CN116676289A

CN116676289A - Oomycete vacuole type ATPase subunit a protein, encoding gene and application thereof

Info

Publication number: CN116676289A
Application number: CN202310435838.2A
Authority: CN
Inventors: 刘西莉; 苗建强; 代探; 彭钦; 黄中乔
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2023-04-22
Filing date: 2023-04-22
Publication date: 2023-09-01

Abstract

The invention discloses a vacuole type ATPase subunit a protein VHA-a from oomycetes, and a coding gene and application thereof. The protein containing vacuole ATPase subunit a has the amino acid sequences shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, and the encoding genes have the nucleotide sequences shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No. 4. The VHA-a protein provided by the invention is subjected to homozygous knockout and death in oomycetes, so that the protein has important biological functions. The protein provided by the invention has high application value in controlling oomycete diseases, and the developed bactericide has important practical significance in controlling oomycete occurrence and epidemic by taking the protein as an action target.

Description

Oomycete vacuole type ATPase subunit a protein, encoding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, relates to a pathogenic oomycete proton pump protein and a coding gene and application thereof, and in particular relates to a vacuole type ATPase subunit a protein VHA-a from oomycetes and a coding gene and application thereof.

Background

Oomycetes are a class of eukaryotes, including phytopathogenic oomycetes such as phytophthora capsici (Phytophthora capsici), phytophthora sojae (Phytophthora sojae), phytophthora litchi (phytophthora litchi), pythum ultimum) and the like, have a wide host range, and can infect most dicotyledonous plants. Phytophthora sojae causes serious harm to soybean and can cause seed rot, seedling blight, root rot and stem rot of soybean. The phytophthora litchi can cause a large number of rotted fruits and fallen fruits of litchi, the rotted fruits reach 30-50% in spring rain and plum rain season, and the yield and quality and the storage and transportation of fresh fruits are seriously affected. The Pythium ultimum can infect more than 150 economic plants such as apples, strawberries, oranges, watermelons, sugarcanes, tomatoes and the like, and cause various diseases such as seedling blight, cataplexy, root rot, foot rot, wilt and the like. Oomycete diseases cause serious damage to agriculture and natural ecosystems.

The vacuolar ATPase protein is a proton pump dependent on ATP and can pump cytoplasmic H ⁺ Pumping into the cell compartment. Vacuolar ATPase proteins are widely distributed in the cell membrane system of eukaryotic cells, including endosomes, lysosomes, golgi vesicles, secretory vesicles and cell membranes of various cells. Vacuolar ATPase subunit a protein is an important subunit of V-ATPase, which has only one copy in oomycetes and most fungi. Therefore, the aim of controlling the pepper epidemic disease can be achieved by inhibiting the oomycete vacuole type ATPase subunit a protein and further inhibiting the growth of oomycetes at each stage.

Disclosure of Invention

Based on the above, research of the inventor finds that the vacuole type ATPase subunit a protein in oomycetes such as phytophthora sojae, phytophthora capsici, phytophthora litchi, pythium ultimum and the like is homozygous and knocked out to kill, and the subunit is an essential subunit for the normal growth of the oomycetes. Biological phenotype measurement is carried out on the oomycete vacuole type ATPase subunit a protein heterozygous transformant, and the number of sporangium and zoospores is obviously higher than that of the parent strain, and other strains have no obvious change, so that the influence on the phenotype caused by subunit a protein heterozygous knockout is smaller. Therefore, the occurrence and development of oomycete diseases can be controlled by controlling the vacuole type ATPase subunit a protein to inhibit the normal growth of oomycete.

It is therefore an object of the present invention to provide a class of Oomycetes vacuole type ATPase subunit a proteins derived from Phytophthora sojae, phytophthora capsici, phytophthora litchi and Pythium ultimum, respectively, designated PcVHA-a, psVHA-a, plVHA-a, pyuVHA-a, respectively, derived from Phytophthora capsici strain BYA, phytophthora sojae P6497, phytophthora litchi Plyn3, pyuyn ultimum 7, respectively, being A1) or A2) or A3) or A4) as follows

A1 Amino acid sequence is protein shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8;

a2 A fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of a protein shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8;

a3 Protein derived from protein shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 with the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8;

a4 Amino acid sequence having a similarity of 75% or more, preferably 85% or more, more preferably 95% or more with the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 and having the same function as the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

In order to facilitate purification of the protein in A1), a tag such as Poly-Arg (RRRRRRR), poly-His (HHHHH), FLAG (DYKDDDDK), strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) or the like may be attached to the amino-terminus or the carboxyl-terminus of the protein consisting of the amino acid sequences shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 in the sequence Listing.

The protein in the A1) -A4) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing. The coding gene of the protein in the A2) -A4) can be obtained by deleting one or more codons of amino acid residues in the DNA sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 in the sequence list and/or carrying out missense mutation of one or more nucleotide pairs and/or linking the coding sequences of the above-mentioned tags at the 5 'end and/or 3' end thereof.

Wherein, the protein PcVHA-a shown in SEQ ID No.5 has a coding gene of a nucleotide sequence shown in SEQ ID No.1 and is derived from phytophthora capsici; the protein PsVHA-a shown in SEQ ID No.6 has a coding gene of a nucleotide sequence shown in SEQ ID No.2 and is derived from phytophthora sojae; the protein PlVHA-a shown in SEQ ID No.7 has a coding gene of a nucleotide sequence shown in SEQ ID No.3 and is derived from Phytophthora litchii; the protein PyuVHA-a shown in SEQ ID No.8 has a coding gene of a nucleotide sequence shown in SEQ ID No.4 and is derived from Pythium ultimum.

It is a further object of the present invention to provide nucleic acid molecules encoding said VHA-a proteins. The nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be an RNA, such as mRNA, hnRNA, tRNA or the like.

Wherein the coding gene of the PcVHA-a is B1) or B2) or B3) as follows:

b1 A DNA molecule shown in a nucleotide sequence shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 in the sequence table;

b2 A cDNA molecule or a DNA molecule having 75% or more, 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encoding the above VHA-a;

b3 Under stringent conditions with a nucleotide sequence defined under B1) or B2), and a cDNA molecule or DNA molecule encoding the above PcVHA-a, psVHA-a, plVHA-a, pyuVHA-a.

The coding gene is characterized in that SEQ ID NO.1 in a sequence table consists of 2616 nucleotides, and the 1 st to 2616 th nucleotides at the 5' end of the sequence 1 are the coding sequences to code a protein (PcVHA-a) shown in SEQ ID NO.5 in the sequence table; SEQ ID NO.2 of the sequence table consists of 2622 nucleotides, and 1 st to 2622 nd nucleotides from the 5' end of the sequence table 2 are coding sequences for coding a protein (PsVHA-a) shown in SEQ ID NO.6 of the sequence table; SEQ ID NO.3 of the sequence table consists of 2616 nucleotides, and the 1 st to 2616 th nucleotides from the 5' end of the sequence 3 are coding sequences for coding a protein (PlVHA-a) shown in SEQ ID NO.7 of the sequence table; SEQ ID No.4 of the sequence Listing consists of 2619 nucleotides, and the 1 st to 2619 th nucleotides from the 5' end of the sequence No.1 are coding sequences, which code the protein (PyuVHA-a) shown in SEQ ID No.8 of the sequence Listing.

The RNA molecule is obtained by transcription of the coding gene;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

c1 A RNA sequence having the same function as the RNA sequence transcribed from the DNA sequence shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4, wherein the similarity of the RNA sequence transcribed from the DNA sequence shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 is 75% or more, more preferably 85% or more, still more preferably 95% or more;

c2 RNA sequences transcribed from the DNA sequences shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4. The DNA sequence according to the invention is capable of molecular hybridization under stringent conditions with a DNA sequence as shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 and encodes a DNA sequence which codes for VHA-a as shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8. The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65℃followed by washing the membrane once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

It is a further object of the present invention to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vector can be a recombinant expression vector or a recombinant cloning vector. In the above biological material, the vector may be a plasmid, cosmid, phage or viral vector; the microorganism may be a yeast, bacterium, algae or fungus, such as agrobacterium; the transgenic plant cell line does not include propagation material. Specifically, any one of the following D1) to D10) may be mentioned:

D1 An expression cassette containing the coding gene;

d2 A recombinant vector containing the coding gene or a recombinant vector containing the expression cassette of D1);

d3 A recombinant microorganism containing the coding gene, or a recombinant microorganism containing the expression cassette of D1), or a recombinant microorganism containing the recombinant vector of D2);

d4 A transgenic plant cell line comprising said coding gene, or a transgenic plant cell line comprising D1) said expression cassette;

d5 A transgenic plant tissue comprising said coding gene, or a transgenic plant tissue comprising D2) said expression cassette;

d6 A transgenic plant organ comprising said coding gene, or a transgenic plant organ comprising D2) said expression cassette;

d7 A nucleic acid molecule that inhibits expression of the encoding gene;

d8 A expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line comprising the nucleic acid molecule of D7);

d9 A nucleic acid molecule that inhibits translation of the RNA molecule;

d10 Producing D9) an expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line of said nucleic acid molecule.

The fourth object of the present invention is to provide a method for screening or assisting in screening of an oomycete antibacterial and/or bactericidal agent, which comprises applying a substance to be tested to the oomycete, wherein the substance to be tested is the oomycete antibacterial and/or bactericidal agent when the substance to be tested can inhibit transcription of any one DNA sequence or any combination of two DNA sequences, or inhibit translation of any one RNA sequence or any combination of two RNA sequences, or inhibit and/or inactivate activity of any one VHA-a protein as shown above.

The oomycete is preferably one or more of phytophthora capsici, phytophthora sojae, phytophthora litchi and Pythium ultimum.

The fifth purpose of the invention is to provide the application of the VHA-a protein shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 in the sequence table and the coding gene shown as sequence 1 in the sequence table as a bacteriostatic or bactericidal agent target for screening oomycetes bacteriostasis or bactericidal agent. The oomycete is preferably one or more of phytophthora capsici, phytophthora sojae, phytophthora litchii, pythium ultimum and Pythium ultimum. It is a sixth object of the present invention to provide a method for screening or assisting in screening an oomycete antibacterial and/or bactericidal agent, which comprises applying a test substance to the oomycete, wherein the test substance is a candidate oomycete antibacterial and/or bactericidal agent when the test substance can inhibit transcription of the above DNA sequence, or inhibit translation of the above RNA sequence, or inhibit and/or inactivate the VHA-a protein as shown above; wherein, the oomycete is preferably one or more of phytophthora capsici, phytophthora sojae, phytophthora litchi and Pythium ultimum.

The seventh object of the present invention is to provide a method for reducing or inactivating the activity of oomycetes, comprising the steps of: inhibiting transcription or deleting said coding gene, or inhibiting translation in said RNA molecule, or inhibiting activity or inactivating said PcVHA-a protein;

The activity of the oomycetes is reduced, namely, the zoospore yield of the oomycetes is inhibited, the germination of resting spores is inhibited, the morphology of the resting spores is/are destroyed, and/or the hypha growth speed of oomycetes such as phytophthora capsici, phytophthora sojae, phytophthora litchi, pythium ultimum and the like is reduced;

preferably, the protein shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 of the sequence Listing is inactivated by gene knockout of the gene shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 of the oomycete sequence Listing. The oomycetes are preferably oomycetes such as phytophthora capsici, phytophthora sojae, phytophthora litchi and Pythium ultimum.

Experiments prove that the VHA-a protein (PcVHA-a, psVHA-a, plVHA-a and PyuVHA-a) has an amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8, and the coding gene has a nucleotide sequence shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4. The VHA-a protein provided by the invention is subjected to homozygous knockout and death in phytophthora capsici, phytophthora sojae, phytophthora litchii and Pythium ultimum, so that the protein has important biological functions. The protein provided by the invention has high application value in controlling oomycete diseases such as phytophthora capsici, phytophthora sojae, downy mildew of litchi, pythium ultimum and the like, and the developed bactericide has important practical significance in controlling the occurrence and the epidemic of oomycete diseases such as phytophthora capsici, phytophthora sojae, downy mildew of litchi, pythium ultimum and the like by taking the protein as an action target.

Drawings

The sequence verification schematic diagram of the homologous arm is shown in the figure 1, the PCR identification result of the PcVHA-a knockout mutant gene of phytophthora capsici is shown below, and the empty control strain, the heterozygous knockout mutant and the wild phytophthora capsici strain BYA are shown in sequence from left to right (figures EV, pca-HKO and BYA 5).

FIG. 2 is a graph showing the hypha growth rate and hypha growth morphology of wild type Phytophthora capsici strain BYA, pcVHA-a gene heterozygous knockout mutant Pca-HKO, EV (empty vector control).

FIG. 3 is a bar graph of wild type Phytophthora capsici strain BYA, pcVHA-a gene heterozygous knockout mutant Pca-HKO, EV (empty vector control) versus sporangium number.

FIG. 4 is a bar graph of wild type Phytophthora capsici strain BYA, pcVHA-a gene heterozygous knockout mutant Pca-HKO, EV (empty vector control) versus zoospores.

FIG. 5 is a bar graph showing germination rates of P.capsici (wild type) strain BYA, pcVHA-a gene heterozygous knockout mutant Pca-HKO and EV (empty vector control) resting spores.

FIG. 6 shows temperature sensitive bar graphs (left) and hypha morphology graphs (right) of wild type Phytophthora capsici strain BYA, EV (empty vector control), pcVHA-a gene heterozygous knockout mutant Pca-HKO.

FIG. 7 is a schematic representation of a knockout lethal genetic assay of PcVHA-a, psVHA-a, plVHA-a, pyuVHA-a heterozygous knockout transformant Pca-HKO.

FIG. 8 shows PCR identification results of the PsVHA-a knockout mutant gene of Phytophthora sojae.

FIG. 9 shows PCR identification results of the P.litchi PlVHA-a knockout mutant gene.

FIG. 10 shows PCR identification results of PyuVHA-a knockout mutant genes of PyuVHA-a finally.

Detailed Description

The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Phytophthora capsici wild-type strain BYA is obtained from silver chloride City of Gansu province (Miao, J. Et al 2018. Phytopathology.108:1412-1419). Phytophthora sojae strain P6497 is a standard strain for genome sequencing (Tyler, B.M. et al science. 313:1261-1266) given by the teachings of Brett M.Tyler, U.S.A. (Oregon State University). Phytophthora litchi Plyn3 and Pyuyn7 are all obtained from Yunnan province. Phytophthora capsici mating type standard strains PCAS1 and PCAS2 (Bower, L.A. et al 1985.Canndian Journal of Plant Pathology.7 (1): 1-6) give a gift to the Michael Coffey professor of the university of California, U.S. Hebine. The above strains are merely materials used in the examples of the present invention, and in fact, the phytophthora strains can be obtained using any commercially available route when the screening markers of the present invention are applied.

All of the above strains have been identified by existing morphological and molecular biological methods.

Example 1, pcVHA-a Gene of Phytophthora capsici and production of its encoded protein

In this example, the PcVHA-a protein of Phytophthora capsici and its coding gene (or cDNA) can be obtained by amplifying the DNA (or cDNA) of Phytophthora capsici strain BYA as a template by the primers shown in Table 1. Wherein the DNA or RNA extracted material can be mycelium of Phytophthora capsici strain BYA. Wherein, cDNA of phytophthora capsici leonian strain BYA is used as a template, pcVHA-a-F and PcVHA-a-R are used for amplification to obtain a coding gene PcVHA-a of vacuole type ATPase subunit a, as shown in SEQ ID NO.1 in a sequence table, the SEQ ID NO.1 consists of 2616 nucleotides, and 1 st to 2616 th nucleotides at the 5' end of the SEQ ID NO.1 are used as coding sequences to code protein (PcVHA-a) shown in SEQ ID NO.5 in the sequence table. The above proteins or genes may also be synthesized artificially.

TABLE 1 amplification primers for full-length coding gene of PcVHA-a

Example 2 functional verification of Phytophthora capsici PcVHA-a Gene and its encoded protein

1. Acquisition of heterozygous knockout transformant of Phytophthora capsici PcVHA-a Gene

1.1 construction of knock-out vector of Phytophthora capsici PcVHA-a Gene

(1) Obtaining candidate sgrnas

The design of the sgRNA of PcVHA-a was performed by EuPaGDT (http:// grna. Ctegd. Uga. Edu /), and the search was performed by inputting the full length of the genome into the website.

(2) Secondary structure screening

And analyzing the secondary structure of the candidate sgRNAs by using a website (http:// rna. Urmc. Rochester. Edu/RNAstructureWeb/Servers/Predict 1. Html), and selecting the number of complementary bridges forming the hairpin as the candidate sgRNAs, wherein the number is less than or equal to 3.

(3) Off-target analysis

The off-target analysis was performed on sgRNA by JGI (https:// mycocosm. JGI. Doe. Gov/Phyca 11.Home. Html), and the total of 23 bases including the PAM region were input for alignment, including the case of a perfect match of 9 to 23 (including NGG), and the risk of off-target was considered to be higher.

(4) The ideal sgRNA is selected for synthesis (the DNA molecular sequence for expressing the sgRNA is 5'-acaggttgtt ccagcccttg-3', the sgRNA sequence is ACAGGUUUCCAGCCCUUUG, and the reverse nucleotide sequence from 1819 th to 1837 th positions of the 5 '. Fwdarw.3' end of the SEQ ID No.1 sequence in the targeting sequence table.

(5) The construction of the sgRNA expression vector (structure as the sgRNA vector in FIG. 2) was carried out using PYF515 (published vector, fang Y, cui L, gu B, et al 2017. Effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology,44:21A.1.1-21 A.1.26.) as a backbone vector according to the published method of the literature (described in Fang Y, cui L, gu B, et al 2017. Effect genome editing in the oomycete Phytophthora sojae using CRISPR/cas9.Current Protocols in Microbiology,44:21A.1.1-21 A.1.26.). sgRNA encoding DNA annealing treatment (30. Mu.L System): 3. Mu.L sense strand, 3. Mu.L antisense strand, 3. Mu.L 10 XT 4 DNA Ligase Buffer (NEB), 0.5M NaCl 4. Mu.L, and 21. Mu.L ddH ₂ O,100 ℃,2min; slowly cooling at room temperature for about 3-4 h; diluting 1. Mu.L, adding 499. Mu.L ddH ₂ O; enzyme cutting sites BsaI and NneI are selected for enzyme cuttingPYF515 plasmid, linearizing the plasmid; ligation plasmid: mu.L of diluted post-annealing sgRNA fragment encoding DNA (5'-acaggttgtt ccagcccttg-3'), 2. Mu.L of 10 XT 4 DNA Ligase Buffer (NEB), 1. Mu. L T4 DNA Polynudeotide,50ng PYF515 linear plasmid, ddH ₂ O was added to 20. Mu.L at 25℃for 30min. Transferring the connection product into competent cells of escherichia coli DH5 alpha, ice-bathing for 30min, heat-shocking for 42 s, ice-bathing for 2min, adding non-resistance LB, shaking and culturing for 60min, coating bacterial liquid on an LB plate with Amp resistance, culturing overnight at 37 ℃, amplifying and sequencing by using a universal primer M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3')/RPL 41-F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3'), and verifying cloning. The recombinant vector containing the DNA molecule for expressing sgRNA, which is verified to be correct, is named as PYF515-PcsgRNA1, and the expression of the recombinant vector targets the reverse nucleic acid sequence of the 5 '. Fwdarw.3' end 1819-1837 of the sequence SEQ ID No.1 in the sequence table.

(6) Using phytophthora capsici leonian BYA genome DNA as a template, and respectively amplifying an upstream 1000bp fragment (the sequence is shown as SEQ ID No. 9) and a downstream 1000bp fragment (the sequence is shown as SEQ ID No. 10) of a target gene by using a primer pair (the sequence of the upstream 1000bp fragment primer pair of the gene is shown as F:5'-gtcgacggta tcgataagctttcgttgcga ttgccttga-3', R:5'-ccttgcccat ggttaatgtcctttaaacgc t-3', and the sequence of the downstream 1000bp fragment primer pair of the gene is shown as F:5'-cgcgccttga acagcaagtgaatgcatcga gc-3', R:5'-cgcggtggcg gccgctctagadgcgcgaggctgactccat cagtcc-3'); GFP fragments (see SEQ ID No.11 for details) were amplified using the commercially available pGFP plasmid as template and a primer pair (F: 5'-gacattaacc atgggcaagg gcgaggaa-3' and R:5'-cacttgctgt tcaaggcgcg cctgcggc-3'). With pBluescriptII SK ⁺ As a backbone vector, the cleavage sites HindIII and XbaI (enzyme from NEB Co.) were selected for cleavage pBluescript II SK ⁺ The plasmid was constructed by an In-fusion kit (Takara Code No. 639650) as a homology arm replacement vector (structure shown as PcVHA-aDonor vector In FIG. 2). By In-HD Cloning Kit fusion of three amplified fragments to Cloning vector pBluescript II SK ⁺ (HindIII and XbaI cleavage), 50℃and 15miTransferring the connection product into competent cells of escherichia coli DH5 alpha, ice-bathing for 30min, heat-shocking for 42 s, ice-bathing for 2min, adding non-resistant LB, shaking and culturing for 60min, coating bacterial liquid on an LB plate with Amp resistance, culturing overnight at 37 ℃, amplifying by using a universal primer M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3')/M13R (sequence: 5'-CAGGAAACAGCTATGACC-3'), sequencing and verifying cloning, and designating the correct recombinant expression vector containing the upstream 1000bp sequence of PcVHA-a, the GFP gene sequence and the downstream 1000bp sequence of PcVHA-a which are sequentially connected as pBS-GFP-PcVHA-a.

1.2 obtaining of heterozygous knockout transformant of Phytophthora capsici PcVHA-a Gene

CaCl is adopted ₂ PEG-mediated protoplast transformation method to obtain knock-out transformants of the PcVHA-a gene (described in Fang and Tyler,2016.Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas 9). Specifically, the sgRNA expression vector (PYF 515-sgRNA 1) constructed in 3.1 and a homologous arm replacement vector pBS-GFP-PcVHA-a are subjected to protoplast transformation simultaneously, transferred into phytophthora capsici BYA, grown transformants are cultured and screened on a G418 resistant V8 plate at 25 ℃, mycelium blocks are picked up from the edges of the colonies and inoculated on a V8 plate paved with cellophane, mycelium is scraped after dark culture for 6d at 25 ℃, and DNA of a transformant sample is extracted.

The verification of the knocked-out transformants was performed using three pairs of primers, the first pair (F: 5'-gcttccagaa agtcacagta ga-3' and R:5'-catcaccttc accctctcc-3') and the second pair (F: 5'-ttgtgcctgc tgatgaacgc-3' and R:5'-cctggctgat cgagtttacg-3') being used for the replacement verification of the gene, and the third pair (F: 5'-gcatggcatg gatgaactct ac-3' and R:5'-caacccgaac cagattaaca cc-3') being used for the verification of the gene interior. If the first two pairs of primers are used for carrying out PCR amplification on the suspected transformant, and the third pair of primers is used for carrying out PCR amplification on the suspected transformant, the suspected transformant can be identified as a positive homozygous transformant; if all three pairs of primers have bands, the suspected transformant can be identified as a positive heterozygous transformant. As shown in FIG. 3, 1 heterozygous PcVHA-a knockout transformant Pca-HKO was obtained in total.

2. Analysis of biological traits of heterozygous knockout transformant of Phytophthora capsici PcVHA-a gene

(1) Hypha growth rate detection: the knock-out transformant a-HKO of the phytophthora capsici PcVHA-a gene of the strain to be tested is inoculated on a V8 plate, and after being subjected to dark culture for 6 days at 25 ℃, a puncher with the diameter of 5mm is used for punching bacterial cakes along the edge of a bacterial colony, the bacterial colony is inoculated on the V8 plate, and is subjected to dark culture for 6 days in a incubator at 25 ℃, and the diameter of the bacterial colony is measured by adopting a crisscross method. The experiment was performed 3 times in biological replicates. Phytophthora capsici BYA, no-load strain is used as a control.

As shown in FIG. 2, there was no significant difference in the growth rate of the mycelium of heterozygous knockout transformant Pca-HKO compared to wild-type Phytophthora capsici strain BYA and no load.

(2) Sporocyst yield: the strain to be tested is inoculated on a V8 plate, after the strain to be tested is cultivated for 4 days in darkness at 25 ℃, a puncher with the diameter of 5mm is used for punching fungus cakes along the edge of a bacterial colony, the mycelium is inoculated on a new V8 plate in a face down mode, after the strain to be tested is cultivated for 4 days in darkness at 25 ℃, the strain to be tested is cultivated for 5 days under illumination, 10ml of sterile water is added into a culture dish to enable the aerial mycelium to be clung to a culture medium. The sporangia production was observed under a 100 x microscope and the number of sporangia was counted by selecting a representative field of view. The experiment was performed 3 times in biological replicates.

As shown in FIG. 3, the heterozygous knockout transformant Pca-HKO had a significantly increased sporangia count compared to the wild type Phytophthora capsici strain BYA and the empty vector.

(3) Zoospore yield: the strain to be tested was inoculated onto a V8 plate, cultured in the dark at 25℃for 4 days, a bacterial cake was removed along the edge of the colony by a punch having a diameter of 5mm, inoculated onto a new V8 plate with the mycelium side facing downward, cultured in the dark at 25℃for 4 days, and cultured under light conditions for 5 days, and 10ml of sterilized water was added to the culture dish. Placing the culture dish at 4deg.C for 30-40min, and standing at room temperature for more than 30min to allow zoospores to be released. Zoospore production was counted using a hemocytometer. The experiment was performed 3 times in biological replicates.

As shown in FIG. 4, the heterozygous knockout transformant Pca-HKO had a significantly increased zoospore count compared to the wild type Phytophthora capsici strain BYA and the empty vector.

(4) Germination rate of resting spores: obtaining zoospore suspension by the method, and regulating zoospore suspension concentration to 1×10 with sterile water ⁵ -5×10 ⁵ And each ml. 100. Mu.l of zoospore suspension was pipetted onto a 1% water agar plate and left at room temperature for 3-5h until most of the wild strain resting spores germinated to give shoot tubes. The number of the telogen spores germinated in every 100 telogen spores of each strain is observed by a microscope and is counted as the telogen spore germination rate. The experiment was performed 3 times in biological replicates.

As shown in FIG. 5, the heterozygous knockout transformant Pca-HKO had no significant difference in the germination rate of resting spores compared to the wild-type Phytophthora capsici strain BYA and the empty vector.

(5) Temperature sensitivity: the strain to be tested is inoculated on a V8 plate, after being subjected to dark culture for 3-4d at 25 ℃, a puncher with the diameter of 5mm is used for punching bacterial cakes along the edge of a bacterial colony, the bacterial colonies are inoculated on the V8 plate, and are respectively subjected to dark culture for 4d at 4 ℃, 13 ℃, 18 ℃,25 ℃, 30 ℃ and 37 ℃ and the bacterial colony diameter is measured by adopting a crisscross method. The experiment was performed 3 times in biological replicates.

As shown in FIG. 6, the heterozygous knockout transformant Pca-HKO has no significant difference in temperature sensitivity compared to the wild type Phytophthora capsici strain BYA and the empty vector.

3. Verification of knockout lethal genetics of heterozygous knockout transformant of phytophthora capsici PcVHA-a gene

3.1 test Medium and reagents

1) Basic culture solution: mgSO (MgSO) ₄ ·7H ₂ O 200mg，(NH ₄ )2SO ₄ 200mg，K ₂ HPO ₄ 120mg，CaCl ₂ ·2H ₂ O 60mg，KH ₂ PO ₄ 60mg，ZnSO ₄ ·7H ₂ 0.6 mg, deionized water was set to 200mL. 2) S+L medium: lecithin 100mg, basal culture solution 0.01L, glucose 40mg, agar powder 15g, deionized water to a volume of 1L (pH=7.0). 3) S+L semi-selective medium: 500mL of S+L medium, 2.5mL of the oomycete selective agent was added to the medium (40-60 ℃) before the plate was poured. 4) 0.25% potassium permanganate solution: 1g of potassium permanganate, and the sterile water is fixed to 20mL, and the final concentration is 0.05g/mL.

3.2 mating determination

BYA5 has been obtained earlier in the laboratory and the mating type of BYA was determined using mating type determination standard strains PCA1 and PCA 2. The standard strain was cultivated against BYA. The A2 mating type was obtained by culturing egg spores in the presence of PCA1 and not in the presence of PCA 2. The culture in opposition to PCA1 produced no oospores, and the culture in opposition to PCA2 produced oospores of A1 mating type. The A1A2 mating type produced egg spores by the opposite culture of PCA1 and PCA 2.

3.3 oospore acquisition and oospore germination

1) The mycelia of the standard strain and the heterozygous transformant Pca-HKO are separated by using a carbon-polymerized film (the hormone can penetrate and the mycelia cannot penetrate), and the mycelia are subjected to dark culture at 25 ℃ for 45 days on a V8 culture medium, so that the a-HKO inbred offspring are obtained. 2) Taking mycelium agar blocks, crushing by a crusher, and transferring to a 50mL centrifuge tube; 3) Centrifuging at 4000rpm for 5min, pouring out the upper culture medium, adding 30mL of sterile water, centrifuging at 650 Xg for 5min, and pouring out the supernatant; 4) Filtering with 40 μm cell filter to obtain ovum spore; 5) Treating with 0.25% potassium permanganate for 20min to remove residual mycelium, stimulating ovum spore germination, centrifuging at 650×g for 5min, and discarding supernatant; 6) Adding 20mL of sterile water, mixing well, centrifuging at 400 Xg for 5min, and discarding the supernatant; adding 5mL of sterile water to suspend oospores, coating on a semi-selective S+L culture medium, and irradiating for 2d by a black light lamp; 7) In a sterile console, single germinated oospores were picked using a microscope on V8 plates for subsequent PCR amplification and agarose gel electrophoresis detection analysis.

3.4 chi-square test

The homozygosity of the 81F 1 generation PcVHA-a gene was determined and the results were analyzed according to Mendelian's genetic law. Chi-square test is performed on the separation ratio of the F1 generation to propose invalid hypothesis and alternative hypothesis.

H _v : the ratio of the actual numbers of phenotypes corresponds to homozygosity (+/+): heterozygous (+/-): homozygote (-/-) =1:2:0 theoretical ratio (knockout lethal);

H _i : the ratio of the actual number of phenotypes does not correspond to homozygosity (+/+): heterozygous (+/-): homozygote (-/-) =1:2:0, i.e. in accordance with the theoretical ratio of separation ratio 1:2:1 (knockout is not lethal);

the number of classifications k=3, the degree of freedom df=3-1=3-1=2;

theoretical number of homozygous (+/+) strains T1:81×1/3=27;

theoretical number of heterozygous (+/-) strains T2:81×2/3=54.

Theoretical number of homozygous (-/-) strains T2:0 x 1/4=0.

Calculate χ ² Values (table 2).

Consult χ ² Critical value table, χ when the degree of freedom is 2 ² 0.05 (2) = 5.9915, by χ ² ＝0.889＜χ ² 0.05 (2) obtaining P > 0.05 failing to negate H _v The actual number is shown to have no significant difference from the theoretical number, and is homozygous (+/+): heterozygous (+/-): establishment of a theoretical ratio of homozygosity (-/-) =1:2:0 (knockout mortality) (fig. 7).

TABLE 2F1 sample frequency series

Strain	A (actual times)	T (theoretical times)	A-T	2
					Homozygosity (+/+) and method of producing the same	31	27	4	0.593
Hybrid (+/-)	50	54	-4	0.296
					Homozygote (-/-)	0	0	0	0
Totals to	81	81	0	0.889

The experiment proves that compared with wild phytophthora capsici strain BYA and empty vector transformant, the heterozygous knockout transformant of the phytophthora capsici PcVHA-a gene has obviously increased zoospore number and sporangium number, and the homozygous knockout of the phytophthora capsici PcVHA-a gene has death.

EXAMPLE 3 obtaining of Phytophthora sojae PsVHA-a Gene and its encoded protein

In this example, the phytophthora sojae PsVHA-a protein and its coding gene (cDNA) can be obtained by amplifying the cDNA of the phytophthora sojae strain P6497 as a template by the primers shown in Table 3. Wherein, the material extracted from RNA can be mycelium of phytophthora sojae strain P6497. The cDNA of the phytophthora sojae strain P6497 is used as a template, psVHA-a-F and PsVHA-a-R are used for amplifying to obtain a coding gene PsVHA-a of a vacuole type ATPase subunit a, as shown in SEQ ID NO.2 in a sequence table, the SEQ ID NO.2 consists of 2622 nucleotides, and the 1 st-2622 th nucleotide from the 5' end of the SEQ ID NO.2 is used as a coding sequence to code a protein (PsVHA-a) shown in SEQ ID NO.6 in the sequence table. The above proteins or genes may also be synthesized artificially.

TABLE 3 amplification primers for PsVHA-a full-length coding genes

Example 4 functional verification of Phytophthora sojae PsVHA-a Gene and its encoded protein

1. Acquisition of heterozygous knockout transformant of Phytophthora sojae PsVHA-a Gene

1.1 construction of knockout vector for Phytophthora sojae PsVHA-a Gene

The vector construction method was the same as in example 2, part 1.1.

Wherein, the sgRNA sequence is shown as 5'-gccctgtagg aactggtcga-3', and is the 250 th to 270 th reversed nucleotide sequence of the 5 '. Fwdarw.3' end of the SEQ ID No.2 sequence in the targeting sequence table, namely GCCCUGUAGGAACUGGUCGA. The recombinant vector which is verified to express the fragment shown by the sgRNA targeting sequence correctly is named as PYF515-PssgRNA1, and the vector expresses the reverse nucleic acid sequence of 250-270 positions at the 5 '. Fwdarw.3' end of the sequence SEQ ID No.2 in the targeting sequence table.

Wherein, the genomic DNA of phytophthora sojae P6497 is used as a template, and a primer pair (the sequences of a 1000bp fragment primer pair at the upstream of the gene are F:5'-gtcgacggta tcgataagcttagagtgagg caggacttt-3' and R:5'-ccttgcccat ggctgttgcg gactttttc-3', and the sequences of a 1000bp fragment primer pair at the downstream of the gene are F:5'-cgcgccttga atagcagacg caatgag-3' and R:5'-cgcggtggcg gccgctctagacagaggtga ctcagcga-3') is used for respectively amplifying an upstream 1000bp fragment (the sequence is shown as SEQ ID No. 12) and a downstream 1000bp fragment (the sequence is shown as SEQ ID No. 13) of the target gene; GFP fragments (see SEQ ID No.11 for details) were amplified using the commercially available pGFP plasmid as template and a primer pair (F: 5'-tccgcaacag ccatgggcaa gggcgaggaa-3' and R:5'-tgcgtctgct attcaaggcg cgcctgcggc-3'). The successfully constructed recombinant expression vector was named pBS-GFP-PsVHA-a.

1.2 obtaining of heterozygous knockout transformant of Phytophthora sojae PsVHA-a Gene

The transformant obtaining method was the same as that of the first portion 1.2 in example 2

Wherein, three pairs of primers are used for verifying the knockout transformant, a first pair of primers (F: 5'-cagtccatgg cggtgctag-3' and R:5'-ccgttcacat caccatccag t-3') and a second pair of primers (F: 5'-gtcctgctgg agttcgtga-3' and R:5'-agttcattct gaccacacac cat-3') are used for verifying whether substitution of the gene occurs, and a third pair of primers (F: 5'-gcgcaagctg cgctactt-3' and R:5'-ttgctctgga tcaggtgggc-3') are used for verifying the inside of the gene. As shown in FIG. 8, 1 heterozygous PsVHA-a knockout transformant Psa-HKO was obtained in total.

2. Verification of knockout lethal genetics of heterozygous knockout transformant of Phytophthora sojae PsVHA-a gene

2.1 test Medium and reagents the same as in example 2, third section 3.1

2.2 methods for egg spore acquisition and germination were the same as in example 2, third section 3.3

Wherein, the heterozygous transformant Ps-HKO is used for generating oospores by an selfing method, and particularly is used for culturing in the dark for 45 days by using a V8 culture medium.

2.3 chi-square test

The homozygosity rate of the 108F 1 generation PsVHA-a gene was determined and the results were analyzed according to Mendelian's genetic law. Chi-square test is performed on the separation ratio of the F1 generation to propose invalid hypothesis and alternative hypothesis.

the number of classifications k=3, the degree of freedom df=3-1=3-1=2;

theoretical number of homozygous (+/+) strains T1:108×1/3=36;

theoretical number of heterozygous (+/-) strains T2:108 x 2/3=72.

Theoretical number of homozygous (-/-) strains T2:0 x 1/4=0.

Calculate χ ² Values (table 4).

Consult χ ² Critical value table, χ when the degree of freedom is 2 ² 0.05 (2) = 5.9915, by χ ² ＝1.041＜χ ² 0.05 (2) obtaining P > 0.05 failing to negate H _v Indicating the realityThere was no significant difference in number from the theoretical number, homozygous (+/+): heterozygous (+/-): establishment of a theoretical ratio of homozygosity (-/-) =1:2:0 (knockout mortality) (fig. 7).

TABLE 4F1 sample frequency series table

Strain	A (actual times)	T (theoretical times)	A-T	2
					Homozygosity (+/+) and method of producing the same	31	36	5	0.694
Hybrid (+/-)	77	72	-5	0.347
					Homozygote (-/-)	0	0	0	0
Totals to	108	108	0	1.041

Example 5, production of Phytophthora litchii PlVHA-a Gene and its encoded protein

In this example, the Phytophthora litchii PlVHA-a protein and its coding gene (cDNA) can be obtained by amplifying the cDNA of Phytophthora litchii Plyn3 strain as a template by the primers shown in Table 5. Wherein, the RNA extraction material can be mycelium of Phytophthora litchii Plyn 3. The cDNA of the downy mildew strain Plyn3 is used as a template, and PlVHA-a-F and PlVHA-a-R are used for amplification to obtain a coding gene PlVHA-a of a vacuole type ATPase subunit a, wherein the coding gene PlVHA-a is shown as SEQ ID NO.3 in a sequence table, the SEQ ID NO.3 consists of 2616 nucleotides, and the 1 st to 2616 th nucleotides from the 5' end of the SEQ ID NO.3 are used as coding sequences to code a protein (PlVHA-a) shown as SEQ ID NO.7 in the sequence table. The above proteins or genes may also be synthesized artificially.

TABLE 5 PlVHA-a full-length coding gene amplification primers

Example 6 functional verification of Phytophthora litchii PlVHA-a Gene and its encoded protein

1. Obtaining of heterozygous knockout transformant of Phytophthora litchii PlVHA-a gene

1.1 construction of knockout vector of Phytophthora litchi PlVHA-a Gene

The vector construction method was the same as in example 2, part 1.1.

Wherein the sgRNA sequence is 5'-gaacgagtca ctgttaatgg-3', the sgRNA sequence is GAACGAGUCACUGUUAAUGG, and the sequence 5 '. Fwdarw.3' of SEQ ID No.3 in the targeting sequence table has the reverse nucleotide sequence of 2398-2418. The recombinant vector for correctly expressing the sgRNA targeting sequence is named as PYF515-PlsgRNA1, and expresses the 2398-2418 reverse nucleic acid sequence at the 5 '. Fwdarw.3' end of the sequence SEQ ID No.3 in the targeting sequence table.

Wherein, using the Platycladus litchi Plyn3 genome DNA as a template, and using a primer pair (the sequences of a 1000bp fragment primer pair at the upstream of the gene are F:5'-gtcgacggta tcgataagcttgtcacttcggtaactgctg g-3' and R:5'-ccttgcccat ggctgttttt aaagcgct-3', and the sequences of a 1000bp fragment primer pair at the downstream of the gene are F:5'-cgcgccttga acagcaagtg aactgagtta-3' and R:5'-cgcggtggcg gccgctctagaaaaattgtt cactgacga-3') to amplify an upstream 1000bp fragment (the sequence is SEQ ID No. 14) and a downstream 1000bp fragment (the sequence is SEQ ID No. 15) of the target gene respectively; GFP fragments (see SEQ ID No.11 for details) were amplified using the commercially available pGFP plasmid as template and a primer pair (F: 5'-ctttaaaaac agccatgggcaagggcgagg aa-3' and R:5'-tcagttcact tgctgttcaaggcgcgcctg cggc-3'). The successfully constructed recombinant expression vector was designated pBS-GFP-PlVHA-a.

1.2 obtaining of heterozygous knockout transformant of Phytophthora litchii PlVHA-a Gene

Wherein, three pairs of primers are used for verifying the knockout transformant, a first pair of primers (F: 5'-actggaaatg ttgccgccac t-3' and R:5'-cccgttcaca tcaccatcca gt-3') and a second pair of primers (F: 5'-cctgctgccg gacaaccatt-3' and R:5'-gctacgccag aaccatcatc a-3') are used for verifying whether substitution of the gene occurs, and a third pair of primers (F: 5'-gaggtcagga ggatacagct-3' and R:5'-gtacgtttcc acgaaggcct g-3') are used for verifying the inside of the gene. As shown in FIG. 9, a total of 1 heterozygous PlVHA-a knockout transformant Pla-HKO was obtained.

2. Verification of heterozygous knockout transformant knockout lethal genetics of Phytophthora litchii PlVHA-a gene

2.1 test Medium and reagents the same as in example 2, third section 3.1

Among them, heterozygous transformant Pla-HKO was used to produce oospores by the selfing method, specifically, was cultured in the dark using V8 medium for 45 days.

2.3 chi-square test

The homozygosity of the 72F 1 generation PlVHA-a gene was determined and the results were analyzed according to Mendelian's genetic law. Chi-square test is performed on the separation ratio of the F1 generation to propose invalid hypothesis and alternative hypothesis.

the number of classifications k=3, the degree of freedom df=3-1=3-1=2;

theoretical number of homozygous (+/+) strains T1:72×1/3=24;

theoretical number of heterozygous (+/-) strains T2:72×2/3=48.

Theoretical number of homozygous (-/-) strains T2:0 x 1/4=0.

Calculate χ ² Values (table 6).

Consult χ ² Critical value table, χ when the degree of freedom is 2 ² 0.05 (2) = 5.9915, by χ ² ＝4＜χ ² 0.05 (2) obtaining P > 0.05 failing to negate H _v The actual number is shown to have no significant difference from the theoretical number, and is homozygous (+/+): heterozygous (+/-): establishment of a theoretical ratio of homozygosity (-/-) =1:2:0 (knockout mortality) (fig. 7).

TABLE 6F1 sample frequency series table

Strain	A (actual times)	T (theoretical times)	A-T	2
					Homozygosity (+/+) and method of producing the same	16	24	-8	2.667
Hybrid (+/-)	56	48	8	1.333
					Homozygote (-/-)	0	0	0	0
Totals to	72	72	0	4

EXAMPLE 7 PyuVHA-a Gene of PyuVHA-a Fuscoporia finally and production of its encoded protein

In this example, pyuVHA-a protein and its coding gene (cDNA) can be amplified by using cDNA of Pyuyn7 as a template and using the primers shown in Table 7. Wherein, the RNA extracted material can be mycelium of Pyuyn7 of Pyuyn eventually. The cDNA of Pyuyn7 of PyuVHA is used as a template, pyuVHA-a-F and PyuVHA-a-R are used for amplification to obtain a coding gene PyuVHA-a of a vacuole ATPase subunit a, as shown in SEQ ID NO.4 in a sequence table, the SEQ ID NO.4 consists of 2619 nucleotides, and 1 st to 2619 nucleotides from the 5' end of the SEQ ID NO.4 are used as coding sequences to code a protein (PyuVHA-a) shown in SEQ ID NO.8 in the sequence table. The above proteins or genes may also be synthesized artificially.

TABLE 7 amplification primers for PyuVHA-a full-length coding genes

Example 8 functional verification of PyuVHA-a Gene of PyuVHA-a Fuscoporia finally and its encoded protein

1. Obtaining of heterozygous knockout transformant of PyuVHA-a Gene of PyuVHA

1.1 construction of knockout vector of PyuVHA-a Gene of PyuVHA

The vector construction method was the same as in example 2, part 1.1.

Wherein the sgRNA sequence is 5'-ggtgtgccca tacaactttg-3', the sgRNA sequence is GGUGUGCCCAUACAACUUUG, and the 1908-1927 nucleotide sequence of the 5 'to 3' end of the SEQ ID No.4 sequence in the targeting sequence table. The recombinant vector for correctly expressing the sgRNA targeting sequence is named as PYF515-PyusgRNA1, and expresses 1908-1927 nucleic acid sequence at the 5 '. Fwdarw.3' end of the sequence SEQ ID No.4 in the targeting sequence table.

Wherein, using Pyuyn7 genome DNA of Pyuyn7 as template, using primer pair (the sequence of 1000bp segment primer pair at the upper part of gene is F:5'-gtcgacggta tcgataagcttaagacacgg cgcgcgcg-3' and 5' -ccttgcccat ctcttccgagcgcatccac, the sequence of 1000bp segment primer pair at the lower part of gene is F:5'-cgcgccttga ggcgccctgg aaagaacgac-3' and 5'-cgcggtggcg gccgctctagatgttcactattgtgtaaag tg-3') to amplify the 1000bp segment at the upper part of target gene (sequence is SEQ ID No. 16) and the 1000bp segment at the lower part (sequence is SEQ ID No. 17); GFP fragments (see SEQ ID No.11 for details) were amplified using the commercially available pGFP plasmid as template and a primer pair (F: 5'-cgctcggaag agatgggcaa gggcgaggaa-3' and 5'-ttctttccag ggcgcctcaaggcgcgcctg cggc-3'). The successfully constructed recombinant expression vector was named pBS-GFP-PyuVHA-a.

1.2 Pythium ultimum PsThe heterozygous knockout transformant of VHA-a gene was obtained using CaCl ₂ PEG-mediated protoplast transformation method to obtain a knock-out transformant of the PyuVHA-a gene was performed with reference to the reported literature (Feng.L. Et al. 2021.Plos Pathogens.17:1-24). Specifically, the sgRNA expression vector (PYF 515-PyusgRNA 1) constructed in 1.1 and a homologous arm replacement vector pBS-GFP-PyuVHA-a are subjected to protoplast transformation simultaneously, the protoplast is transferred into Pyuyn7, the grown transformant is cultured and screened on a G418 resistant V8 plate at 25 ℃, hypha blocks are taken from the edge of the colony and inoculated on a V8 plate paved with cellophane, hypha is scraped after the culture is performed in dark at 25 ℃ for 3 days, and DNA of a transformant sample is extracted.

The transformant verification method was the same as in the first part 1.2 of example 2. Wherein, three pairs of primers were used for the verification of the knockout transformant, the first pair of primers (F: 5'-gcgatcggca acgctgtaat gaaa-3' and 5'-ccgttcacat caccatccag-3') and the second pair of primers (F: 5'-gcaatctgcc ctctccaagg-3' and 5'-gggtcagtgc gtgaagaaag ta-3') were used for the replacement verification of the gene, and the third pair of primers (F: 5'-ctcaaccagt tccgctcgga-3' and 5'-ggtacgcaaa cttggagcca aac-3') were used for the verification of the gene interior. As shown in FIG. 10, 1 heterozygous PyuVHA-a knockout transformant Pyua-HKO-was obtained in total. 2. Verification of PyuVHA-a Gene heterozygous knockout transformant knockout lethal genetics

2.1 test Medium

CMA (Corn mean Agar): 20-30g of corn flour; 15-20g of agar; 1000mL of distilled water; PDB (Potato Dextrose Broth ): 200g of potatoes; glucose 20g; distilled water 1000mL.

2.2 egg spore harvesting and germination

The reported method was used to produce oospores and germinate Pyuyn7 from Pyuyn terminalis. Oospores were produced by culturing Pyuyn for 7 2 weeks at 25℃on CMA medium (Corn Meal Agar). The oospores were extracted using the method of section 3.3 of example 2, and the oospore suspension was spread evenly on PDB medium containing 4% agar and cultured at 25℃for 1-6 days. During this time, single germinated oospores were picked on V8 plates using a microscope in a sterile console for subsequent PCR amplification and agarose gel electrophoresis detection analysis

2.3 chi-square test

The homozygosity of the 87F 1 generation PyuVHA-a gene was determined and the results were analyzed according to Mendelian's genetic law. Chi-square test is performed on the separation ratio of the F1 generation to propose invalid hypothesis and alternative hypothesis.

the number of classifications k=3, the degree of freedom df=3-1=3-1=2;

theoretical number of homozygous (+/+) strains T1:87×1/3=29;

theoretical number of heterozygous (+/-) strains T2:87×2/3=58.

Theoretical number of homozygous (-/-) strains T2:0 x 1/4=0.

Calculate χ ² Values (table 8).

Consult χ ² Critical value table, χ when the degree of freedom is 2 ² 0.05 (2) = 5.9915, by χ ² ＝4.190＜χ ² 0.05 (2) obtaining P > 0.05 failing to negate H _v The actual number is shown to have no significant difference from the theoretical number, and is homozygous (+/+): heterozygous (+/-): establishment of a theoretical ratio of homozygosity (-/-) =1:2:0 (knockout mortality) (fig. 7).

TABLE 8F1 sample frequency series table

Strain	A (actual times)	T (theoretical times)	A-T	2
					Homozygosity (+/+) and method of producing the same	38	29	9	2.793
Hybrid (+/-)	49	58	-9	1.397
					Homozygote (-/-)	0	0	0	0
Totals to	87	87	0	4.190

Claims

1. A vacuolar ATPase subunit a protein, which is a protein of A1) or A2) or A3) or A4) as follows:

a1 A protein consisting of the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8;

A3 A protein which is derived from the amino acid sequence shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 by substitution and/or deletion and/or addition of one or more amino acid residues and is related to oomycete knockout death and is derived from A1);

a4 Amino acid sequence having a similarity of 93% or more, preferably 95% or more, more preferably 98% or more with the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8, and having the same function as the amino acid sequence shown as SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

2. A coding gene encoding the vacuolar ATPase subunit a protein of claim 1; preferably, the coding gene is B1) or B2) or B3) as follows:

b1 A DNA molecule represented by the nucleotide sequence set forth in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4;

b2 A cDNA molecule or a DNA molecule having 75% or more, or 85% or more, or 95% or more identity with the nucleotide sequence shown in B1) and encoding the protein of claim 1;

b3 A cDNA molecule or a DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in B1) or B3) and which codes for a protein according to claim 1.

3. An RNA molecule transcribed from the coding gene of claim 2;

preferably, the sequence of the RNA molecule is C1) or C2) as follows:

c2 RNA sequences transcribed from the DNA sequences shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4.

4. A biological material associated with the vacuolar ATPase subunit a protein of claim 1, the coding gene of claim 2 or the RNA molecule of claim 3, being any one of the following D1) to D10):

d1 An expression cassette comprising the coding gene of claim 2;

d2 A recombinant vector comprising the coding gene of claim 2 or a recombinant vector comprising the expression cassette of D1);

d3 A recombinant microorganism comprising the coding gene of claim 2, or a recombinant microorganism comprising the expression cassette of D1), or a recombinant microorganism comprising the recombinant vector of D2);

D4 A transgenic plant cell line comprising the coding gene of claim 2, or a transgenic plant cell line comprising the expression cassette of D1);

d5 A transgenic plant tissue comprising the coding gene of claim 2, or a transgenic plant tissue comprising the expression cassette of D2);

d6 A transgenic plant organ comprising the coding gene of claim 2, or a transgenic plant organ comprising the expression cassette of D2);

d7 A nucleic acid molecule which inhibits the expression of the coding gene of claim 2; preferably, the nucleic acid molecule is a nucleic acid molecule that knocks out the encoding gene of claim 2, or that silences the encoding gene of claim 2;

d8 An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing or expressing D7) said nucleic acid molecule;

d9 A nucleic acid molecule that inhibits translation of the RNA molecule of claim 3;

d10 An expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing or expressing D9) said nucleic acid molecule.

5. Use of the vacuole ATPase subunit a protein of claim 1, the coding gene of claim 2, or the RNA molecule of claim 3, or the biological material of claim 4, for inhibiting the normal growth and development of or killing oomycetes.

6. The use according to claim 5, wherein the oomycete is phytophthora capsici (Phytophthora capsici), phytophthora sojae (phytophthora jae), phytophthora litchi (phytophthora litchi), pythum ultimum (Pythum ultimum).

7. Use of a vacuole ATPase subunit a protein of claim 1, a coding gene of claim 2 or an RNA molecule of claim 3 or a biological material of claim 4 as a pesticide formulation for screening for inhibiting hypha growth, sporangia production, zoospore release, spore germination or killing of said oomycetes.

8. A method of screening or assisting in the screening of an oomycete bacterium for a bacteriostatic and/or bactericidal agent, the method comprising applying an agent to be detected to the oomycete bacterium, wherein the agent to be detected is the bacteriostatic and/or bactericidal agent of the oomycete bacterium when the agent is capable of inhibiting transcription of the coding gene according to claim 2, or inhibiting translation of the RNA molecule according to claim 3, or inhibiting or inactivating the activity of the vacuolar ATPase subunit a protein according to claim 1.

9. A method of reducing or inactivating oomycete pathogens comprising the steps of: inhibiting or deleting the transcription of the coding gene of claim 2, or inhibiting the translation in the RNA molecule of claim 3, or inhibiting or inactivating the activity of the vacuolar ATPase subunit a protein of claim 1;

Wherein, the activity of reducing oomycete bacteria is to inhibit the yield of zoospores of oomycete bacteria, and/or inhibit the germination of resting spores, and/or destroy the morphology of resting spores, and/or reduce the hypha growth rate of oomycete bacteria;

preferably, the protein shown in SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 or SEQ ID No.8 in the sequence Listing is inactivated by gene knockout of the gene shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 or SEQ ID No.4 in the sequence Listing.

10. Use of a substance that inhibits expression and/or activity of the vacuole ATPase subunit a protein of claim 1 in the preparation of a plant oomycete germicide;

preferably, the substance that inhibits the expression and/or activity of vacuole-type ATPase subunit a protein is a substance that inhibits the expression of vacuole-type ATPase subunit a protein, and/or inhibits the transcription of a gene encoding vacuole-type ATPase subunit a protein, and/or inhibits the translation of an RNA molecule resulting from the transcription of a gene encoding vacuole-type ATPase subunit a protein.