (en) * 2022-04-19 2023-07-14 中国农业大学 Phytophthora capsici growth and development regulation protein PcAGO1, and coding gene and application thereof
CN116574161A (en) * 2022-04-19 2023-08-11 中国农业大学 Phytophthora capsici growth and development regulation protein PcAGO5, and encoding gene and application thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
JIAN ZHANG等: "SlCML55, a novel Solanum lycopersicum calmodulin-like gene, negatively regulates plant immunity to Phytophthora pathogens", SCIENTIA HORTICULTURAE, vol. 299, 1 June 2022 (2022-06-01), pages 111049 *
VOGEL, G.等: "hypothetical protein DVH05_026893 [Phytophthora capsici]", GENBANK DATABASE, 12 January 2021 (2021-01-12), pages 1691401 *
刘西莉等: "辣椒疫霉Sec4同源基因敲除及其功能初探", 中国植物病理学会2019年学术年会论文集, 20 July 2019 (2019-07-20), pages 255 *
张德锋等: "贝莱斯芽孢杆菌的分类、拮抗功能及其应用研究进展", 微生物学通报, vol. 47, no. 11, 31 December 2020 (2020-12-31), pages 3634 - 3649 *

Also Published As

Publication number Publication date
CN117088948B (en) 2024-05-14

Similar Documents

Publication Publication Date Title
Takaichi et al. Transgenic carrots with enhanced resistance against two major pathogens, Erysiphe heraclei and Alternaria dauci
CN116574161A (en) Phytophthora capsici growth and development regulation protein PcAGO5, and encoding gene and application thereof
CN106244599A (en) A kind of Radix Notoginseng pathogenesis-related proteins 1 family gene PnPR1 2 and application
Meng et al. Novel factors contributing to fungal pathogenicity at early stages of Setosphaeria turcica infection
CN111534525A (en) Fusarium graminearum FgARL1 gene and application thereof
CN114369147B (en) Application of BFNE gene in tomato plant type improvement and biological yield improvement
CN108588041B (en) Gossypium barbadense cytochrome P450 gene, and coding protein and application thereof
CN111808178B (en) Phytophthora sojae NCR protein and coding gene and application thereof
CN116425843A (en) Phytophthora capsici growth and development regulation protein PcAGO1, and coding gene and application thereof
CN114989273B (en) Gene PlMYB1R and application thereof in preventing and treating downy mildew of litchi
CN115925838A (en) Phytophthora capsici STT3B protein and coding gene and application thereof
CN117088948B (en) Phytophthora capsici zoospore development regulation related protein, and coding gene and application thereof
CN111808179B (en) Phytophthora sojae 4 NCR protein and its coding gene and application
CN112458110B (en) Application of plant disease-resistant gene AtIQD1
CN115261386A (en) Double-stranded RNA molecule of targeted silent phytophthora capsici oxysterol binding protein 1 and application
CN113969270A (en) Application of plant infection-related protein TaCIPK14 in regulation and control of stripe rust resistance of plants
CN115010795B (en) Phytophthora capsici regulating extracellular vesicle secretion key protein, and encoding gene and application thereof
CN111979210A (en) Phytophthora capsici cellulose synthase protein and coding gene and application thereof
CN110305893B (en) Gossypol biosynthetic pathway gene CYP71BE79 and application thereof
JP2007306917A (en) Method for increasing the resistance of rice plant to pathogenic microorganism and pathogenic microorganism-resistant rice transformant
CN116676289A (en) Oomycete vacuole type ATPase subunit a protein, encoding gene and application thereof
CN117447564A (en) Phytophthora sojae 14-3-3 protein, and encoding gene and application thereof
CN114854752B (en) Double-stranded RNA molecule of targeted silencing phytophthora capsici cellulose synthase 3 and application thereof
CN116334036B (en) Method for screening bacterial wilt-resistant extracellular nuclease from bacterial wilt and genetic improvement application
CN114790449B (en) Application of calpain gene GhCPK4 in verticillium resistance of plants

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant