CA2365968A1

CA2365968A1 - Novel plant genes and uses thereof

Info

Publication number: CA2365968A1
Application number: CA002365968A
Authority: CA
Inventors: John Manuel Salmeron; Laura Jean Weislo; Michael G. Willits; Tesfaye Mengiste
Original assignee: Individual
Current assignee: Syngenta Participations AG
Priority date: 1999-03-09
Filing date: 2000-03-07
Publication date: 2000-09-14
Also published as: RU2241749C2; CN1355847A; HK1043606A1; AU3165100A; JP2002537840A; PL352326A1; WO2000053762A2; CZ20013219A3; HUP0200528A2; TR200102718T2; WO2000053762A3; EP1159424A2

Abstract

Homologues of the Arabidopsis NIM1 gene, which is involved in the signal transduction cascade leading to systemic acquired resistance (SAR), are isolated from Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Beta vulgaris (sugarbeet), Helianthus annuus (sunflower), and Solanum tuberosum (potato). The invention further concerns transformation vectors and processes for expressing the NIM1 homologues in transgenic plants to increase SAR gene expression and enhance broad spectrum disease resistance.

Description

2 CA 02365968 2001-09-06 pCT~P00/01978 NOVEL PLANT GENES AND USES THEREOF
The present invention relates to broad-spectrum disease resistance in plants, including the phenomenon of systemic acquired resistance (SAR). More particularly, the present invention relates to the identification, isolation and characterization of homologues of the Arabidopsis NIM1 gene involved in the signal transduction cascade leading to systemic acquired resistance in plants.
Plants are constantly challenged by a wide variety of pathogenic organisms including viruses, bacteria, fungi, and nematodes. Crop plants are particularly vulnerable because they are usually grown as genetically-uniform monocultures; when disease strikes, losses can be severe. However, most plants have their own innate mechanisms of defense against pathogenic organisms. Natural variation for resistance to plant pathogens has been identified by plant breeders and pathologists and bred into many crop plants.
These natural disease resistance genes often provide high levels of resistance to or immunity against pathogens.
Systemic acquired resistance (SAR) is one component of the complex system plants use to defend themselves from pathogens (Hunt and Ryals, 1996; Ryals et al., 1996). See also, U.S. Patent No. 5,614,395. SAR is a particularly important aspect of plant-pathogen responses because it is a pathogen-inducible, systemic resistance against a broad spectrum of infectious agents, including viruses, bacteria, and fungi. When the SAR signal transduction pathway is blocked, plants become more susceptible to pathogens that normally cause disease, and they also become susceptible to some infectious agents that would not normally cause disease (Gaffney et aL, 1993; Delaney et al., 1994;
Delaney et al., 1995; Delaney, 1997; Bi et al., 1995; Mauch-Mani and Slusarenko, 1996).
These observations indicate that the SAR signal transduction pathway is critical for maintaining plant health.
Conceptually, the SAR response can be divided into two phases. In the initiation phase, a pathogen infection is recognized, and a signal is released that travels through the phloem to distant tissues. This systemic signal is perceived by target cells, which react by expression of both SAR genes and disease resistance. The maintenance phase of SAR
refers to the period of time, from weeks up to the entire life of the plant, during which the plant is in a quasi steady state, and disease resistance is maintained (Ryals et al., 1996).

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Salicylic acid (SA) accumulation appears to be required for SAR signal transduction.
Plants that cannot accumulate SA due to treatment with specific inhibitors, epigenetic repression of phenylalanine ammonia-lyase, or transgenic expression of salicylate hydroxylase, which specifically degrades SA, also cannot induce either SAR
gene expression or disease resistance (Gaffney et al., 1993; Delaney et al., 1994;
Mauch-Mani and Slusarenko, 1996; Maher et al., 1994; Pallas et al., 1996). Although it has been suggested that SA might serve as the systemic signal, this is currently controversial and, to date, all that is known for certain is that if SA cannot accumulate, then SAR
signal transduction is blocked (Pallas et al., 1996; Shulaev et al., 1995; Vernooij et al., 1994).
Recently, Arabidopsis has emerged as a model system to study SAR (Uknes ef al., 1992; Uknes et al., 1993; Cameron et al., 1994; Mauch-Mani and Slusarenko, 1994;
Dempsey and Klessig, 1995). It has been demonstrated that SAR can be activated in Arabidopsis by both pathogens and chemicals, such as SA, 2,6-dichloroisonicotinic acid (INA) and benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester (BTH) (Uknes et al., 1992; Vernooij et aL, 1995; Lawton et al., 1996). Following treatment with either INA or BTH or pathogen infection, at least three pathogenesis-related (PR) protein genes, namely, PR-1, PR-2, and PR-5 are coordinately induced concomitant with the onset of resistance (Uknes et aL, 1992, 1993). In tobacco, the best characterized species, treatment with a pathogen or an immunization compound induces the expression of at least nine sets of genes (Ward et al., 1991 ). Transgenic disease-resistant plants have been created by transforming plants with various SAR genes (U.S. Patent No. 5,614,395).
A number of Arabidopsis mutants have been isolated that have modified SAR
signal transduction (Delaney, 1997) The first of these mutants are the so-called Isd (lesions simulating disease) mutants and acd2 Lccelerated cell death) (Dietrich et al., 1994;
Greenberg et al., 1994). These mutants all have some degree of spontaneous necrotic lesion formation on their leaves, elevated levels of SA, mRNA accumulation for the SAR
genes, and significantly enhanced disease resistance. At least seven different Isd mutants have been isolated and characterized (Dietrich et al., 1994; W eymann et al., 1995).
Another interesting class of mutants are cim Lonstitutive immunity) mutants (Lawton et aL, 1993). See also, U.S. Patent No. 5,792,904 and International PCT Application WO
94/16077. Like Isd mutants and acd2, cim mutants have elevated SA and SAR gene expression and resistance, but in contrast to Isd or acd2, do not display detectable lesions on their leaves. cprl constitutive expresser of PR genes) may be a type of cim mutant;

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 however, because the presence of microscopic lesions on the leaves of cprl has not been ruled out, cprl might be a type of Isd mutant (Bowling et al., 1994).
Mutants have also been isolated that are blocked in SAR signaling. ndrl (non-race-specific disease resistance) is a mutant that allows growth of both Pseudomonas syringae containing various avirulence genes and also normally avirulent isolates of Peronospora parasitica (Century et al., 1995). Apparently this mutant is blocked early in SAR signaling.
nprl ~onexpresser of PR genes) is a mutant that cannot induce expression of the SAR
signaling pathway following INA treatment (Cao et al., 1994). eds enhanced disease susceptibility) mutants have been isolated based on their ability to support bacterial infection following inoculation of a low bacterial concentration (Glazebrook et al., 1996;
Parker et al., 1996). Certain eds mutants are phenotypically very similar to nprl, and, recently, eds5 and eds53 have been shown to be allelic to nprl (Glazebrook et al., 1996).
niml Loninducible immunity) is a mutant that supports P. parasitica (i.e., causal agent of downy mildew disease) growth following INA treatment (Delaney et al., 1995;
U.S. Patent No. 5,792,904). Although nim 1 can accumulate SA following pathogen infection, it cannot induce SAR gene expression or disease resistance, suggesting that the mutation blocks the pathway downstream of SA. niml is also impaired in its ability to respond to INA or BTH, suggesting that the block exists downstream of the action of these chemicals (Delaney et al., 1995; Lawton et aL, 1996).
Allelic Arabidopsis genes have been isolated and characterized, mutants of which are responsible for the nim 1 and nprl phenotypes, respectively (Ryals et al., 1997; Cao et al., 1997). The wild-type NIM1 gene product is involved in the signal transduction cascade leading to both SAR and gene-for-gene disease resistance in Arabidopsis (Ryals et al., 1997). Ryals et al., 1997 also report the isolation of five additional alleles of nim 1 that show a range of phenotypes from weakly impaired in chemically induced PR-1 gene expression and fungal resistance to very strongly blocked. Transformation of the wild-type NPR1 gene into nprl mutants not only complemented the mutations, restoring the responsiveness of SAR induction with respect to PR-gene expression and disease resistance, but also rendered the transgenic plants more resistant to infection by P. syringae in the absence of SAR induction (Cao et al., 1997). WO 98/06748 describes the isolation of NPR1 from Arabidopsis and a homologue from Nicotiana glutinosa. See also, WO 97/49822, WO
98/26082, and WO 98/29537.

WO 00/$3762 CA 02365968 2001-09-06 pCT~P00/01978 Despite much research and the use of sophisticated and intensive crop protection measures, including genetic transformation of plants, losses due to disease remain in the billions of dollars annually. Therefore, there is a continuing need to develop new crop protection measures based on the ever-increasing understanding of the genetic basis for disease resistance in plants. In particular, there is a need for the identification, isolation, and characterization of homologues of the Arabidopsis NIM1 gene from additional species of plants.
In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
Associated With / Operatively Linked: Refers to two DNA sequences that are related physically or functionally. For example, a promoter or regulatory DNA sequence is said to be "associated with" a DNA sequence that codes for an RNA or a protein if the two sequences are operatively linked, or situated such that the regulator DNA
sequence will affect the expression level of the coding or structural DNA sequence.
Chimeric Gene: A recombinant DNA sequence in which a promoter or regulatory DNA sequence is operatively linked to, or associated with, a DNA sequence that codes for an mRNA or which is expressed as a protein, such that the regulator DNA
sequence is able to regulate transcription or expression of the associated DNA sequence. The regulator DNA sequence of the chimeric gene is not normally operatively linked to the associated DNA sequence as found in nature.
Coding Sequence: a nucleic acid sequence that is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense RNA or antisense RNA. Preferably the RNA is then translated in an organism to produce a protein.
Complementary: refers to two nucleotide sequences that comprise antiparallel nucleotide sequences capable of pairing with one another upon formation of hydrogen bonds between the complementary base residues in the antiparallel nucleotide sequences.
Expression: refers to the transcription and/or translation of an endogenous gene or a transgene in plants. In the case of antisense constructs, for example, expression may refer to the transcription of the antisense DNA only.
Expression Cassette: A nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operatively linked to the nucleotide sequence of interest which is operatively linked to termination signals. It also typically comprises sequences required for proper translation of WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 the nucleotide sequence. The expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components. The expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Typically, however, the expression cassette is heterologous with respect to the host, i.e., the particular nucleic acid sequence of the expression cassette does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, such as a plant, the promoter can also be specific to a particular tissue, or organ, or stage of development.
Gene: A defined region that is located within a genome and that, besides the aforementioned coding nucleic acid sequence, comprises other, primarily regulatory, nucleic acid sequences responsible for the control of the expression, that is to say the transcription and translation, of the coding portion. A gene may also comprise other 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns.
Heterologous DNA Sequence: The terms "heterologous DNA sequence", "exogenous DNA segment" or "heterologous nucleic acid," as used herein, each refer to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling. The terms also includes non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA
segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found.
Exogenous DNA
segments are expressed to yield exogenous polypeptides.
Homologous DNA Sequence: A DNA sequence naturally associated with a host cell into which it is introduced.
Isocoding: A nucleic acid sequence is isocoding with a reference nucleic acid sequence when the nucleic acid sequence encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by the reference nucleic acid sequence.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Isolated: In the context of the present invention, an isolated nucleic acid molecule or an isolated enzyme is a nucleic acid molecule or enzyme that, by the hand of man, exists apart from its native environment and is therefore not a product of nature. An isolated nucleic acid molecule or enzyme may exist in a purified form or may exist in a non-native environment such as, for example, a recombinant host cell.
Minimal Promoter: promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.
Native: refers to a gene that is present in the genome of an untransformed cell:
Naturally occurring: the term "naturally occurring" is used to describe an object that can be found in nature as distinct from being artificially produced by man.
For example, a protein or nucleotide sequence present in an organism (including a virus), which can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory, is naturally occurring.
NIM1: Gene described in Ryals et al., 1997, which is involved in the SAR
signal transduction cascade.
NIM1: Protein encoded by the NIM1 gene Nucleic acid: the term "nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991 ); Ohtsuka et aL, J. Biol. Chem. 260: 2605-2608 (1985);
Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The terms "nucleic acid"
or "nucleic acid sequence" may also be used interchangeably with gene, cDNA, and mRNA encoded by a gene. In the context of the present invention, the nucleic acid molecule is preferably a segment of DNA. Nucleotides are indicated by their bases by the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G).

WO ~~/53762 CA 02365968 2001-09-06 pCT~, P~0/01978 ORF: Open Reading Frame.
Plant: Any whole plant.
Plant Cell: Structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, a plant tissue, a plant organ, or a whole plant.
Plant Cell Culture: Cultures of plant units such as, for example, protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development.
Plant Material: Refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant.
Plant Organ: A distinct and visibly structured and differentiated part of a plant such as a root, stem, leaf, flower bud, or embryo.
Plant tissue: A group of plant cells organized into a structural and functional unit. Any tissue of a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture and any groups of plant cells organized into structural and/or functional units. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as listed above or otherwise embraced by this definition is not intended to be exclusive of any other type of plant tissue.
Promoter: An untranslated DNA sequence upstream of the coding region that contains the binding site for RNA polymerase II and initiates transcription of the DNA. The promoter region may also include other elements that act as regulators of gene expression.
Protoplast: An isolated plant cell without a cell wall or with only parts of the cell wall.
Purified: the term "purified," when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein which is the predominant species present in a preparation is substantially purified. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
Particularly, it means that the nucleic acid or protein is at least about 50% pure, more preferably at least about 85% pure, and most preferably at least about 99% pure.
_7_ WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Recombinant DNA molecule: a combination of DNA molecules that are joined together using recombinant DNA technology Regulatory Elements: Sequences involved in controlling the expression of a nucleotide sequence. Regulatory elements comprise a promoter operably linked to the nucleotide sequence of interest and termination signals. They also typically encompass sequences required for proper translation of the nucleotide sequence.
Selectable marker gene: a gene whose expression in a plant cell gives the cell a selective advantage. The selective advantage possessed by the cells transformed with the selectable marker gene may be due to their ability to grow in the presence of a negative selective agent, such as an antibiotic or a herbicide, compared to the growth of non-transformed cells. The selective advantage possessed by the transformed cells, compared to non-transformed cells, may also be due to their enhanced or novel capacity to utilize an added compound as a nutrient, growth factor or energy source. Selectable marker gene also refers to a gene or a combination of genes whose expression in a plant cell gives the cell both, a negative and a positive selective advantage.
Significant Increase: an increase in enzymatic activity that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater of the activity of the wild-type enzyme in the presence of the inhibitor, more preferably an increase by about 5-fold or greater, and most preferably an increase by about 10-fold or greater.
The terms "identical" or percent "identity" in the context of two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
Substantially identical: the phrase "substantially identical," in the context of two nucleic acid or protein sequences, refers to two or more sequences or subsequences that have at least 60%, preferably 80%, more preferably 90-95%, and most preferably at least 99%
nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. Preferably, the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues. In a most preferred embodiment, the sequences are _g_ WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 substantially identical over the entire length of the coding regions.
Furthermore, substantially identical nucleic acid or protein sequences perform substantially the same function.
For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequences) relative to the reference sequence, based on the designated program parameters.
Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. AppL Math. 2: 482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'I. Acad. Sci. USA
85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Science Dr., Madison, WI), or by visual inspection (see generally, Ausubel et al., infra).
One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol.
Biol. 215: 403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov~.
This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul ef aL, 1990). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
Cumulative scores are calculated using, for nucleotide sequences, the parameters M
(reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues;
always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring _g_ WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 residue alignments, or the end of either sequence is reached. The BLAST
algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
The BLASTN
program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (V11) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff &
Henikoff, Proc.
Natl. Acad. Sci. USA 89: 10915 (1989)).
In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin &
Altschul, Proc. Nat'1. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. "Bind(s) substantially" refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
"Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays"
Elsevier, New York. Generally, highly stringent hybridization and wash conditions are selected to be about 5°-C lower than the thermal melting point (Tm) for the specific sequence W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 at a defined ionic strength and pH. Typically, under "stringent conditions" a probe will hybridize to its target subsequence, but to no other sequences.
The Tm is the temperature (under defined ionic strength and pH) at which 50%
of the target sequence hybridizes to a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50%
formamide with 1 mg of heparin at 42°-C, with the hybridization being carried out overnight. An example of highly stringent wash conditions is 0.1 5M NaCI at 72°-C for about 15 minutes. An example of stringent wash conditions is a 0.2x SSC wash at 65°-C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is 1 x SSC at 45°C
for 15 minutes. An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC
at 40°-C for 15 minutes. For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.OM Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°-C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
The following are examples of sets of hybridization/wash conditions that may be used to clone homologous nucleotide sequences that are substantially identical to reference nucleotide sequences of the present invention: a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 2X SSC, 0.1 % SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 1 X
SSC, 0.1 % SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1 % SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04, 1 mM EDTA at 50°C with washing in 0.1 X

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 SSC, 0.1 % SDS at 50°C, more preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M
NaP04, 1 mM EDTA at 50°C with washing in 0.1 X SSC, 0.1 % SDS at 65°C.
A further indication that two nucleic acid sequences or proteins are substantially identical is that the protein encoded by the first nucleic acid is immunologically cross reactive with, or specifically binds to, the protein encoded by the second nucleic acid. Thus, a protein is typically substantially identical to a second protein, for example, where the two proteins differ only by conservative substitutions.
The phrase "specifically (or selectively) binds to an antibody," or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction which is determinative of the presence of the protein in the presence of a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample. Specific binding to an antibody under such conditions may require an antibody that is selected for its specificity for a particular protein. For example, antibodies raised to the protein with the amino acid sequence encoded by any of the nucleic acid sequences of the invention can be selected to obtain antibodies specifically immunoreactive with that protein and not with other proteins except for polymorphic variants. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays, Western blots, or immunohistochemistry are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York "Harlow and Lane"), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. Typically a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background.
"Conservatively modified variations" of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid sequences, or where the nucleic acid sequence does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code; a large number of functionally identical nucleic acids encode any given polypeptide.
For instance the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine.
Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein. Such WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 nucleic acid variations are "silent variations" which are one species of "conservatively modified variations." Every nucleic acid sequence described herein which encodes a protein also describes every possible silent variation, except where otherwise noted.
One of skill will recognize that each codon in a nucleic acid (except ATG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent variation" of a nucleic acid which encodes a protein is implicit in each described sequence.
Furthermore, one of skill will recognize that individual substitutions deletions or additions that alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 5%, more typically less than 1 %) in an encoded sequence are "conservatively modified variations," where the alterations result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following five groups each contain amino acids that are conservative substitutions for one another:
Aliphatic: Glycine (G), Alanine (A), Vaiine (V), Leucine (L), Isoleucine (I); Aromatic:
Phenylalanine (F), Tyrosine (Y), Tryptophan (W); Sulfur-containing: Methionine (M), Cysteine (C);
Basic:
Arginine (R), Lysine (K), Histidine (H); Acidic: Aspartic acid (D), Glutamic acid (E), Asparagine (N), Glutamine (Q). See also, Creighton (1984) Proteins, W.H.
Freeman and Company. In addition, individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also "conservatively modified variations."
A "subsequence" refers to a sequence of nucleic acids or amino acids that comprise a part of a longer sequence of nucleic acids or amino acids (e.g., protein) respectively.
Nucleic acids are "elongated" when additional nucleotides (or other analogous molecules) are incorporated into the nucleic acid. Most commonly, this is performed with a polymerase (e.g., a DNA polymerase), e.g., a polymerase which adds sequences at the 3' terminus of the nucleic acid.
Two nucleic acids are "recombined" when sequences from each of the two nucleic acids are combined in a progeny nucleic acid. Two sequences are "directly"
recombined when both of the nucleic acids are substrates for recombination. Two sequences are "indirectly recombined"
when the sequences are recombined using an intermediate such as a cross-over oligonucleotide. For indirect recombination, no more than one of the sequences is an actual substrate for recombination, and in some cases, neither sequence is a substrate for recombination.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 A "specific binding affinity" between two molecules, for example, a ligand and a receptor, means a preferential binding of one molecule for another in a mixture of molecules. The binding of the molecules can be considered specific if the binding affinity is about 1 x 104 M-' to about 1 x 106 M-' or greater.
Transformation: a process for introducing heterologous DNA into a host cell or organism.
'Transformed," "transgenic," and "recombinant" refer to a host organism such as a bacterium or a plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating. Transformed cells, tissues, or plants are understood to encompass not only the end product of a transformation process, but also transgenic progeny thereof. A "non-transformed," "non-transgenic," or "non-recombinant" host refers to a wild-type organism, e.g., a bacterium or plant, which does not contain the heterologous nucleic acid molecule.
The present invention addresses the aforementioned needs by providing several homologues of the Arabidopsis NIMi gene from additional species of plants. In particular, the present invention concerns the isolation of Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Befa vulgaris (sugarbeet), Helianthus annuus (sunflower), and Solanum tuberosum (potato) homologues of the NIM1 gene, which encode proteins believed to be involved in the signal transduction cascade responsive to biological and chemical inducers that lead to systemic acquired resistance in plants.
Hence, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes SEQ ID N0:2, 4, 6, 8, 16, 18, 20, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68, 70, 72, or 74.
In another embodiment, the present invention is directed to an isolated nucleic acid molecule comprising SEO ID N0:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.
In a further embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that comprises an at least 20, 25, 30, 35, 40, 45, or 50 (preferably 20) consecutive base pair portion identical in sequence to an at least 20, 25, 30, 35, 40, 45, or 50 (preferably 20) consecutive base pair portion of SEQ ID
N0:1, 3, 5, 7, 15, WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.
In still another embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Lycopersicon esculentum DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID N0:9 and 10, SEQ ID N0:21 and 24, SEQ ID N0:22 and 24, SEQ ID
N0:25 and 28, SEQ ID N0:26 and 28, or SEQ ID N0:59 and 60.
In yet another embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Beta vulgaris DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ ID
N0:22 and 24 or SEQ ID N0:26 and 28.
In a further embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Helianthus annuus DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID
N0:26 and 28.
In another embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Solanum tuberosum DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID N0:21 and 24, SEQ ID N0:21 and 23, SEQ ID N0:22 and 24, SEQ ID N0:25 and 28, or SEO ID N0:26 and 28.
In a further embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from a Brassica napus DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID
N0:9 and 10 or SEQ ID N0:26 and 28.
In yet another embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from an Arabidopsis thaliana DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID N0:13 and 14, SEQ ID N0:21 and 24, or SEQ ID N0:22 and 24.
In a further embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from an Nicotiana tabacum DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID N0:9 and 10, SEQ ID N0:11 and 12, SEQ ID N0:21 and 24, SEQ ID N0:22 and 24, SEQ ID N0:25 and 28, or SEQ ID N0:26 and 28; or WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 In a further embodiment, the present invention is directed to an isolated nucleic acid molecule comprising a nucleotide sequence that can be amplified from an plant DNA library using the polymerase chain reaction with a pair of primers comprising the first 20 nucleotides and the reverse complement of the last 20 nucleotides of the coding sequence (CDS) of SEQ ID N0:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.
The present invention also encompasses a chimeric gene comprising a promoter active in plants operatively linked to a NIM1 homologue coding sequence of the present invention, a recombinant vector comprising such a chimeric gene, wherein the vector is capable of being stably transformed into a host, as well as a host stably transformed with such a vector. Preferably, the host is a plant such as one of the following agronomically important crops: rice, wheat, barley, rye, canola, sugarcane, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum, and sugarcane. The present invention also encompasses seed from a plant of the invention.
Further, the present invention is directed to a method of increasing SAR gene expression in a plant by expressing in the plant a chimeric gene that itself comprises a promoter active in plants operatively linked to a NIMI homologue coding sequence of the present invention, wherein the encoded protein is expressed in the transformed plant at higher levels than in a wild type plant.
In addition, the present invention is directed to a method of enhancing disease resistance in a plant by expressing in the plant a chimeric gene that itself comprises a promoter active in plants operatively linked to a NIM1 homologue coding sequence of the present invention, wherein the encoded protein is expressed in the transformed plant at higher levels than in a wild type plant.
Further, the present invention is directed to a PCR primer selected from the group consisting of SEQ ID N0:9-14, 21-28, 59, and 60.
The present invention also encompasses a method for isolating a NIM1 homologue involved in the signal transduction cascade leading to systemic acquired resistance in plants comprising amplifying a DNA molecule from a plant DNA library using the polymerase chain reaction with a pair of primers corresponding to the first 20 nucleotides and the WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 reverse complement of the last 20 nucleotides of the coding sequence (CDS) of SEQ ID
NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73 or with the pair of primers set forth as SEQ ID N0:9 and 10, SEQ ID
N0:11 and 12, SEQ ID N0:13 and 14, SEQ ID N0:21 and 24, SEQ ID N0:22 and 24, SEQ
ID N0:21 and 23, SEQ ID N0:25 and 28, SEQ ID N0:26 and 28, or SEQ ID N0:59 and 60.
In a preferred embodiment, the plant DNA library is a Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Beta vulgaris (sugarbeet), Helianthus annuus (sunflower), or Solanum tuberosum (potato) DNA library.
Northern data on several of the NIMi homologues described herein indicates constitutive expression or BTH-inducibility. The homologues of the NIM1 gene described herein are predicted to encode proteins involved in the signal transduction cascade responsive to biological and chemical inducers, which leads to systemic acquired resistance in plants. The present invention also concerns the transgenic expression of such NIM1 homologues in plants to increase SAR gene expression and enhance disease resistance.
The DNA sequences of the invention can be isolated using the techniques described in the examples below, or by PCR using the sequences set forth in the sequence listing as the basis for constructing PCR primers. For example, oligonucleotides having the sequence of approximately the first and last 20-25 consecutive nucleotides of SEQ ID N0:7 (e.g., nucleotides 1-20 and 1742-1761 of SEQ ID N0:7) can be used as PCR
primers to amplify the cDNA sequence (SEQ ID N0:7) directly from a cDNA library from the source plant (Arabidopsis thaliana). The other DNA sequences of the invention can likewise be amplified by PCR from cDNA or genomic DNA libraries of the respective plants using the ends of the DNA sequences set forth in the sequence listing as the basis for PCR primers.
The transgenic expression of the NIM1 homologues of the invention in plants is predicted to result in immunity to a wide array of plant pathogens, which include, but are not limited to viruses or viroids, e.g. tobacco or cucumber mosaic virus, ringspot virus or necrosis virus, pelargonium leaf curl virus, red clover mottle virus, tomato bushy stunt virus, and like viruses; fungi, e.g. oomycetes such as Phythophthora parasitica and Peronospora tabacina; bacteria, e.g. Pseudomonas syringae and Pseudomonas tabaci; insects such as aphids, e.g. Myzus persicae; and lepidoptera, e.g., Heliothus spp.; and nematodes, e.g., Meloidogyne incognita. The vectors and methods of the invention are useful against a number of disease organisms of maize including but not limited to downy mildews such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari and Peronosclerospora maydis; rusts such as Puccinia sorphi, Puccinia polysora and Physopella zeae; other fungi such as Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoliforme, Gibberella zeae, Exserohilum turcicum, Kabatiellu zeae, Erysiphe graminis, Septoria and Bipolaris maydis; and bacteria such as Erwinia stewartii.
The methods of the present invention can be utilized to confer disease resistance to a wide variety of plants, including gymnosperms, monocots, and dicots.
Although disease resistance can be conferred upon any plants falling within these broad classes, it is particularly useful in agronomically important crop plants, such as rice, wheat, barley, rye, rape, corn, potato, carrot, sweet potato, sugar beet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.
A NIM1 homologue coding sequence of the present invention may be inserted into an expression cassette designed for plants to construct a chimeric gene according to the invention using standard genetic engineering techniques. The choice of specific regulatory sequences such as promoter, signal sequence, 5' and 3' untranslated sequences, and enhancer appropriate for the achieving the desired pattern and level of expression in the chosen plant host is within the level of skill of the routineer in the art.
The resultant molecule, containing the individual elements linked in proper reading frame, may be inserted into a vector capable of being transformed into a host plant cell.
Examples of promoters capable of functioning in plants or plant cells (i.e., those capable of driving expression of associated coding sequences such as those coding for NIM1 homologues in plant cells) include the Arabidopsis and maize ubiquitin promoters;
cauliflower mosaic virus (CaMV) 19S or 35S promoters and CaMV double promoters; rice actin promoters; PR-1 promoters from tobacco, Arabidopsis, or maize; nopaline synthase promoters; small subunit of ribulose bisphosphate carboxylase (ssuRUBISCO) promoters, and the like. Especially preferred is the Arabidopsis ubiquitin promoter. The promoters themselves may be modified to manipulate promoter strength to increase expression of the associated coding sequence in accordance with art-recognized procedures.
Preferred promoters for use with the present invention are those that confer high level constitutive expression.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Signal or transit peptides may be fused to the NIMI homologue coding sequence in the chimeric DNA constructs of the invention to direct transport of the expressed protein to the desired site of action. Examples of signal peptides include those natively linked to the plant pathogenesis-related proteins, e.g. PR-1, PR-2, and the like. See, e.g., Payne et al., 1988. Examples of transit peptides include the chloroplast transit peptides such as those described in Von Heijne et aL (1991 ), Mazur et al. (1987), and Vorst et al.
(1988); and mitochondria) transit peptides such as those described in Boutry et al.
(1987). Also included are sequences that result in localization of the encoded protein to various cellular compartments such as the vacuole. See, for example, Neuhaus et al. (1991 ) and Chrispeels (1991 ).
The chimeric DNA constructs) of the invention may contain multiple copies of a promoter or multiple copies of a NIM1 homologue coding sequence of the present invention. In addition, the constructs) may include coding sequences for markers and coding sequences for other peptides such as signal or transit peptides, each in proper reading frame with the other functional elements in the DNA molecule. The preparation of such constructs are within the ordinary level of skill in the art.
Useful markers include peptides providing herbicide, antibiotic or drug resistance, such as, for example, resistance to protoporphyrinogen oxidase inhibitors, hygromycin, kanamycin, 6418, gentamycin, lincomycin, methotrexate, glyphosate, phosphinothricin, or the like. These markers can be used to select cells transformed with the chimeric DNA
constructs of the invention from untransformed cells. Other useful markers are peptidic enzymes which can be easily detected by a visible reaction, for example a color reaction, for example luciferase, f3-glucuronidase, or f3-galactosidase.
Chimeric genes designed for plant expression such as those described herein can be introduced into the plant cell in a number of art-recognized ways. Those skilled in the art will appreciate that the choice of method might depend on the type of plant (i.e. monocot or dicot) and/or organelle (i.e. nucleus, chloroplast, mitochondria) targeted for transformation.
Suitable methods of transforming plant cells include microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium mediated transformation (Hinchee et aL, 1988; Ishida et al., 1996), direct gene transfer (Paszkowski et al., 1984;
Hayashimoto et al., 1990), and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wisconsin and Dupont, Inc., Wilmington, Delaware (see, for example, U.S. Patent 4,945,050; and McCabe et al., 1988). See also, Weissinger et al. (1988);
Sanford et al.
(1987) (onion); Christou et al. (1988) (soybean); McCabe et al. (1988) (soybean); Datta et WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 al. (1990) (rice); Klein et al. (1988) (maize); Klein et al. (1988) (maize);
Klein ~et al. (1988) (maize); Fromm et al. (1990); and Cordon-Kamm et al. (1990) (maize); Svab et al. (1990) (tobacco chloroplasts); Cordon-Kamm et al. (1993) (maize); Shimamoto et al.
(1989) (rice);
Christou et al. (1991 ) (rice); Datta et al. (1990) (rice); European Patent Application EP 0 332 581 (orchardgrass and other Pooideae); Vasil et al. (1993) (wheat); Weeks et al. (1993) (wheat); Wan et al. (1994) (barley); Jahne et al. (1994) (barley); Umbeck et al. (1987) (cotton); Casas et al. (1993) (sorghum); Somers et al. (1992) (oats); Torbert et al. (1995) (oats); Weeks et a/.,(1993) (wheat); WO 94/13822 (wheat); and Nehra et al.
(1994) (wheat).
A particularly preferred set of embodiments for the introduction of recombinant DNA
molecules into maize by microprojectile bombardment can be found in Koziel et al. (1993);
Hill et al. (1995) and Koziel et al. (1996). An additional preferred embodiment is the protoplast transformation method for maize as disclosed in EP 0 292 435.
Once a chimeric gene comprising a NIM1 homologue coding sequence has been transformed into a particular plant species, it may be propagated in that species or moved into other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques. Particularly preferred plants of the invention include the agronomically important crops listed above. The genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction and can thus be maintained and propagated in progeny plants.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 EXAMPLES
The invention is illustrated in further detail by the following detailed procedures, preparations, and examples. The examples are for illustration only, and are not to be construed as limiting the scope of the present invention. Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by Sambrook, et aL, 1989; by T.J. Silhavy, M.L. Berman, and L.W. Enquist, 1984;
and by Ausubel, F.M. et al., 1987.
I. Isolation of Homologues of the Arabidopsis NIM1 Gene Example 1: Isolation of a NIM1 Homologue from Nicotiana tabacum Plasmid DNA from a mass excision of phage from a tobacco cDNA library is used as a template for PCR using the following primer pairs: 5'-AGATTATTGTCAAGTCTAATG-3' (SEQ ID N0:9) + 5'-TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10), and 5'-GCGGATCCATGGATAATAGTAGG-3' (SEQ ID N0:11 ) +
5'-GCGGATCCTATTTCCTAAAAGGG-3' (SEQ ID N0:12). Cycling conditions are preferably 94 degrees for one minute, 40 degrees for one minute, and 72 degrees for 1.5 minutes, and the reaction is preferably carried out for 40 cycles. PCR
products are run out on agarose gels, excised, and cloned into pCRll-TOPO (Invitrogen).
The full-length cDNA sequence of this tobacco NIM1 homologue is shown in SEQ
ID
N0:1, and the protein encoded by this cDNA sequence is shown in SEQ ID N0:2. A
tobacco NIM1 homologue comprising SEQ ID N0:1 has been deposited as pNOV1206 with the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A) on August 17, 1998, and assigned accession no. NRRL B-30051.
Example 2: Isolation of a NIM1 Homologue from Lycopersicon esculentum Phagemids are excised from ~, ZAPII cDNA libraries of tomato using a protocol from Stratagene. Phagemids (plasmids) are mass-transformed into E. coli XL1-Blue in 10 pools of about 80,000 clones each and DNA is extracted from these pools. The pools are screened by PCR for the presence of NIM1 homologues by PCR using the following WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 primers: 5'-AGATTATTGTCAAGTCTAATG-3' (SEQ ID N0:9) and 5'-TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10).
Sequences amplified from the pools are confirmed to contain NIMI homologues by cloning the PCR-amplified DNA fragment and sequencing. Pools are made successively smaller and screened by PCR using the same primers mentioned above for the presence of the NIM1 homologues until a single clone containing the homologue is obtained.
In the event that the cDNA clone contains a partial gene missing the 5' end, 5' RACE
(Rapid Amplification of cDNA Ends) is used to obtain the full-length sequence of the gene.
The full-length cDNA sequence of this tomato NIM1 homologue is shown in SEQ ID
N0:3, and the protein encoded by this cDNA sequence is shown in SEQ ID N0:4. A
tomato NIM1 homologue comprising SEQ ID N0:3 has been deposited as pNOV1204 with the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A) on August 17, 1998, and assigned accession no. NRRL B-30050.
Example 3: Isolation of a NIM1 Homologue from Brassica napus Phagemids are excised from ~, ZAPII cDNA libraries of Brassica napus using a protocol from Stratagene. Phagemids (plasmids) are mass-transformed into E.
coli XL1-Blue in 10 pools of about 80,000 clones each and DNA is extracted from these pools. The pools are screened by PCR for the presence of NIM1 homologues by PCR using the following primers: 5'-AGATTATTGTCAAGTCTAATG-3' (SEQ ID N0:9) and 5'-TTCCATGTACCTTTGCTTC-3' (SEQ ID N0:10).
Sequences amplified from the pools are confirmed to contain NIM1 homologues by cloning the PCR-amplified DNA fragment and sequencing. Pools are made successively smaller and screened by PCR using the same primers mentioned above for the presence of the NIMi homologues until a single clone containing the homologue is obtained.
In the event that the cDNA clone contains a partial gene, missing the 5' end, 5' RACE
(Rapid Amplification of cDNA Ends) is used to obtain the full-length sequence of the gene.
A partial cDNA sequence of this Brassica napus NIM1 homologue is shown in SEQ
ID N0:5, and the protein encoded by this cDNA sequence is shown in SEQ ID
N0:6. A
Brassica napus NIM1 homologue comprising SEQ ID N0:5 has been deposited as pNOV1203 with the NRRL (Agricultural Research Service, Patent Culture Collection, WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A) on August 17, 1998, and assigned accession no. NRRL B-30049.
Example 4: Isolation of a NIM1 Homologue from Arabidopsis thaliana BLAST searches using the Arabidopsis or tomato NIM1 amino acid sequences as queries detect GenBank entry B26306, which contains Arabidopsis genomic sequence from the Bacterial Artificial Chromosome (BAC) F18D8. Part of the BAC sequence is predicted to encode a protein with significant similarity (47% amino acid identity) to NIM1. The following primers are designed to regions of the F18D8 sequence: 5'-TCAAGGCCTTGGATTCAGATG-3' (SEQ ID N0:13) and 5'-ATTAACTGCGCTACGTCCGTC-3' (SEQ ID N0:14).
The primers are used in a PCR reaction with DNA from a pFL61-based Arabidopsis cDNA library as a template. Preferable cycling conditions are 94 degrees for 30 seconds, 53 degrees for 30 seconds, 72 degrees for 30 seconds. The reaction is preferably run for 40 cycles. A PCR product of the predicted size (290 base pairs) is detected, and the cDNA
clone corresponding to the F18D8 primers is purified from the cDNA library by sequential purification by passage of increasingly smaller amounts of the library through E. coli and re-diagnosis of the presence of the clone by PCR. Ultimately, a single positive clone is obtained and sequenced. The sequence of the clone confirms the presence of an open reading frame with significant homology to NIM1.
A full-length cDNA sequence of this Arabidopsis thaliana NIM1 homologue is shown in SEQ ID N0:7, and the protein encoded by this cDNA sequence is shown in SEQ
ID
N0:8. An Arabidopsis thaliana NIM1 homologue comprising SEQ ID N0:7 has been deposited as AtNMLcS in E. coli with the NRRL (Agricultural Research Service, Patent Culture Collection, Northern Regional Research Center, 1815 North University Street, Peoria, Illinois 61604, U.S.A) on May 25, 1999, and assigned accession no.
NRRL B-30139.
Example 5: Design of Degenerate Primers In addition to the NIM1 gene (Ryals et al., 1997) and the NIM-like gene described above in Example 4 (AtNMLcS - SEQ ID N0:7), Arabidopsis thaliana contains three other NIM like (NML) genomic sequences: AtNMLc2 (SEQ ID N0:15), AtNMLc4-1 (SEQ ID

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 N0:17), and AtNMLc4-2 (SEQ ID N0:19), where c[#J stands for the chromosome number on which the particular NML gene is located. Using the GCG Seqweb multiple sequence alignment program (Pretty, Wisconsin Genetics Computer Group), the NIM1 sequences from Arabidopsis thaliana (Ryals et al., 1997), Nicotiana tabacum (Example 1 -SEQ ID
N0:1 ), and Lycopersicon esculentum (Example 2 - SEO ID N0:3), as well as the NML
sequences from Arabidopsis thaliana (SEQ ID N0:7, 15, 17, and 19) are aligned.
Based on this alignment, three regions emerge with sufficient conservation to design degenerate PCR
primers for PCR amplification of NIM1 homologues from other crop species, including sugarbeet, sunflower, potato, and canola. The primers designed from these conserved regions are listed below in Table 1. The NIM 1 (A-D) primers are designed using a lineup with only the NIMI genes from Arabidopsis thaliana (Ryals et al., 1997), Nicotiana tabacum (Example 1 - SEQ ID N0:1 ), and Lycopersicon esculentum (Example 2 - SEQ ID
N0:3).
The NIM 2(A-D) primers are designed using a lineup with these three sequences in addition to the four NML sequences from Arabidopsis thaliana (SEQ ID N0:7, 15, 17, and 19).
Primers are preferably synthesized by Genosys Biotechnologies, Inc. (The Woodlands, Texas). Positions of degeneracy are indicated in Table 1 by the notation of more than one base at a single site in the oligonucleotide. "Orientation" designates whether the primer is directed towards the 3' end (Downstream) or the 5' end (Upstream) of the cDNA.
Table 1: Degenerate Primers Primer Se uence 5' to 3' SEQ ID NO: Orientation NIM GAGATTATTGTCAAGTCTAATGTAGATA SEQ ID N0:21Downstream T T

NIM ACTGGACTCGGATGATATTGAATTA SEQ ID N0:22Downstream T T T T G G

NIM TAACTCAACATCATCAGAATCAAATGC SEO ID N0:23Upstream T T C G C G

NIM GTTGAGCAAGAGCAACTCTATTTTCAAG SEQ ID N0:24Upstream T C CC

G

T

NIM TGCATAGAAATAATTGTGAAGTCTAATGTAGA SEQ ID N0:25Downstream T G TG C G T

NIM GGCACTGGACTCAGATGATGTTGAACT SEQ ID N0:26Downstream T T T GT

NIM AACTCAACATCATCAGAATCCAATGCC SEQ ID N0:27Upstream GT T G G

NIM AGTTGAGCAAGGCCAACTCGATTTTCAAAAT SEQ ID N0:28Upstream T C A T GG

T

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Example 6: PCR Amplification of NIM-like DNA Fragments From Crop Species NIM like DNA fragments are amplified from Arabidopsis, tomato, tobacco, sugarbeet, sunflower, potato, and canola, using either genomic DNA or cDNA as templates.
The primer combinations used, along with the expected fragment sizes, are listed below in Table 2.
Table 2: Primer combinations and DNA fragment sizes Left PrimerRi ht PrimerFra ment Size b Degenerate primer PCR is preferably performed with Ready-To-Go PCR Beads (Amersham, Piscataway, NJ) in a GeneAmp PCR System 9700 (PE Applied Biosystems, Foster City, CA). 20 to 40 ng of genomic DNA or 5 to 10 ng of cDNA is used in each reaction, with each primer at a final concentration of 0.8 uM. Preferable cycling parameters are as follows: 94°C for 1 minute; 3 cycles of [94°C for 30 seconds; 37°C for 30 seconds;
72°C for 2 minutes]; 35 cycles of [94°C for 30 seconds;
60°C for 30 seconds; 72°C for 2 minutes]; 72°C for 7 minutes; 4°C hold. Reaction products are analyzed on 2% agarose gels and DNA fragments of the appropriate size are excised. DNA fragments are isolated from agarose bands using, for example, the Geneclean III Kit (BIO 101, Inc., Carlsbad, CA) and cloned using, for example, the TOPO TA Cloning Kit (Invitrogen Corporation, Carlsbad, CA). Plasmids are isolated using, for example, the CONCERT Rapid Plasmid Miniprep System (Life Technologies, Inc., Rockville, MD) and sequenced by standard protocols.
NIM-like DNA fragments are obtained from all plant species attempted, and in many cases multiple, unique Nlll~like sequences are isolated. Table 3 and Figure 2 detail the NIIV~Iike fragments that are isolated.

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Table 3: Nlll~like PCR fragments Species Successful Primer PCR TemplateUnique ClonesSE(~ ID
NO:

Pairs Arabido 1 A/1 D; 1 B/1 D Genomic DNA One sis Tobacco 1 A/1 D; 1 B/1 D; cDNA Four SEQ ID
2A/2D; NO:

2B/2D 29, 31, 33, and 35 Tomato 1 A/1 D; 1 B/1 D; Genomic DNA,One SEQ ID
2A/2D; NO:

2B/2D cDNA 37 Sugarbeet 1 B/1 D; 2B/2D Genomic DNA,One SEQ ID
NO:

cDNA 39 Sunflower 2B12D cDNA Two SEQ ID
NO:

41 and Potato 1 A/1 D; 1 A/1 C; cDNA Three SEQ ID
1 B/1 D; NO:

2A/2D; 2B/2D 45, 47, and Canola 2B/2D cDNA Four SEQ ID
NO:

51, 53, 55, and 57 Based on these results, the degenerate primer PCR described above can amplify Nlll~like fragments from a wide variety of plant species. In particular, the primer combination of NIM 2B/NIM 2D is successful with cDNA as a template from all species attempted. The use of Ready-To-Go PCR Beads is especially preferably for obtaining products. In addition, using cDNA as a template is preferable for all samples except Arabidopsis, tomato and sugarbeet, where genomic DNA is sufficient.
Example 7: Additional Degenerate Primers A new pair of degenerate primers is designed based on a sequence alignment of the four tobacco fragments (SEQ ID NO: 29, 31, 33, and 35) and the tomato sequence (SEQ ID
NO: 37) for use in determining whether tomato also contains similar NIM like sequences that are not amplified with the degenerate primers listed in Table 1. The primers designed from these fragments are listed below in Table 3 and are preferably synthesized by Genosys Biotechnologies, Inc. (The Woodlands, Texas). Positions of degeneracy are indicated in Table 3 by the notation of more than one base at a single site in the WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 oligonucleotide. "Orientation" designates whether the primer is directed towards the 3' end (Downstream) or the 5' end (Upstream) of the cDNA.
Table 4: Additional degenerate primers PrimerSe uence 5' TO 3' SEQ ID NO: Orientation NIM TAGATGAAGCATACGCTCTCCACTATGCTGT SEQ ID N0:59Downstream T C T T T

NIM GGCTCCTTACGCATGGCAGCAACATGAAGGAC SEQ ID N0:60Upstream T C T TG C

Degenerate primer PCR is performed as described above using tomato cDNA, and potential products are cloned and sequenced. The sequence analysis reveals two classes of Nlll~like fragments: the first is identical to the tomato sequence shown in SEQ ID NO: 37, and the second is unique in tomato and 88% identical to the tobacco sequences shown in SEQ ID N0:31 and 33. The sequence of this new tomato sequence is presented in SEQ ID
N0:61.
Example 8: Full-length NIM-like cDNA's Corresponding cDNA sequences upstream and downstream from Nlll~like PCR
fragments are preferably obtained by RACE PCR using the SMART RACE cDNA
Amplification Kit (Clontech, Palo Alto, CA). Preferably, at least three independent RACE
products are sequenced for each 5'- or 3'-end in order to eliminate PCR
errors. Resulting full-length cDNA sequences for Sugarbeet, Sunflower B, and Tobacco B NIM1 homologues, which correspond to the NIIV~Iike PCR fragments shown in SEQ ID N0:39, 43, and 31 are presented as SEQ ID N0:63, 65, and 73 respectively.
NIM like Arabidopsis thaliana cDNA's corresponding to the NIM like genomic sequences AtNMLc2 (SEQ ID N0:15), AtNMLc4-1 (SEQ ID N0:17), and AtNMLc4-2 (SEQ
ID N0:19), are preferably cloned by RT-PCR. Total RNA from Arabidopsis thaliana is reverse transcribed using oligo dT primer. The resulting first strand cDNA is amplified by PCR using specific sense and antisense oligonucleotide primers designed based on the 5' and 3' ends of the coding region of each genomic sequence (SEQ ID N0:15, 17, and 19).
PCR fragments of the predicted sizes are cloned into a vector and sequenced to confirm that these cDNA clones correspond to the NIM like genomic sequences. A cDNA
sequence corresponding to the NIIV~Iike genomic sequence AtNMLc2 (SEQ ID N0:15) is presented as WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 SEQ ID N0:67; a full-length cDNA sequence corresponding to the NIIV~Iike genomic sequence AtNMLc4-1 (SEQ ID N0:17) is presented as SEQ ID N0:69; and a full-length cDNA sequence corresponding to the NIIVf-like genomic sequence AtNMLc4-2 (SEQ
ID
N0:19) is presented as SEQ ID N0:71.
Example 9: Northern Analysis Northern data shows that expression of the sugarbeet NIM-like clone (SEQ ID
N0:39 and 63) increases three to seven fold after 100NM or 300 NM BTH
(benzo(1,2,3)thiadiazole-7-carbothioic acid S-methyl ester) treatment. Also, Northern data shows that expression of the Sunflower A NIM-like clone (SEQ ID N0:41 ) is constitutive. Furthermore, Northern data shows that expression of the Sunflower B NIM-like clone (SEQ ID N0:43 and 65) increases two fold after 100NM or 300 NM BTH treatment.
II. Expression of the Gene Sequences of the Invention In Plants A NIM1 homologue of the present invention can be incorporated into plant cells using conventional recombinant DNA technology. Generally, this involves inserting a coding sequence of the invention into an expression system to which the coding sequence is heterologous (i.e., not normally present) using standard cloning procedures known in the art. The vector contains the necessary elements for the transcription and translation of the inserted protein-coding sequences. A large number of vector systems known in the art can be used, such as plasmids, bacteriophage viruses and other modified viruses.
Suitable vectors include, but are not limited to, viral vectors such as lambda vector systems ~,gtl1, ~,gtl0 and Charon 4; plasmid vectors such as pB1121, pBR322, pACYC177, pACYC184, pAR series, pKK223-3, pUCB, pUC9, pUCl8, pUCl9, pLG339, pRK290, pKC37, pKC101, pCDNAII; and other similar systems. The components of the expression system may also be modified to increase expression. For example, truncated sequences, nucleotide substitutions or other modifications may be employed. The expression systems described herein can be used to transform virtually any crop plant cell under suitable conditions. Transformed cells can be regenerated into whole plants such that the NIM1 homologue increases SAR gene expression and enhances disease resistance in the transgenic plants.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Example 10: Construction of Plant Expression Cassettes Coding sequences intended for expression in transgenic plants are first assembled in expression cassettes behind a suitable promoter expressible in plants. The expression cassettes may also comprise any further sequences required or selected for the expression of the transgene. Such sequences include, but are not restricted to, transcription terminators, extraneous sequences to enhance expression such as introns, vital sequences, and sequences intended for the targeting of the gene product to specific organelles and cell compartments. These expression cassettes can then be easily transferred to the plant transformation vectors described below. The following is a description of various components of typical expression cassettes.
1. Promoters The selection of the promoter used in expression cassettes will determine the spatial and temporal expression pattern of the transgene in the transgenic plant.
Selected promoters will express transgenes in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the desired location of accumulation of the gene product. Alternatively, the selected promoter may drive expression of the gene under various inducing conditions. Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters can be used, including the gene's native promoter. The following are non-limiting examples of promoters that may be used in expression cassettes.
a. Constitutive Expression, the Ubiquitin Promoter:
Ubiquitin is a gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g.
sunflower - Binet et a1.,1991; maize - Christensen et al., 1989; and Arabidopsis - Norris et al., 1993). The maize ubiquitin promoter has been developed in transgenic monocot systems and its sequence and vectors constructed for monocot transformation are disclosed in the patent publication EP 0 342 926 (to Lubrizol). Taylor et al. (1993) describe a vector (pAHC25) that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 bombardment. The Arabidopsis ubiquitin promoter is especially preferred for use with the NIMi homologues of the present invention. The ubiquitin promoter is suitable for gene expression in transgenic plants, both monocotyledons and dicotyledons.
Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
b. Constitutive Expression, the CaMV 35S Promoter:
Construction of the plasmid pCGN1761 is described in the published patent application EP 0 392 225 (Example 23). pCGN1761 contains the "double" CaMV 35S
promoter and the tml transcriptional terminator with a unique EcoRl site between the promoter and the terminator and has a pUC-type backbone. A derivative of pCGN1761 is constructed which has a modified polylinker which includes Notl and Xhol sites in addition to the existing EcoRl site. This derivative is designated pCGN1761 ENX.
pCGN1761 ENX is useful for the cloning of cDNA sequences or coding sequences (including microbial ORF
sequences) within its polylinker for the purpose of their expression under the control of the 35S promoter in transgenic plants. The entire 35S promoter-coding sequence-tml terminator cassette of such a construction can be excised by Hindlll, Sphl, Sall, and Xbal sites 5' to the promoter and Xbal, BamHl and Bgll sites 3' to the terminator for transfer to transformation vectors such as those described below. Furthermore, the double promoter fragment can be removed by 5' excision with Hindlll, Sphl, Sall, Xbal, or Pstl, and 3' excision with any of the polylinker restriction sites (EcoRl, Notl or Xhon for replacement with another promoter. If desired, modifications around the cloning sites can be made by the introduction of sequences that may enhance translation. This is particularly useful when overexpression is desired. For example, pCGN1761 ENX may be modified by optimization of the translational initiation site as described in Example 37 of U.S. Patent No. 5,639,949.
c. Constitutive Expression, the Actin Promoter:
Several isoforms of actin are known to be expressed in most cell types and consequently the actin promoter is a good choice for a constitutive promoter.
In particular, the promoter from the rice Actl gene has been cloned and characterized (McElroy et al., 1990). A 1.3kb fragment of the promoter was found to contain all the regulatory elements required for expression in rice protoplasts. Furthermore, numerous expression vectors based on the Actl promoter have been constructed specifically for use in monocotyledons (McElroy et al., 1991 ). These incorporate the Actl-intron 1, Adhl 5' flanking sequence and Adhl intron 1 (from the maize alcohol dehydrogenase gene) and sequence from the CaMV
35S promoter. Vectors showing highest expression were fusions of 35S and Actl intron or the ActlS' flanking sequence and the Actl intron. Optimization of sequences around the initiating ATG (of the GUS reporter gene) also enhanced expression. The promoter expression cassettes described by McElroy et al. (1991 ) can be easily modified for gene expression and are particularly suitable for use in monocotyledonous hosts.
For example, promoter-containing fragments is removed from the McElroy constructions and used to replace the double 35S promoter in pCGN1761 ENX, which is then available for the insertion of specific gene sequences. The fusion genes thus constructed can then be transferred to appropriate transformation vectors. In a separate report, the rice Actl promoter with its first intron has also been found to direct high expression in cultured barley cells (Chibbar et al., 1993).
d. Inducible Expression, the PR-1 Promoter:
The double 35S promoter in pCGN1761 ENX may be replaced with any other promoter of choice that will result in suitably high expression levels. By way of example, one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395 may replace the double 35S promoter. The promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites. Should PCR-amplification be undertaken, then the promoter should be re-sequenced to check for amplification errors after the cloning of the amplified promoter in the target vector. The chemically/pathogen regulatable tobacco PR-1 a promoter is cleaved from plasmid pCIB1004 (for construction, see example 21 of EP 0 332 104) and transferred to plasmid pCGN1761 ENX (Uknes et al., 1992).
pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered blunt by treatment with T4 DNA polymerase. The fragment is then cleaved with Hindlll and the resultant PR-1 a promoter-containing fragment is gel purified and cloned into pCGN1761 ENX from which the double 35S promoter has been removed. This is done by cleavage with Xhol and blunting with T4 polymerase, followed by cleavage with Hindlll and isolation of the larger vector-terminator containing fragment into which the pCIB1004 promoter fragment is cloned. This generates a pCGN1761 ENX derivative with the PR-1 a promoter and the tml terminator and an intervening polylinker with unique EcoRl and Notl sites. The selected coding sequence can be inserted into this vector, and the fusion products (i.e. promoter-gene-terminator) can subsequently be transferred to any selected transformation vector, including those described infra. Various chemical regulators may be employed to induce expression of the selected coding sequence in the plants transformed according to the present invention, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos. 5,523,311 and 5,614,395.
e. Inducible Expression, an Ethanol-Inducible Promoter:
A promoter inducible by certain alcohols or ketones, such as ethanol, may also be used to confer inducible expression of a coding sequence of the present invention. Such a promoter is for example the alcA gene promoter from Aspergillus nidulans (Caddick et al., 1998). In A. nidulans, the alcA gene encodes alcohol dehydrogenase I, the expression of which is regulated by the AIcR transcription factors in presence of the chemical inducer.
For the purposes of the present invention, the CAT coding sequences in plasmid paIcA:CAT
comprising a alcA gene promoter sequence fused to a minimal 35S promoter (Caddick ef al., 1998) are replaced by a coding sequence of the present invention to form an expression cassette having the coding sequence under the control of the alcA gene promoter. This is carried out using methods well known in the art.
f. Inducible Expression, a Glucocorticoid-Inducible Promoter:
Induction of expression of a NIM1 homologue of the present invention using systems based on steroid hormones is also contemplated. For example, a glucocorticoid-mediated induction system is used (Aoyama and Chua, 1997) and gene expression is induced by application of a glucocorticoid, for example a synthetic glucocorticoid, preferably dexamethasone, preferably at a concentration ranging from 0.1 mM to 1 mM, more preferably from lOmM to 100mM. For the purposes of the present invention, the luciferase gene sequences are replaced by a gene sequence encoding a NIM1 homologue to form an expression cassette having the gene sequence encoding a NIM1 homologue under the control of six copies of the GAL4 upstream activating sequences fused to the 35S minimal promoter. This is carried out using methods well known in the art. The trans-acting factor comprises the GAL4 DNA-binding domain (Keegan et al., 1986) fused to the transactivating domain of the herpes viral protein VP16 (Triezenberg et al., 1988) fused to the hormone-binding domain of the rat glucocorticoid receptor (Picard et al., 1988). The expression of the fusion protein is controlled by any promoter suitable for expression in plants known in the art or described here. This expression cassette is also comprised in the plant comprising the gene sequence encoding a NIM1 homologue fused to the 6xGAL4/minimal promoter.

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Thus, tissue- or organ-specificity of the fusion protein is achieved leading to inducible tissue- or organ-specificity of the NIM1 homologue.
g. Root Specific Expression:
Another pattern of gene expression is root expression. A suitable root promoter is described by de Framond (1991 ) and also in the published patent application EP 0 452 269.
This promoter is transferred to a suitable vector such as pCGN1761 ENX for the insertion of a selected gene and subsequent transfer of the entire promoter-gene-terminator cassette to a transformation vector of interest.
h. Wound-Inducible Promoters:
Wound-inducible promoters may also be suitable for gene expression. Numerous such promoters have been described (e.g. Xu et al., 1993); Logemann et al., 1989;
Rohrmeier & Lehle, 1993; Firek et al., 1993; Warner et al., 1993) and all are suitable for use with the instant invention. Logemann et al. describe the 5' upstream sequences of the dicotyledonous potato wunl gene. Xu et al. show that a wound-inducible promoter from the dicotyledon potato (pink is active in the monocotyledon rice. Further, Rohrmeier & Lehle describe the cloning of the maize Vtiipl cDNA which is wound induced and which can be used to isolate the cognate promoter using standard techniques. Similar, Firek et al, and Warner et al. have described a wound-induced gene from the monocotyledon Asparagus officinalis, which is expressed at local wound and pathogen invasion sites.
Using cloning techniques well known in the art, these promoters can be transferred to suitable vectors, fused to the genes pertaining to this invention, and used to express these genes at the sites of plant wounding.
i. Pith-Preferred Expression:
Patent Application WO 93/07278 describes the isolation of the maize trpA gene, which is preferentially expressed in pith cells. The gene sequence and promoter extending up to -1726 by from the start of transcription are presented. Using standard molecular biological techniques, this promoter, or parts thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a foreign gene in a pith-preferred manner. In fact, fragments containing the pith-preferred promoter or parts thereof can be transferred to any vector and modified for utility in transgenic plants.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 j. Leaf-Specific Expression:
A maize gene encoding phosphoenol carboxylase (PEPC) has been described by Hudspeth & Grula (1989). Using standard molecular biological techniques the promoter for this gene can be used to drive the expression of any gene in a leaf-specific manner in transgenic plants.
k. Pollen-Specific Expression:

8 describes the isolation of the maize calcium-dependent protein kinase (CDPK) gene which is expressed in pollen cells. The gene sequence and promoter extend up to 1400 by from the start of transcription. Using standard molecular biological techniques, this promoter or parts thereof, can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a NIM1 homologue of the present invention in a pollen-specific manner.
2. Transcriptional Terminators A variety of transcriptional terminators are available for use in expression cassettes.
These are responsible for the termination of transcription beyond the transgene and its correct polyadenylation. Appropriate transcriptional terminators are those that are known to function in plants and include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator and the pea rbcS E9 terminator. These can be used in both monocotyledons and dicotyledons. In addition, a gene's native transcription terminator may be used.
3. Sequences for the Enhancement or Regulation of Expression Numerous sequences have been found to enhance gene expression from within the transcriptional unit and these sequences can be used in conjunction with the genes of this invention to increase their expression in transgenic plants.
Various intron sequences have been shown to enhance expression, particularly in monocotyledonous cells. For example, the introns of the maize Adhl gene have been found to significantly enhance the expression of the wild-type gene under its cognate promoter when introduced into maize cells. Intron 1 was found to be particularly effective and enhanced expression in fusion constructs with the chloramphenicol acetyltransferase gene (Callis etal., 1987). In the same experimental system, the intron from the maize bronzel WO 00/53762 cA 02365968 2001-o9-os PCT/EP00/01978 gene had a similar effect in enhancing expression. Intron sequences have been routinely incorporated into plant transformation vectors, typically within the non-translated leader.
A number of non-translated leader sequences derived from viruses are also known to enhance expression, and these are particularly effective in dicotyledonous cells.
Specifically, leader sequences from Tobacco Mosaic Virus (TMV, the "W-sequence"), Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMV) have been shown to be effective in enhancing expression (e.g. Gallie et al., 1987; Skuzeski et al., 1990).
4. Targeting of the Gene Product Within the Cell Various mechanisms for targeting gene products are known to exist in plants and the sequences controlling the functioning of these mechanisms have been characterized in some detail. For example, the targeting of gene products to the chloroplast is controlled by a signal sequence found at the amino terminal end of various proteins which is cleaved during chloroplast import to yield the mature protein (e.g. Comai et al., 1988). These signal sequences can be fused to heterologous gene products to effect the import of heterologous products into the chloroplast (van den Broeck, et aL, 1985). DNA encoding for appropriate signal sequences can be isolated from the 5' end of the cDNAs encoding the RUBISCO
protein, the CAB protein, the EPSP synthase enzyme, the GS2 protein and many other proteins which are known to be chloroplast localized. See also, the section entitled "Expression With Chloroplast Targeting" in Example 37 of U.S. Patent No.
5,639,949.
Other gene products are localized to other organelles such as the mitochondrion and the peroxisome (e.g. Unger et al., 1989). The cDNAs encoding these products can also be manipulated to effect the targeting of heterologous gene products to these organelles.
Examples of such sequences are the nuclear-encoded ATPases and specific aspartate amino transferase isoforms for mitochondria. Targeting cellular protein bodies has been described by Rogers et al. (1985).
In addition, sequences have been characterized which cause the targeting of gene products to other cell compartments. Amino terminal sequences are responsible for targeting to the ER, the apoplast, and extracellular secretion from aleurone cells (Koehler &
Ho, 1990). Additionally, amino terminal sequences in conjunction with carboxy terminal sequences are responsible for vacuolar targeting of gene products (Shinshi et al., 1990).
By the fusion of the appropriate targeting sequences described above to transgene sequences of interest it is possible to direct the transgene product to any organelle or cell compartment. For chloroplast targeting, for example, the chloroplast signal sequence from WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 the RUBISCO gene, the CAB gene, the EPSP synthase gene, or the GS2 gene is fused in frame to the amino terminal ATG of the transgene. The signal sequence selected should include the known cleavage site, and the fusion constructed should take into account any amino acids after the cleavage site which are required for cleavage. In some cases this requirement may be fulfilled by the addition of a small number of amino acids between the cleavage site and the transgene ATG or, alternatively, replacement of some amino acids within the transgene sequence. Fusions constructed for chloroplast import can be tested for efficacy of chloroplast uptake by in vitro translation of in vitro transcribed constructions followed by in vitro chloroplast uptake using techniques described by Bartlett et al. (1982) and Wasmann et al. (1986). These construction techniques are well known in the art and are equally applicable to mitochondria and peroxisomes.
The above-described mechanisms for cellular targeting can be utilized not only in conjunction with their cognate promoters, but also in conjunction with heterologous promoters so as to effect a specific cell-targeting goal under the transcriptional regulation of a promoter that has an expression pattern different to that of the promoter from which the targeting signal derives.
Example 11: Construction of Plant Transformation Vectors Numerous transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors. The selection of vector will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing &
Vierra, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., 1990; Spencer ef al., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann), and the dhfrgene, which confers resistance to methatrexate (Bourouis ef al., 1983), and the EPSPS
gene, which confers resistance to glyphosate (U.S. Patent Nos. 4,940,935 and 5,188,642).
1. Vectors Suitable for Agrobacterium Transformation WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Many vectors are available for transformation using Agrobacterium tumefaciens.
These typically carry at least one T-DNA border sequence and include vectors such as pBINl9 (Bevan, Nucl. Acids Res. (1984)) and pXYZ. Below, the construction of two typical vectors suitable for Agrobacterium transformation is described.
a. pCIB200 and pCIB2001:
The binary vectors pcIB200 and pCIB2001 are used for the construction of recombinant vectors for use with Agrobacterium and are constructed in the following manner. pTJS75kan is created by Narl digestion of pTJS75 (Schmidhauser &
Helinski, 1985) allowing excision of the tetracycline-resistance gene, followed by insertion of an Accl fragment from pUC4K carrying an NPTII (Messing & Vierra, 1982; Bevan et al., 1983;
McBride et al., 1990). Xhol linkers are ligated to the EcoRV fragment of PCIB7 which contains the left and right T-DNA borders, a plant selectable noslnptll chimeric gene and the pUC polylinker (Rothstein et al., 1987), and the Xhol digested fragment are cloned into Sall-digested pTJS75kan to create pCIB200 (see also EP 0 332 104, example 19).
pCIB200 contains the following unique polylinker restriction sites: EcoRI, Sstl, Kpnl, Bglll, Xbal, and Sall. pCIB2001 is a derivative of pCIB200 created by the insertion into the polylinker of additional restriction sites. Unique restriction sites in the polylinker of pCIB2001 are EcoRl, Sstl, Kpnl, Bglll, Xbal, Sall, Mlul, Bcll, Avrll, Apal, Hpal, and Stul.
pCIB2001, in addition to containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right T-DNA borders for Agrobacterium-mediated transformation, the RK2-derived trfA function for mobilization between E. coli and other hosts, and the OriT and OriV functions also from RK2. The pCIB2001 polylinker is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
b. pCIBlO and Hygromycin Selection Derivatives thereof:
The binary vector pCIBlO contains a gene encoding kanamycin resistance for selection in plants and T-DNA right and left border sequences and incorporates sequences from the wide host-range plasmid pRK252 allowing it to replicate in both E.
coli and Agrobacterium. Its construction is described by Rothstein et al. (1987).
Various derivatives of pCIBlO are constructed which incorporate the gene for hygromycin B
phosphotransferase described by Gritz et al., 1983). These derivatives enable selection of transgenic plant cells on hygromycin only (pCIB743), or hygromycin and kanamycin (pCIB715, pCIB717).

2. Vectors Suitable for non-Agrobacterium Transformation Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. Below, the construction of typical vectors suitable for non-Agrobacterium transformation is described.
a. pCIB3064:
pCIB3064 is a pUC-derived vector suitable for direct gene transfer techniques in combination with selection by the herbicide basta (or phosphinothricin). The plasmid pCIB246 comprises the CaMV 35S promoter in operational fusion to the E, coli GUS gene and the CaMV 35S transcriptional terminator and is described in the PCT
published application WO 93/07278. The 35S promoter of this vector contains two ATG
sequences 5' of the start site. These sites are mutated using standard PCR techniques in such a way as to remove the ATGs and generate the restriction sites Sspl and Pvull. The new restriction sites are 96 and 37 by away from the unique Sall site and 101 and 42 by away from the actual start site. The resultant derivative of pCIB246 is designated pCIB3025.
The GUS
gene is then excised from pCIB3025 by digestion with Sall and Sacl, the termini rendered blunt and religated to generate plasmid pCIB3060. The plasmid pJIT82 is obtained from the John Innes Centre, Norwich and the a 400 by Smal fragment containing the bar gene from Streptomyces viridochromogenes is excised and inserted into the Hpal site of pCIB3060 (Thompson etal., 1987). This generated pCIB3064, which comprises the bar gene under the control of the CaMV 35S promoter and terminator for herbicide selection, a gene for ampicillin resistance (for selection in E, coh) and a polylinker with the unique sites Sphl, Pstl, Hindlll, and BamHl. This vector is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
b. pSOGl9 and pSOG35:
pSOG35 is a transformation vector that utilizes the E, coli gene dihydrofolate reductase (DFR) as a selectable marker conferring resistance to methotrexate.
PCR is WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 used to amplify the 35S promoter (-800 bp), intron 6 from the maize Adh1 gene (-550 bp) and 18 by of the GUS untranslated leader sequence from pSOGlO. A 250-by fragment encoding the E. coli dihydrofolate reductase type II gene is also amplified by PCR and these two PCR fragments are assembled with a Sacl-Pstl fragment from pB1221 (Clontech) which comprises the pUCl9 vector backbone and the nopaline synthase terminator.
Assembly of these fragments generates pSOGl9 which contains the 35S promoter in fusion with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator. Replacement of the GUS leader in pSOGl9 with the leader sequence from Maize Chlorotic Mottle Virus (MCMV) generates the vector pSOG35. pSOGl9 and pSOG35 carry the pUC gene for ampicillin resistance and have Hindlll, Sphl, Pstl and EcoRl sites available for the cloning of foreign substances.
Example 12: Transformation Once the gene sequence of interest has been cloned into an expression system, it is transformed into a plant cell. Methods for transformation and regeneration of plants are well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, micro-injection, and microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants.
1. Transformation of Dicotyledons Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium. Non-Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described by Paszkowski et al., 1984; Potrykus et al., 1985; Reich et al., 1986; and Klein et al., 1987. In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
Agrobacterium-mediated transformation is a preferred technique for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species. Agrobacterium transformation typically involves the transfer of the binary WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 vector carrying the foreign DNA of interest (e,g. pCIB200 or pCIB2001 ) to an appropriate Agrobacterium strain which may depend of the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g, strain CIB542 for pCIB200 and pCIB2001 (Uknes et al., 1993). The transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E.
coli carrying the recombinant binary vector, a helper E. coil strain which carries a plasmid such as pRK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Hofgen & Willmitzer, 1988).
Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows protocols well known in the art. Transformed tissue is regenerated on selectable medium carrying the antibiotic or herbicide resistance marker present between the binary plasmid T-DNA borders.
Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in U.S.
Patent Nos. 4,945,050, 5,036,006, and 5,100,792. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof.
When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the desired gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced) can also be propelled into plant cell tissue.
2. Transformation of Monocotyledons Transformation of most monocotyledon species has now also become routine.
Preferred techniques include direct gene transfer into protoplasts using PEG
or electroporation techniques, and particle bombardment into callus tissue.
Transformations can be undertaken with a single DNA species or multiple DNA species (i,e, co-transformation) and both these techniques are suitable for use with this invention. Co-transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable. However, a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher et al., 1986).
Patent Applications EP 0 292 435, EP 0 392 225, and WO 93/07278 describe techniques for the preparation of callus and protoplasts from an elite inbred line of maize, transformation of protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed protoplasts. Gordon-Kamm et aL (1990) and Fromm et al.
(1990) have published techniques for transformation of A188-derived maize line using particle bombardment. Furthermore, WO 93/07278 and Koziel et al. (1993) describe techniques for the transformation of elite inbred lines of maize by particle bombardment.
This technique utilizes immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and a PDS-1000He Biolistics device for bombardment.
Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment. Protoplast-mediated transformation has been described for Japonica-types and lndica-types (Zhang et al., 1988; Shimamoto et al., 1989;
Datta et al., 1990). Both types are also routinely transformable using particle bombardment (Christou et al., 1991 ). Furthermore, WO 93/21335 describes techniques for the transformation of rice via electroporation.
Patent Application EP 0 332 581 describes techniques for the generation, transformation and regeneration of Pooideae protoplasts. These techniques allow the transformation of Dactylis and wheat. Furthermore, wheat transformation has been described by Vasil et al. (1992) using particle bombardment into cells of type C long-term regenerable callus, and also by Vasil et al. (1993) and Weeks et al. (1993) using particle bombardment of immature embryos and immature embryo-derived callus. A
preferred technique for wheat transformation, however, involves the transformation of wheat by particle bombardment of immature embryos and includes either a high sucrose or a high maltose step prior to gene delivery. Prior to bombardment, any number of embryos (0.75-1 mm in length) are plated onto MS medium with 3% sucrose (Murashiga & Skoog, 1962) and 3 mg/I 2,4-D for induction of somatic embryos, which is allowed to proceed in the dark. On the chosen day of bombardment, embryos are removed from the induction medium and placed onto the osmoticum (i.e. induction medium with sucrose or maltose added at the desired concentration, typically 15%). The embryos are allowed to plasmolyze for 2-3 h and are then bombarded. Twenty embryos per target plate is typical, although not critical. An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size gold particles using standard procedures. Each plate of embryos is shot with the DuPont Biolistics0 helium device using a burst pressure of 1000 psi using a standard 80 mesh screen. After bombardment, the embryos are placed back into the dark to recover for about 24 h (still on osmoticum). After 24 hrs, the embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration. Approximately one month later the embryo explants with developing embryogenic callus are transferred to regeneration medium (MS + 1 mg/liter NAA, 5 mg/liter GA), further containing the appropriate selection agent (10 mg/I basta in the case of pCIB3064 and 2 mg/I methotrexate in the case of pSOG35). After approximately one month, developed shoots are transferred to larger sterile containers known as "GA7s" which contain half-strength MS, 2% sucrose, and the same concentration of selection agent.
Tranformation of monocotyledons using Agrobacterium has also been described.
See, WO 94/00977 and U.S. Patent No. 5,591,616.
III. Breeding and Seed Production Example 13: Breeding The plants obtained via tranformation with a gene of the present invention can be any of a wide variety of plant species, including those of monocots and dicots;
however, the plants used in the method of the invention are preferably selected from the list of agronomically important target crops set forth supra. The expression of a gene of the present invention in combination with other characteristics important for production and quality can be incorporated into plant lines through breeding. Breeding approaches and techniques are known in the art. See, for example, Welsh J. R. (1981 ); Wood D. R. (Ed.) (1983); Mayo O. (1987); Singh, D.P. (1986); and Wricke and Weber (1986).
The genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants. Generally said maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting. Specialized processes such as hydroponics or greenhouse technologies can also be applied. As the growing crop is vulnerable to attack and damages caused by insects or infections as well as to competition by weed plants, measures are WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 undertaken to control weeds, plant diseases, insects, nematodes, and other adverse conditions to improve yield. These include mechanical measures such a tillage of the soil or removal of weeds and infected plants, as well as the application of agrochemicals such as herbicides, fungicides, gametocides, nematicides, growth regulants, ripening agents and insecticides.
Use of the advantageous genetic properties of the transgenic plants and seeds according to the invention can further be made in plant breeding, which aims at the development of plants with improved properties such as tolerance of pests, herbicides, or stress, improved nutritional value, increased yield, or improved structure causing less loss from lodging or shattering. The various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending on the desired properties, different breeding measures are taken. The relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical, or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines.
Thus, the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines, that for example, increase the effectiveness of conventional methods such as herbicide or pestidice treatment or allow one to dispense with said methods due to their modified genetic properties. Alternatively new crops with improved stress tolerance can be obtained, which, due to their optimized genetic "equipment', yield harvested product of better quality than products that were not able to tolerate comparable adverse developmental conditions.
Example 14: Seed Production In seeds production, germination quality and uniformity of seeds are essential product characteristics, whereas germination quality and uniformity of seeds harvested and sold by the farmer is not important. As it is difficult to keep a crop free from other crop and weed seeds, to control seedborne diseases, and to produce seed with good germination, fairly extensive and well-defined seed production practices have been developed by seed WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 producers, who are experienced in the art of growing, conditioning and marketing of pure seed. Thus, it is common practice for the farmer to buy certified seed meeting specific quality standards instead of using seed harvested from his own crop.
Propagation material to be used as seeds is customarily treated with a protectant coating comprising herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides, or mixtures thereof.
Customarily used protectant coatings comprise compounds such as captan, carboxin, thiram (TMTD~), methalaxyl (Apron~), and pirimiphos-methyl (Actellic~). If desired, these compounds are formulated together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation to provide protection against damage caused by bacterial, fungal or animal pests. The protectant coatings may be applied by impregnating propagation material with a liquid formulation or by coating with a combined wet or dry formulation. Other methods of application are also possible such as treatment directed at the buds or the fruit.
It is a further aspect of the present invention to provide new agricultural methods, such as the methods examplified above, which are characterized by the use of transgenic plants, transgenic plant material, or transgenic seed according to the present invention.
The seeds may be provided in a bag, container or vessel comprised of a suitable packaging material, the bag or container capable of being closed to contain seeds. The bag, container or vessel may be designed for either short term or long term storage, or both, of the seed. Examples of a suitable packaging material include paper, such as kraft paper, rigid or pliable plastic or other polymeric material, glass or metal.
Desirably the bag, container, or vessel is comprised of a plurality of layers of packaging materials, of the same or differing type. In one embodiment the bag, container or vessel is provided so as to exclude or limit water and moisture from contacting the seed. In one example, the bag, container or vessel is sealed, for example heat sealed, to prevent water or moisture from entering. In another embodiment water absorbent materials are placed between or adjacent to packaging material layers. In yet another embodiment the bag, container or vessel, or packaging material of which it is comprised is treated to limit, suppress or prevent disease, contamination or other adverse affects of storage or transport of the seed.
An example of such treatment is sterilization, for example by chemical means or by exposure to radiation. Comprised by the present invention is a commercial bag comprising seed of a transgenic plant comprising a gene of the present invention that is expressed in said transformed plant at higher levels than in a wild type plant, together with a suitable carrier, together with label instructions for the use thereof for conferring broad spectrum disease resistance to plants.
IV. Disease Resistance Evaluation Disease resistance evaluation is performed by methods known in the art. See, Uknes et al. (1993); Gorlach et al. (1996); Alexander et al. (1993). For example, several representative disease resistance assays are described below.
Example 15: Phytophthora parasitica (Black Shank) Resistance Assay Assays for resistance to Phytophthora parasitica, the causative organism of black shank, are performed on six-week-old plants grown as described in Alexander et al. (1993).
Plants are watered, allowed to drain well, and then inoculated by applying 10 ml of a sporangium suspension (300 sporangia/ml) to the soil. Inoculated plants are kept in a greenhouse maintained at 23-25°C day temperature, and 20-22°C
night temperature. The wilt index used for the assay is as follows: 0=no symptoms; 1=no symptoms;
1=some sign of wilting, with reduced turgidity; 2=clear wilting symptoms, but no rotting or stunting;
3=clear wilting symptoms with stunting, but no apparent stem rot; 4=severe wilting, with visible stem rot and some damage to root system; 5=as for 4, but plants near death or dead, and with severe reduction of root system. All assays are scored blind on plants arrayed in a random design.
Example 16: Pseudomonas syringae Resistance Assay Pseudomonas syringae pv. tabaci strain #551 is injected into the two lower leaves of several 6-7-week-old plants at a concentration of 106 or 3 x 106 per ml in H20. Six individual plants are evaluated at each time point. Pseudomonas tabaci infected plants are rated on a point disease severity scale, 5=100% dead tissue, 0=no symptoms. A T-test (LSD) is conducted on the evaluations for each day and the groupings are indicated after the Mean disease rating value. Values followed by the same letter on that day of evaluation are not statistically significantly different.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Example 17: Cercospora nicotianae Resistance Assay A spore suspension of Cercospora nicotianae (ATCC #18366) (100,000-150,000 spores per ml) is sprayed to imminent run-off onto the surface of the leaves.
The plants are maintained in 100% humidity for five days. Thereafter the plants are misted with water 5-10 times per day. Six individual plants are evaluated at each time point.
Cercospora nicotianae is rated on a % leaf area showing disease symptoms basis. A T-test (LSD) is conducted on the evaluations for each day and the groupings are indicated after the Mean disease rating value. Values followed by the same letter on that day of evaluation are not statistically significantly different.
Example 18: Peronospora parasitica Resistance Assay Assays for resistance to Peronospora parasitica are performed on plants as described in Uknes et al, (1993). Plants are inoculated with a compatible isolate of P.
parasitica by spraying with a conidial suspension (approximately 5 x 104 spores per milliliter). Inoculated plants are incubated under humid conditions at 17° C in a growth chamber with a 14-hr day/10-hr night cycle. Plants are examined at 3-14 days, preferably 7-12 days, after inoculation for the presence of conidiophores. In addition, several plants from each treatment are randomly selected and stained with lactophenol-trypan blue (Keogh et al., 1980) for microscopic examination.
The above disclosed embodiments are illustrative. This disclosure of the invention will place one skilled in the art in possession of many variations of the invention. All such obvious and foreseeable variations are intended to be encompassed by the claims.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
SEQ ID N0:1 - Full length cDNA sequence of a NIM1 homologue from Nicotiana tabacum.
SEQ ID N0:2 - Protein sequence of the Nicotiana tabacum NIM1 homologue encoded by SEQ ID N0:1.
SEQ ID N0:3 - Full length cDNA sequence of a NIM1 homologue from Lycopersicon esculentum.

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 SEQ ID N0:4 - Protein sequence of the Lycopersicon esculentum NIM1 homologue encoded by SEQ ID N0:3.
SEQ ID N0:5 - Partial cDNA sequence of a NIM1 homologue from Brassica napus.
SEQ ID N0:6 - Partial protein sequence of the Brassica napus NIM1 homologue encoded by SEQ ID N0:5.
SEQ ID N0:7 - Full length cDNA sequence of a NIM1 homologue (AtNMLcS~ from Arabidopsis thaliana.
SEQ ID N0:8 - Full length protein sequence of the Arabidopsis thaliana NIM1 homologue AtNMLc5 encoded by SEQ ID N0:7.
SEQ ID NOs:9-14 - Oligonucleotide primers used in Examples 1-4.
SEQ ID N0:15 - Genomic DNA sequence of a NIM1 homologue (AtNMLc2) from Arabidopsis thaliana.
SEQ ID N0:16 - Protein sequence of the Arabidopsis thaliana NIM1 homologue AtNMLc2 encoded by SEQ ID N0:15.
SEQ ID N0:17 - Genomic DNA sequence of a NIM1 homologue (AtNMLc4-1) from Arabidopsis thaliana.
SEQ ID N0:18 - Protein sequence of the Arabidopsis thaliana NIM1 homologue AtNMLc4-1 encoded by SEQ ID N0:17.
SEQ ID N0:19 - Genomic DNA sequence of a NIM1 homologue (AfNMLc4-2) from Arabidopsis thaliana.
SEQ ID N0:20 - Protein sequence of the Arabidopsis thaliana NIM1 homologue AtNMLc4-2 encoded by SEQ ID N0:19.
SEQ ID N0:21 - PCR primer NIM 1A.
SEQ ID N0:22 - PCR primer NIM 1 B.
SEQ ID N0:23 - PCR primer NIM 1C.
SEQ ID N0:24 - PCR primer NIM 1 D.
SEQ ID N0:25 - PCR primer NIM 2A.
SEQ ID N0:26 - PCR primer NIM 2B.
SEQ ID N0:27 - PCR primer NIM 2C.
SEQ ID N0:28 - PCR primer NIM 2D.
SEQ ID N0:29 - 659 by NIIV~Iike DNA fragment amplified from Nicotiana tabacum (Tobacco A), which is a consensus of 36 sequences and has 67% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.

SEQ ID N0:30 - Protein sequence encoded by SEQ ID N0:29.
SEQ ID N0:31 - 498 by NIM like DNA fragment amplified from Nicotiana tabacum (Tobacco B), which is a consensus of 2 sequences and has 62% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:32 - Protein sequence encoded by SEQ ID N0:31.
SEQ ID N0:33 - 498 by Nlll~like DNA fragment amplified from Nicotiana tabacum (Tobacco C), which is a consensus of 3 sequences and has 63% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:34 - Protein sequence encoded by SEQ ID N0:33.
SEQ ID N0:35 - 399 by Nlll~like DNA fragment amplified from Nicotiana tabacum (Tobacco D), which has 59% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:36 - Protein sequence encoded by SEQ ID N0:35.
SEQ ID N0:37 - 498 by Nlll~like DNA fragment amplified from Lycopersicon esculentum (Tomato A), which is a consensus of 8 sequences and has 67% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:38 - Protein sequence encoded by SEQ ID N0:37.
SEQ ID N0:39 - 498 by NIM like DNA fragment amplified from Beta vulgaris (Sugarbeet), which is a consensus of 24 sequences and has 66% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:40 - Protein sequence encoded by SEQ ID N0:39.
SEO ID N0:41 - 498 by NIM like DNA fragment amplified from Helianthus annuus (Sunflower A), which is a consensus of 9 sequences and has 61 % sequence identity to the Arabidopsis thaliana NIMi gene sequence.
SEQ ID N0:42 - Protein sequence encoded by SEQ ID N0:41.
SEQ ID N0:43 - 498 by NIM like DNA fragment amplified from Helianthus annuus (Sunflower B), which is a consensus of 10 sequences and has 59%
sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:44 - Protein sequence encoded by SEQ ID N0:43.
SEQ ID N0:45 - 653 by NIM like DNA fragment amplified from Solanum tuberosum (Potato A), which is a consensus of 15 sequences and has 68% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:46 - Protein sequence encoded by SEQ ID N0:45.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 SEQ ID N0:47 - 498 by Nlll~like DNA fragment amplified from Solanum tuberosum (Potato B), which is a consensus of 3 sequences and has 61 % sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:48 - Protein sequence encoded by SEQ ID N0:47.
SEQ ID N0:49 - 477 by Nlll~like DNA fragment amplified from Solanum tuberosum (Potato C), which is a consensus of 2 sequences and has 62% sequence identity to the Arabidopsis thaliana NIMi gene sequence.
SEQ ID N0:50 - Protein sequence encoded by SEQ ID N0:49.
SEQ ID N0:51 - 501 by Nlll~like DNA fragment amplified from Brassica napes (Canola A), which is a consensus of 5 sequences and has 59% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:52 - Protein sequence encoded by SEQ ID N0:51.
SEQ ID N0:53 - 501 by Nlll~like DNA fragment amplified from Brassica napes (Canola B), which is a consensus of 5 sequences and has 58% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:54 - Protein sequence encoded by SEQ ID N0:53.
SEQ ID N0:55 - 498 by NIM like DNA fragment amplified from Brassica napes (Canola C), which has 56% sequence identity to the Arabidopsis thaliana NIMi gene sequence.
SEQ ID N0:56 - Protein sequence encoded by SEQ ID N0:55.
SEQ ID N0:57 - 498 by NIM like DNA fragment amplified from Brassica napes (Canola D), which has 73% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:58 - Protein sequence encoded by SEQ ID N0:57.
SEQ ID N0:59 - PCR primer NIM 3A.
SEQ ID N0:60 - PCR primer NIM 3B.
SEQ ID N0:61 - 148 by NlM like DNA fragment amplified from Lycopersicon esculentum (Tomato B), which is a consensus of 3 sequences and has 72% sequence identity to the Arabidopsis thaliana NIM1 gene sequence.
SEQ ID N0:62 - Protein sequence encoded by SEQ ID N0:61.
SEQ ID N0:63 - Full length cDNA sequence of a NlM1 homologue from Beta vulgaris (Sugarbeet), which corresponds to the PCR fragment of SEQ ID N0:39.
SEQ ID N0:64 - Protein sequence of the sugarbeet NIM1 homologue encoded by SEQ
ID
N0:62.

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 SEQ ID N0:65 - Full length cDNA sequence of a NIM1 homologue from Heliauthus annuus (Sunflower B), which corresponds to the PCR fragment of SEQ ID N0:43.
SEQ ID N0:66 - Protein sequence of the Heliauthus annuus NIM1 homologue encoded by SEQ ID N0:65.
SEQ ID N0:67 - cDNA sequence corresponding to the Arabidopsis thaliana Nlll~like genomic sequence AtNMLc2 (SEQ ID N0:15).
SEQ ID N0:68 - Protein sequence encoded by SEQ ID N0:67.
SEQ ID N0:69 - cDNA sequence corresponding to the Arabidopsis thaliana Nlll~like genomic sequence AfNMLc4-1 (SEQ ID N0:17).
SEQ ID N0:70 - Protein sequence encoded by SEQ ID N0:69.
SEQ ID N0:71 - cDNA sequence corresponding to the Arabidopsis thaliana Nlll~like genomic sequence AfNMLc4-2 (SEQ ID N0:19).
SEQ ID N0:72 - Protein sequence encoded by SEQ ID N0:71.
SEQ ID N0:73 - Full length cDNA sequence of a NIM1 homologue from Nicotiana tabacum (Tobacco B), which corresponds to the PCR fragment of SEQ ID N0:31.
SEQ ID N0:74 - Protein sequence of the Nicotiana tabacum NIM1 homologue encoded by SEQ ID N0:73.
DEPOSITS
The following material has been deposited with the Agricultural Research Service, Patent Culture Collection (NRRL), 1815 North University Street, Peoria, Illinois 61604, USA, under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. All restrictions on the availability of the deposited material will be irrevocably removed upon the granting of a patent.
Clone Accession Number Date of Deposit pNOV1203 NRRL B-30049 August 17, pNOV1204 NRRL B-30050 August 17, pNOV1206 NRRL B-30051 August 17, AtNMLc5 NRRL B-30139 May 25, 1999 REFERENCES

WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 The references cited herein are indicative of the current state of the art.
Each of the following is incorporated by reference into the instant disclosure.
U.S. Patent No. 4,940,935 U.S. Patent No. 4,945,050 U.S. Patent No. 5,036,006 U.S. Patent No. 5,100,792 U.S. Patent No. 5,188,642 U.S. Patent No. 5,523,311 U.S. Patent No. 5,591,616 U.S. Patent No. 5,614,395 U.S. Patent No. 5,639,949 U.S. Patent No. 5,792,904 International PCT Application WO 93/07278 International PCT Application WO 93/21335 International PCT Application WO 94/00977 International PCT Application WO 94/13822 International PCT Application WO 94/16077 International PCT Application WO 97/49822 International PCT Application WO 98/06748 International PCT Application WO 98/26082 International PCT Application WO 98/29537 Alexander et al., Proc. Natl. Acad. Sci. USA 90: 7327-7331 (1993) Aoyama and Chua, The Plant Journal 11: 605-612 (1997) Ausubel, F.M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987) Bartlett et aL, In: Edelmann et al. (Eds.) Methods in Chloroplast Molecular Biology, Elsevier pp 1081-1091 (1982) Bevan et al., Nature 304:184-187 (1983) Bevan, Nucl. Acids Res. (1984) Bi et al., Plant J. 8: 235-245 (1995) Binet et al. Plant Science 79: 87-94 (1991 ) Blochinger & Diggelmann, Mol Cell. Biol. 4: 2929-2931 Bourouis et al., EMBO J. 2(7): 1099-1104 (1983) Boutry et al., Nature 328:340-342 (1987) Caddick et aL, Nat. Biotechnol 16:177-180 (1998) Callis et al., Genes Develop. 1: 1183-1200 (1987) Cameron et al., Plant J. 5: 715-725 (1994) Cao et al., Plant Cell 6, 1583-1592 (1994) Cao et al., Cell 88: 57-63 (1997) Casas et al., Proc. Natl. Acad. Sci. USA 90: 11212-11216 (1993) Century et al., Proc. NatL Acad. Sci. USA 92: 6597-6601 (1995) Chibbar et al., Plant Cell Rep. 12: 506-509 (1993) Chrispeels, Ann. Rev. Plant Physiol. Plant Mol. Biol. 42: 21-53 (1991 ) Christou et al., Plant Physiol. 87:671-674 (1988) Christou et aL, Biotechnology 9: 957-962 (1991 ) Christensen et al., Plant Molec. Biol. 12: 619-632 (1989) Comai et al., J. Biol. Chem. 263: 15104-15109 (1988) Crossway et al., BioTechniques 4:320-334 (1986) Datta et al., Biotechnology 8: 736-740 (1990) de Framond, FEBS 290: 103-106 (1991 ) Delaney et al., Science 266: 1247-1250 (1994) Delaney et al., Proc. Natl. Acad. ScL USA 92: 6602-6606 (1995) Dempsey and Klessig, Bulletin de L'Institut Pasteur 93: 167-186 (1995) Dietrich et al., Cell77: 565-577 (1994) Firek et al., Plant Molec. Biol. 22: 129-142 (1993) Fromm et al., Biotechnology 8: 833-839 (1990) Gaffney et al., Science 261: 754-756 (1993) Gallie et al., Nucl. Acids Res. 15: 8693-8711 (1987) Glazebrook et al., Genetics 143: 973-982 (1996) Gordon-Kamm et al., Plant Cell 2: 603-618 (1990) Gordon-Kamm et al, in 'Transgenic Plants", vol. 2., pp.21-33, pub. by Academic Press (1993) Gorlach et aL, Plant Cel18:629-643 (1996) Greenberg etal., Cell77: 551-563 (1994) Gritz et al., Gene 25: 179-188 (1983) Hayashimoto et al., Plant Physiol. 93: 857-863 (1990) Hill et al., Euphytica 85:119-123 (1995) Hinchee et al., Biotechnology 6:915-921 (1988) Hofgen & Willmitzer, Nucl. Acids Res. 16: 9877 (1988) Hudspeth & Grula, Plant Molec. Biol 12: 579-589 (1989) Hunt and Ryals, Crit. Rev, in Plant Sci. 15: 583-606 (1996) Innis et al., PCR Protocols, a Guide to Mefhods and Applications eds., Academic Press (1990) Ishida et al., Nature Biotechnology 14: 745-750 (1996) Jahne et al., Theor. Appl. Genet. 89: 525-533 (1994) Keegan et al., Science 231: 699-704 (1986) Keogh et al., Trans. Br. Mycol. Soc. 74: 329-333 (1980) Klein et al., Nature 327: 70-73 (1987) Klein et al., Proc. Natl. Acad. Sci. USA 85:4305-4309 (1988) Klein et al., BiolTechnology 6:559-563 (1988) Klein et al., Plant Physiol. 91:440-444 (1988) Koziel et al., Biotechnology 11: 194-200 (1993) Koziel et aL, Annals of the New York Academy of Sciences 792:164-171 (1996) Lawton et al., "The molecular biology of systemic aquired resistance" in Mechanisms of Defence Responses in Plants, B. Fritig and M. Legrand, eds (Dordrecht, The Netherlands: Kluwer Academic Publishers), pp. 422-432 (1993) Lawton et al., Plant J. 10: 71-82 (1996) Logemann et al., Plant Cell 1: 151-158 (1989) Maher et al., Proc. Natl. Acad. Sci. USA 91: 7802-7806 (1994) Mauch-Mani and Slusarenko, Mol. Plant-Microbe Interact. 7: 378-383 (1994) Mauch-Mani and Slusarenko, Plant CellB: 203-212 (1996) Mayo O., The Theory of Plant Breeding, Second Edition, Clarendon Press, Oxford (1987) Mazur et al., Plant Physiol. 85: 1110 (1987) WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 McBride et al., Plant Molecular Biology 14: 266-276 (1990) McCabe et al., Biotechnology 6:923-926 (1988) McElroy et aL, Plant Cell 2: 163-171 (1990) McElroy et al., Mol. Gen. Genet. 231: 150-160 (1991 ) Messing & Vierra, Gene 19: 259-268 (1982) Murashiga & Skoog, Physiologia Plantarum 15: 473-497 (1962) Nehra et aL, The Plant Journal5: 285-297 (1994) Neuhaus et al., Proc. Natl. Acad Sci. USA 88: 10362-10366 (1991 ) Norris et al., Plant Mol. Biol. 21: 895-906 (1993) Pallas et aL, Plant J. 10: 281-293 (1996) Parker et aL, Plant Cell 8: 2033-2046 (1996) Paszkowski et aL, EMBO J. 3: 2717-2722 (1984) Payne et aL, Plant MoL Biol. 11:89-94 (1988) Picard et al., Cell54: 1073-1080 (1988) Potrykus et al., Mol. Gen. Genet. 199: 169-177 (1985) Reich et al., Biotechnology 4: 1001-1004 (1986) Riggs et al, Proc. Natl. Acad. Sci. USA 83:5602-5606 (1986) Rogers et aL, Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985) Rohrmeier & Lehle, Plant Molec. Biol. 22: 783-792 (1993) Rothstein et al., Gene 53: 153-161 (1987) Ryals et al., Plant CellB: 1809-1819 (1996) Ryals et al., Plant Cell 9: 425-439 (1997) Sambrook et al., Molecular Cloning, eds., Cold Spring Harbor Laboratory Press (1989) Sanford et al., Particulate Science and Technology 5:27-37 (1987) Schmidhauser & Helinski, J. Bacteriol. 164: 446-455 (1985) Schocher et al., Biotechnology 4: 1093-1096 (1986) Shimamoto et al., Nature 338: 274-277 (1989) Shinshi et aL, Plant Molec. Biol. 14: 357-368 (1990) Shulaev ef al., Plant Cell7: 1691-1701 (1995) Silhavy, et al., Experiments with Gene Fusions, eds., Cold Spring Harbor Laboratory Press (1984) Singh, D.P., Breeding for Resistance to Diseases and Insect Pests, Springer-Verlag, NY
(1986) Skuzeski et aL, Plant Molec. Biol. 15: 65-79 (1990) Somers et al., BiolTechnology 10: 1589-1594 (1992) Spencer et al., Theor. Appl. Genet. 79: 625-631 (1990) Stanford et al., Mol. Gen. Genet. 215: 200-208 (1989) Svab et al., Proc. NatL Acad. Sci. USA 87:8526-8530 (1990) Taylor et al., Plant Cell Rep. 12: 491-495 (1993) Thompson et al. EMBO J. 6: 2519-2523 (1987) Torbert et aL, Plant Cell Reports 14: 635-640 (1995) Triezenberg et al., Genes Devel. 2: 718-729 (1988) Uknes et al., Plant Cell4: 645-656 (1992) Uknes et al. Plant Cell s: 159-169 (1993) Uknes et aG, Molecular Plant Microbe Interactions 6: 680-685 (1993) Uknes et al., Mol. Plant-Microbe Interact. 6: 692-698 (1993) Umbeck et al., BiolTechnology 5: 263-266 (1987) Unger et al., Plant Molec. BioL 13: 411-418 (1989) van den Broeck, et al., Nature 313: 358-363 (1985) Vasil et aL, Biotechnology 10: 667-674 (1992) Vasil et al., Biotechnology 11: 1553-1558 (1993) Vernooij et aL, Plant Cell 6: 959-965 (1994) Vernooij et aL, Mol. Plant-Microbe Interact. 8: 228-234 (1995) Von Heijne et al., Plant MoL Biol. Rep. 9:104-126 (1991 ) Vorst et al., Gene 65: 59 (1988) Wan et aL, Plant Physiol. 104: 37-48 (1994) Ward et al., Plant Cell 3: 1085-1094 (1991 ) Warner et al., Plant J. 3: 191-201 (1993) Wasmann et al., Mol. Gen. Genet. 205: 446-453 (1986) Weeks et al., Plant Physiol. 102: 1077-1084 (1993) Weissinger et al., Annual Rev. Genet. 22:421-477 (1988) Welsh J. R., Fundamentals of Plant Genetics and Breeding, John Wiley & Sons, NY (1981 ) Weymann et al., Plant Cell7: 2013-2022 (1995) White et al., Nucl. Acids Res. 18: 1062 (1990) Wood D. R. (Ed.) Crop Breeding, American Society of Agronomy Madison, Wisconsin (1983) Wricke and Weber, Quantitative Genetics and Selection Plant Breeding, Walter de Gruyter and Co., Berlin (1986) Xu et al., Plant Molec. Biol. 22: 573-588 (1993) Zhang et al., Plant Cell Rep. 7: 379-384 (1988) INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis) A. The indications made below relate to the deposited microorganism or other biological material referred to in the description on page 50 , line 19-31 B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Q

Name otdepositary institution Agricultural Research Service Culture Collection (NRRL) Address of dcpositary institution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America (USA) Date of deposit Accession Number 17 August 1998 (17.08.98) NRRL B-30049 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet We request the Expert Solution where available.

D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (ijthe indications are not for al! designated Slates) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to the International Bureau later (specijythegenerd nature ojthe iredicatiome.&, Ac~oession Number ojDepasit'~

For receiving Office use only For Jntanational Bureau use only This sheet was received with the international application Q This sheet was received by the International Bureau on:
Authorized officer ~ ~ Authorized offx~
E. S~ ':~~r Fon» PCT/R01134 (July 1998) - 57 -INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis) A. The indications made below relate to the deposited microorganism or other biological material rcferrcd to in the description on page 50 , line 19-31 B. IDENTIFICATION OF DEPOSIT Further deposits arc identified on an additional sheet D

Name of dcpositary institution Agricultural Research Service Culture Collection (NRRL) Address of dcpositary institution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America (USA) Date of deposit , Accession Number 17 August 1998 (17.08.98) NRRL B-30050 G ADDT1'IONAL INDICATIONS (leave blank if not applicoble) This infomration is continued on an additional sheet We request the Expert Solution where available.

D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (if the indications are not jor oll designated SIOIeS) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed bdow will be submitted to the lntemational Bureau later (speefythegeneral nonoie oJthe indieatioru eg., "Ac~acssiorr Number of Depasit~

For receiving Office use only For international Bureau use only ---~ This sheet was received with the international application Q This shelf was received by the lntanational Bureau on:

Authorized ofFtccr ~ ~ ~ Authorized officer c....;
~. ~.~c,Sc~.
Form PCT/ROlI3~ (~aty199a) INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 136is) A. The indications made below relate to the deposited microorganism or other biological material referred to in the description on page 50 , line 19-31 B. IDENTIFICATION OF DEPOSIT Further deposits are idrntified on an additional sheet Name of depositary institution Agricultural Research Service Culture Collection (NRRL) Address of depository itutitution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America (USA) Date of deposit Accession Number 17 August 1998 (17.08.98) NRRL B-30051 C. ADDITIONAL INDICATIONS (leave blank ijnot applicable) This information is continued on an additional sheet We request the Expert Solution where available.

D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (if the indications are not jor all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank ijnot applicable) The indications listed below will be submitted to the International Bureau later (spec~thegeneral nature oftlre indications eg. "Accurion Number ofDep~it'~

For receiving Office use only For International Bureau ux only ~ This sheet was received with the international application D This sheet was received by the International Bureau on:

Authorized officer 1 1 Authorized offrccr t. v~,lEiJ ~
Fornt PcrIROrI~~ ~mlylm> - 59 -INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule l3bis) A. The indications made below relate to the deposited microorganism or other biological material referred to in the description on page 50 , line 19-31 B. IDENTIFICATION OF DEPOSIT Further deposits are idrntified on an additional sheet Name of depository institution Agricultural Research Service Culture Collection (NRRLj Address of depository institution (including postal code and country) 1815 North University Street Peoria, Illinois 61604 United States of America (USA) Date of deposit Accession Number 25 May 1999 (25.05.99) NRRL B-30139 C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet We request the Expert Solution where available.

D. DESIGNATED STATES FOR WHICH INDICATIONS
ARE MADE (ijtfre indications are not jar all designated States) E. SEPARATE FURNISHING OF INDICATIONS
(leave blank if not applicable) The indications listed below will be submitted to the International Bureau later (spec~thegereer~al nature ojthe indicatiomeg., ~Ac~oessiat Number 9ft~

For receiving Office use only For International Bureau use only This sheet was received with the international application ~ This sheet was received by the International Bureau on:
0 .7 MAR 2000 Authorized officer Authorized oflica ~. spear ~~
Form PCf/ROr134 (luty1993) - 60 -WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 SEQUENCE LISTING
<110> Novartis AG
<120> NOVEL PLANT GENES AND USES THEREOF
<130> S-30857A/RTP2095 <140>
<141>
<160> 74 <170> PatentIn Ver. 2.1 <210>

<211>

<212>
DNA

<213> ianatabacum Nicot <220>

<221>
CDS

<222> (1764) (1)..

<223> length Full tobacco cDNA
sequence <400>

atg aatagt aggact gcgttttct gattcgaat gacatcagc gga 48 gat Met AsnSer ArgThr AlaPheSer AspSerAsn AspIleSer Gly Asp agc agtata tgctgc atcggcggc ggcatgact gaatttttc tcg 96 agt Ser SerIle CysCys IleGlyGly GlyMetThr GluPhePhe Ser Ser ccg acttcg ccggcg gagatcact tcactgaaa cgcctatcg gaa 144 gag Pro ThrSer ProAla GluIleThr SerLeuLys ArgLeuSer Glu Glu aca gaatct atcttc gatgcgtct ttgccggag tttgactac ttc 192 ctg Thr GluSer IlePhe AspAlaSer LeuProGlu PheAspTyr Phe Leu gcc getaag cttgtg gtttccggc ccgtgtaag gaaattccg gtg 240 gac Ala AlaLys LeuVal ValSerGly ProCysLys GluIlePro Val Asp cac tgcatt ttgtcg gcgaggagt ccgttcttt aagaatttg ttc 288 cgg His CysIle LeuSer AlaArgSer ProPhePhe LysAsnLeu Phe Arg tgc aaaaag gagaag aatagtagt aaggtggaa ttgaaggag gtg 336 ggt Cys LysLys GluLys AsnSerSer LysValGlu LeuLysGlu Val Gly atg gagcat gaggtg agctatgat getgtaatg agtgtattg get 384 aaa Met GluHis GluVal SerTyrAsp AlaValMet SerValLeu Ala Lys tat tatagt ggtaaa gttaggcct tcacctaaa gatgtgtgt gtt 432 ttg Tyr TyrSer GlyLys ValArgPro SerProLys AspValCys Val Leu W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tgtgtggac aatgac tgctctcatgtg gettgtagg ccagetgtg gca 480 CysValAsp AsnAsp CysSerHisVal AlaCysArg ProAlaVal Ala ttcctggtt gaggtt ttgtacacatca tttaccttt cagatctct gaa 528 PheLeuVal GluVal LeuTyrThrSer PheThrPhe GlnIleSer Glu ttggttgac aagttt cagagacaccta ctggatatt cttgacaaa act 576 LeuValAsp LysPhe GlnArgHisLeu LeuAspIle LeuAspLys Thr gcagcagac gatgta atgatggtttta tctgttgca aacatttgt ggt 624 AlaAlaAsp AspVal MetMetValLeu SerValAla AsnIleCys Gly aaagca tgcgagaga ttgctttca agctgcatt gagattatt gtcaag 672 LysAla CysGluArg LeuLeuSer SerCysIle GluIleIle ValLys tctaat gttgatatc ataaccctt gataaagcc ttgcctcat gacatt 720 SerAsn ValAspIle IleThrLeu AspLysAla LeuProHis AspIle gtaaaa caaattact gattcacga gcggaactt ggtctacaa gggcct 768 ValLys GlnIleThr AspSerArg AlaGluLeu GlyLeuGln GlyPro gaaagc aacggtttt cctgataaa catgttaag aggatacat agggca 816 GluSer AsnGlyPhe ProAspLys HisValLys ArgIleHis ArgAla ttggat tctgatgat gttgaatta ctacaaatg ttgctaaga gagggg 864 LeuAsp SerAspAsp ValGluLeu LeuGlnMet LeuLeuArg GluGly catact accctagat gatgcatat getctccat tatgetgta gcgtat 912 HisThr ThrLeuAsp AspAlaTyr AlaLeuHis TyrAlaVal AlaTyr tgcgat gcaaagact acagcagaa cttctagat cttgcactt getgat 960 CysAsp AlaLysThr ThrAlaGlu LeuLeuAsp LeuAlaLeu AlaAsp attaat catcaaaat tcaagggga tacacggtg ctgcatgtt gcagcc 1008 IleAsn HisGlnAsn SerArgGly TyrThrVal LeuHisVal AlaAla atgagg aaagagcct aaaattgta gtgtccctt ttaaccaaa ggaget 1056 MetArg LysGluPro LysIleVal ValSerLeu LeuThrLys GlyAla agacct tctgatctg acatccgat ggaagaaaa gcacttcaa atcgcc 1104 ArgPro SerAspLeu ThrSerAsp GlyArgLys AlaLeuGln IleAla aagagg ctcactagg cttgtggat ttcagtaag tctccggag gaagga 1152 LysArg LeuThrArg LeuValAsp PheSerLys SerProGlu GluGly WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 aaa tct get tcg aat gat cgg tta tgc att gag att ctg gag caa gca 1200 Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala gaa aga aga gac cct ctg cta gga gaa get tct gta tct ctt get atg 1248 Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Val Ser Leu Ala Met gca ggc gat gat ttg cgt atg aag ctg tta tac ctt gaa aat aga gtt 1296 Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val ggc ctg get aaa ctc ctt ttt cca atg gaa get aaa gtt gca atg gac 1344 Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp att get caa gtt gat ggc act tct gag ttc cca ctg get agc atc ggc 1392 Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Pro Leu Ala Ser Ile Gly aaa aag atg get aat gca cag agg aca aca gta gat ttg aac gag get 1440 Lys Lys Met Ala Asn Ala Gln Arg Thr Thr Val Asp Leu Asn Glu Ala cct ttc aag ata aaa gag gag cac ttg aat cgg ctt aga gca ctc tct 1488 Pro Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser aga act gta gaa ctt gga aaa cgc ttc ttt cca cgt tgt tca gaa gtt 1536 Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Glu Val cta aat aag atc atg gat get gat gac ttg tct gag ata get tac atg 1584 Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met ggg aat gat acg gca gaa gag cgt caa ctg aag aag caa agg tac atg 1632 Gly Asn Asp Thr Ala Glu Glu Arg Gln Leu Lys Lys Gln Arg Tyr Met gaa ctt caa gaa att ctg act aaa gca ttc act gag gat aaa gaa gaa 1680 Glu Leu Gln Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu tat gat aag act aac aac atc tcc tca tct tgt tcc tct aca tct aag 1728 Tyr Asp Lys Thr Asn Asn Ile Ser Ser Ser Cys Ser Ser Thr Ser Lys gga gta gat aag ccc aat aag ctc cct ttt agg aaa tag 1767 Gly Val Asp Lys Pro Asn Lys Leu Pro Phe Arg Lys <210> 2 <211> 588 <212> PRT
<213> Nicotiana tabacum <400> 2 Met Asp Asn Ser Arg Thr Ala Phe Ser Asp Ser Asn Asp Ile Ser Gly WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Ser Ser Ser Ile Cys Cys Ile Gly Gly Gly Met Thr Glu Phe Phe Ser Pro Glu Thr Ser Pro Ala Glu Ile Thr Ser Leu Lys Arg Leu Ser Glu Thr Leu Glu Ser Ile Phe Asp Ala Ser Leu Pro Glu Phe Asp Tyr Phe Ala Asp Ala Lys Leu Val Val Ser Gly Pro Cys Lys Glu Ile Pro Val His Arg Cys Ile Leu Ser Ala Arg Ser Pro Phe Phe Lys Asn Leu Phe Cys Gly Lys Lys Glu Lys Asn Ser Ser Lys Val Glu Leu Lys Glu Val Met Lys Glu His Glu Val Ser Tyr Asp Ala Val Met Ser Val Leu Ala Tyr Leu Tyr Ser Gly Lys Val Arg Pro Ser Pro Lys Asp Val Cys Val Cys Val Asp Asn Asp Cys Ser His Val Ala Cys Arg Pro Ala Val Ala Phe Leu Val Glu Val Leu Tyr Thr Ser Phe Thr Phe Gln Ile Ser Glu Leu Val Asp Lys Phe Gln Arg His Leu Leu Asp Ile Leu Asp Lys Thr Ala Ala Asp Asp Val Met Met Val Leu Ser Val Ala Asn Ile Cys Gly Lys Ala Cys Glu Arg Leu Leu Ser Ser Cys Ile Glu Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ala Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Gln Met Leu Leu Arg Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ala Leu Ala Asp Ile Asn His Gln Asn Ser Arg Gly Tyr Thr Val Leu His Val Ala Ala WO 00/53762 CA 02365968 2001-09-06 pCT~, P00/01978 Met Arg Lys Glu Pro Lys Ile Val Val Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Arg Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Ser Lys Ser Pro Glu Glu Gly Lys Ser Ala Ser Asn Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Val Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Pro Leu Ala Ser Ile Gly Lys Lys Met Ala Asn Ala Gln Arg Thr Thr Val Asp Leu Asn Glu Ala 465 . 470 475 480 Pro Phe Lys Ile Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Glu Val Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met Gly Asn Asp Thr Ala Glu Glu Arg Gln Leu Lys Lys Gln Arg Tyr Met Glu Leu Gln Glu Ile Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu Tyr Asp Lys Thr Asn Asn Ile Ser Ser Ser Cys Ser Ser Thr Ser Lys Gly Val Asp Lys Pro Asn Lys Leu Pro Phe Arg Lys <210> 3 <211> 1731 <212> DNA
<213> Lycopersicon esculentum <220>
<221> CDS
<222> (1)..(1728) <223> Full length tomato cDNA sequence <400> 3 WO CA pCT~P00/01978 atggatagt agaactget ttttcg gattccaat gatattagt ggaagc 48 MetAspSer ArgThrAla PheSer AspSerAsn AspIleSer GlySer agtagtata tgctgcatg aacgaa tcggaaact tcactggca gacgtc 96 SerSerIle CysCysMet AsnGlu SerGluThr SerLeuAla AspVal aattccctc aaacgtcta tcagaa acactagag tctatcttc gatgcg 144 AsnSerLeu LysArgLeu SerGlu ThrLeuGlu SerIlePhe AspAla tctgcgccg gatttcgac ttcttc getgatget aagcttctg getcca 192 SerAlaPro AspPheAsp PhePhe AlaAspAla LysLeuLeu AlaPro ggcggtaag gaaattccg gtgcat cggtgcatt ttgtcggcg aggagt 240 GlyGlyLys GluIlePro ValHis ArgCysIle LeuSerAla ArgSer ccttttttt aagaatgta ttctgt gggaaagat agcagcacg aagctg 288 ProPhePhe LysAsnVal PheCys GlyLysAsp SerSerThr LysLeu gaactcaaa gagctgatg aaagag tatgaggtg agttttgat gccgtg 336 GluLeuLys GluLeuMet LysGlu TyrGluVal SerPheAsp AlaVal gtcagtgtg ctcgcctat ttgtat agtggaaaa gttaggcct gcatct 384 ValSerVal LeuAlaTyr LeuTyr SerGlyLys ValArgPro AlaSer aaagatgtg tgtgtttgt gtggac aatgagtgc ttgcatgta gettgt 432 LysAspVal CysValCys ValAsp AsnGluCys LeuHisVal AlaCys aggccaget gtggccttc atggtt caggttttg tacgcatcc tttacc 480 ArgProAla ValAlaPhe MetVal GlnValLeu TyrAlaSer PheThr tttcagatc tctcaattg gtcgac aagtttcag agacaccta ttggat 528 PheGlnIle SerGlnLeu ValAsp LysPheGln ArgHisLeu LeuAsp attcttgac aaagetgta gcagat gatgtaatg atggtttta tccgtt 576 IleLeuAsp LysAlaVal AlaAsp AspValMet MetValLeu SerVal gcaaacatt tgcggtaaa gcatgt gaaagatta ctttcaaga tgcatt 624 AlaAsnIle CysGlyLys AlaCys GluArgLeu LeuSerArg CysIle gatattatt gtcaagtct aatgtt gatatcata acccttgat aagtcc 672 AspIleIle ValLysSer AsnVal AspIleIle ThrLeuAsp LysSer ttgcctcat gacattgta aaacaa atcactgat tcacgtget gaactt 720 LeuProHis AspIleVal LysGln IleThrAsp SerArgAla GluLeu ggtctgcaa gggcctgaa agcaat ggttttcct gataaacat gttaag 768 Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys agg ata cat aga gca ttg gac tct gat gat gtt gaa tta cta agg atg 816 Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met ttg ctt aaa gag ggg cat act act ctt gat gat gca tat get ctc cac 864 Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His tat get gta gca tat tgc gat gca aag act aca gca gaa ctt tta gat 912 Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp ctt tca ctt get gat gtt aat cat caa aat cct aga gga cac acg gta 960 Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val ctt cat gtt get gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt 1008 Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu tta acc aaa gga get aga cct tct gat ctg aca tcc gat ggc aaa aaa 1056 Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys gca ctt caa att get aag agg ctc act agg ctt gta gat ttt acc aag 1104 Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys tct aca gag gaa gga aaa tct get cca aag gat cgg tta tgc att gag 1152 Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu att ctg gag caa gca gaa aga aga gat cca cta cta gga gaa get tca 1200 Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser tta tct ctt get atg gca ggc gat gat ttg cgt atg aag ctg tta tac 1248 Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr ctt gaa aat aga gtt ggt ctg get aaa ctc ctt ttt ccc atg gaa gca 1296 Leu Glu Asn Arg Val Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala aaa gtt gca atg gac att gca caa gtt gat ggc acg tct gaa tta ccc 1344 Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Leu Pro ctg get agc atg agg aag aag ata get gat gca cag agg aca aca gtg 1392 Leu Ala Ser Met Arg Lys Lys Ile Ala Asp Ala Gln Arg Thr Thr Val gat ttg aac gag get cct ttc aag atg aaa gag gag cac ttg aat cgg 1440 Asp Leu Asn Glu Ala Pro Phe Lys Met Lys Glu Glu His Leu Asn Arg ctt agg get ctc tct aga act gtg gaa ctt gga aaa cgg ttc ttt cca 1488 Leu Arg Ala Leu Ser Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro _7_ WO UO/53762 CA 02365968 2001-09-06 pCT/EP~~/01978 cgttgt tcagaagtt ctaaataag atcatg gatgetgat gacttgtct 1536 ArgCys SerGluVal LeuAsnLys IleMet AspAlaAsp AspLeuSer gagata gettacatg gggaatgat acagta gaagagcgt caactgaag 1584 GluIle AlaTyrMet GlyAsnAsp ThrVal GluGluArg GlnLeuLys aagcaa aggtacatg gaacttcaa gaaatt ttgtctaaa gcattcacg 1632 LysGln ArgTyrMet GluLeuGln GluIle LeuSerLys AlaPheThr gaggat aaagaagaa tttgetaag actaac atgtcctca tcttgttcc 1680 GluAsp LysGluGlu PheAlaLys ThrAsn MetSerSer SerCysSer tctaca tctaaggga gtagataag cccaat aatctccca tttaggaaa 1728 SerThr SerLysGly ValAspLys ProAsn AsnLeuPro PheArgLys tag 1731 <210> 4 <211> 576 <212> PRT
<213> Lycopersicon esculentum <400> 4 Met Asp Ser Arg Thr Ala Phe Ser Asp Ser Asn Asp Ile Ser Gly Ser Ser Ser Ile Cys Cys Met Asn Glu Ser Glu Thr Ser Leu Ala Asp Val Asn Ser Leu Lys Arg Leu Ser Glu Thr Leu Glu Ser Ile Phe Asp Ala Ser Ala Pro Asp Phe Asp Phe Phe Ala Asp Ala Lys Leu Leu Ala Pro Gly Gly Lys Glu Ile Pro Val His Arg Cys Ile Leu Ser Ala Arg Ser Pro Phe Phe Lys Asn Val Phe Cys Gly Lys Asp Ser Ser Thr Lys Leu Glu Leu Lys Glu Leu Met Lys Glu Tyr Glu Val Ser Phe Asp Ala Val Val Ser Val Leu Ala Tyr Leu Tyr Ser Gly Lys Val Arg Pro Ala Ser Lys Asp Val Cys Val Cys Val Asp Asn Glu Cys Leu His Val Ala Cys Arg Pro Ala Val Ala Phe Met Val Gln Val Leu Tyr Ala Ser Phe Thr _g_ WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Phe Gln Ile Ser Gln Leu Val Asp Lys Phe Gln Arg His Leu Leu Asp Ile Leu Asp Lys Ala Val Ala Asp Asp Val Met Met Val Leu Ser Val Ala Asn Ile Cys Gly Lys Ala Cys Glu Arg Leu Leu Ser Arg Cys Ile Asp Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ser Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Leu Pro Leu Ala Ser Met Arg Lys Lys Ile Ala Asp Ala Gln Arg Thr Thr Val Asp Leu Asn Glu Ala Pro Phe Lys Met Lys Glu Glu His Leu Asn Arg Leu Arg Ala Leu Ser Arg Thr Val Glu Leu Gly Lys Arg Phe Phe Pro _g_ WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Arg Cys Ser Glu Val Leu Asn Lys Ile Met Asp Ala Asp Asp Leu Ser Glu Ile Ala Tyr Met Gly Asn Asp Thr Val Glu Glu Arg Gln Leu Lys Lys Gln Arg Tyr Met Glu Leu Gln Glu Ile Leu Ser Lys Ala Phe Thr Glu Asp Lys Glu Glu Phe Ala Lys Thr Asn Met Ser Ser Ser Cys Ser Ser Thr Ser Lys Gly Val Asp Lys Pro Asn Asn Leu Pro Phe Arg Lys <210>

<211>

<212>
DNA

<213>
Brassica napus <220>

<221>
CDS

<222> (1737) (1)..

<223>
Canola cDNA
sequence <400>

atg accattget rgatttgat gatttc tatgagatcagc agcact 48 gag Met ThrIleAla XaaPheAsp AspPhe TyrGluIleSer SerThr Glu agc cycgccgca ccggcgcca accgat aactccggatca tccacc 96 ttc Ser XaaAlaAla ProAlaPro ThrAsp AsnSerGlySer SerThr Phe gtc ccgacggag cttytcacc agaccc gaggtatccgcg tttcaa 144 twc Val ProThrGlu LeuXaaThr ArgPro GluValSerAla PheGln Xaa ctc tccaacagc ctcgagtcc gtcttc gactcgccggaa gcgttc 192 ctc Leu SerAsnSer LeuGluSer ValPhe AspSerProGlu AlaPhe Leu tac gacgccaag cttgttctc tccgac gacaaggaagta tccttc 240 agc Tyr AspAlaLys LeuValLeu SerAsp AspLysGluVal SerPhe Ser cac tgcattctc tcggcgaga agcctc ttcttcaaggcc getttg 288 cgt His CysIleLeu SerAlaArg SerLeu PhePheLysAla AlaLeu Arg rca gccgagaag gtgcagaag tccacc cccgtgaagctc gagctg 336 gcc Xaa AlaGluLys ValGlnLys SerThr ProValLysLeu GluLeu Ala aag ctcgcggcg gaatacgac gtcggg ttcgattctgtg gtgget 384 aca Lys LeuAlaAla GluTyrAsp ValGly PheAspSerVal ValAla Thr gttctggcg tacgtttac agcggcaga gtgaggccg cctccgaag gga 432 ValLeuAla TyrValTyr SerGlyArg ValArgPro ProProLys Gly gtttctgaa tgcgcagac gakagctgc tgccacgtg gcgtgccgt ccg 480 ValSerGlu CysAlaAsp XaaSerCys CysHisVal AlaCysArg Pro getgtggat ttcatggtg gaggttctc tacttgget ttcgtcttc cag 528 AlaValAsp PheMetVal GluValLeu TyrLeuAla PheValPhe Gln attcaggaa ctggttacc atgtatcag aggcattta ctggatgtt gta 576 IleGlnGlu LeuValThr MetTyrGln ArgHisLeu LeuAspVal Val gacaaagtt awcatagaa gacactttg gtcgtcctc aagcttget aac 624 AspLysVal XaaIleGlu AspThrLeu ValValLeu LysLeuAla Asn atctgcggt aaagcgtgc aagaagcta ttcgataag tgcagagag atc 672 IleCysGly LysAlaCys LysLysLeu PheAspLys CysArgGlu Ile attgtcaag tctaacgtg gatgttgtt actctaaag aagtcattg cct 720 IleValLys SerAsnVal AspValVal ThrLeuLys LysSerLeu Pro gagracatt gccaagcaa gtaatcgat atccgcaaa gagctcggc ttg 768 GluXaaIle AlaLysGln ValIleAsp IleArgLys GluLeuGly Leu gaggtaget gaaccagag aaacatgtc tccaacata cacaaggcg ctt 816 GluValAla GluProGlu LysHisVal SerAsnIle HisLysAla Leu gagtcagac gatcttgac cttgtcgtt atgcttttg aaagagggc cac 864 GluSerAsp AspLeuAsp LeuValVal MetLeuLeu LysGluGly His acgaatcta gacgaagcg tatgetctc cattttget gttgcgtat tgc 912 ThrAsnLeu AspGluAla TyrAlaLeu HisPheAla ValAlaTyr Cys gatgagaag acagcgagg aatctcctg gaactgggg tttgcggat gtc 960 AspGluLys ThrAlaArg AsnLeuLeu GluLeuGly PheAlaAsp Val aaccggaga aacccgaga gggtacacg gtaattcac gtcgetgcg atg 1008 AsnArgArg AsnProArg GlyTyrThr ValIleHis ValAlaAla Met aggaaagag ccgacactg atagcattg ttgttgacg aaagggget aat 1056 ArgLysGlu ProThrLeu IleAlaLeu LeuLeuThr LysGlyAla Asn gcattagaa atgtctttg gacgggaga actgetctg ttgatcgcg aaa 1104 AlaLeuGlu MetSerLeu AspGlyArg ThrAlaLeu LeuIleAla Lys WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 caagtc actaaggcg gccgagtgt tgtattctg gagaaaggg aagtta 1152 GlnVal ThrLysAla AlaGluCys CysIleLeu GluLysGly LysLeu getgcc aaaggcgga gtatgtgta gagatactc aagcaacca gacaac 1200 AlaAla LysGlyGly ValCysVal GluIleLeu LysGlnPro AspAsn acacga gaaccattt cctgaagat gtttctccc tcccttgca gtgget 1248 ThrArg GluProPhe ProGluAsp ValSerPro SerLeuAla ValAla getgat caattcaag ataaggttg attgatctt gaaaacaga gttcaa 1296 AlaAsp GlnPheLys IleArgLeu IleAspLeu GluAsnArg ValGln atgget cgatgtctc tatccaatg gaagcacaa gttgcaatg gatttc 1344 MetAla ArgCysLeu TyrProMet GluAlaGln ValAlaMet AspPhe gcccga atgaaggga acacgcgag tttgtcgtg acgacagca actgac 1392 AlaArg MetLysGly ThrArgGlu PheValVal ThrThrAla ThrAsp ctacac atggaacct ttcaagttc gtagaaatg catcagagt agacta 1440 LeuHis MetGluPro PheLysPhe ValGluMet HisGlnSer ArgLeu acagcg ctttctaaa actgtggaa ttcgggaaa cgcttcttc ccacgc 1488 ThrAla LeuSerLys ThrValGlu PheGlyLys ArgPhePhe ProArg tgttcg aaagtgctc gatgatatt gtggactct gaggacttg actata 1536 CysSer LysValLeu AspAspIle ValAspSer GluAspLeu ThrIle ctgget ctcgtagaa gaagacact cctgagcaa cgacaacaa aagagg 1584 LeuAla LeuValGlu GluAspThr ProGluGln ArgGlnGln LysArg cagagg ttcatggaa atacaggag attgttcaa atggcgttt agtaaa 1632 GlnArg PheMetGlu IleGlnGlu IleValGln MetAlaPhe SerLys gacaag gaggatctt ggaaagtcg tctctctca gettcgtct tcttcc 1680 AspLys GluAspLeu GlyLysSer SerLeuSer AlaSerSer SerSer acatcc aaattaact ggtaaaaag aggtctatt getaaaccc tctcac 1728 ThrSer LysLeuThr GlyLysLys ArgSerIle AlaLysPro SerHis cggcgt cggtga 1740 ArgArg Arg <210>

<211>

<212>
PRT

<213>
Brassica napus <400> 6 Met Glu Thr Ile Ala Xaa Phe Asp Asp Phe Tyr Glu Ile Ser Ser Thr Ser Phe Xaa Ala Ala Pro Ala Pro Thr Asp Asn Ser Gly Ser Ser Thr Val Xaa Pro Thr Glu Leu Xaa Thr Arg Pro Glu Val Ser Ala Phe Gln Leu Leu Ser Asn Ser Leu Glu Ser Val Phe Asp Ser Pro Glu Ala Phe Tyr Ser Asp Ala Lys Leu Val Leu Ser Asp Asp Lys Glu Val Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ser Leu Phe Phe Lys Ala Ala Leu Xaa Ala Ala Glu Lys Val Gln Lys Ser Thr Pro Val Lys Leu Glu Leu Lys Thr Leu Ala Ala Glu Tyr Asp Val Gly Phe Asp Ser Val Val Ala Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Pro Pro Pro Lys Gly Val Ser Glu Cys Ala Asp Xaa Ser Cys Cys His Val Ala Cys Arg Pro Ala Val Asp Phe Met Val Glu Val Leu Tyr Leu Ala Phe Val Phe Gln Ile Gln Glu Leu Val Thr Met Tyr Gln Arg His Leu Leu Asp Val Val Asp Lys Val Xaa Ile Glu Asp Thr Leu Val Val Leu Lys Leu Ala Asn Ile Cys Gly Lys Ala Cys Lys Lys Leu Phe Asp Lys Cys Arg Glu Ile Ile Val Lys Ser Asn Val Asp Val Val Thr Leu Lys Lys Ser Leu Pro Glu Xaa Ile Ala Lys Gln Val Ile Asp Ile Arg Lys Glu Leu Gly Leu Glu Val Ala Glu Pro Glu Lys His Val Ser Asn Ile His Lys Ala Leu Glu Ser Asp Asp Leu Asp Leu Val Val Met Leu Leu Lys Glu Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Val Ala Tyr Cys Asp Glu Lys Thr Ala Arg Asn Leu Leu Glu Leu Gly Phe Ala Asp Val WO 00/53762 CA 02365968 2001-09-06 pC'T/EP00/01978 Asn Arg Arg Asn Pro Arg Gly Tyr Thr Val Ile His Val Ala Ala Met Arg Lys Glu Pro Thr Leu Ile Ala Leu Leu Leu Thr Lys Gly Ala Asn Ala Leu Glu Met Ser Leu Asp Gly Arg Thr Ala Leu Leu Ile Ala Lys Gln Val Thr Lys Ala Ala Glu Cys Cys Ile Leu Glu Lys Gly Lys Leu Ala Ala Lys Gly Gly Val Cys Val Glu Ile Leu Lys Gln Pro Asp Asn Thr Arg Glu Pro Phe Pro Glu Asp Val Ser Pro Ser Leu Ala Val Ala Ala Asp Gln Phe Lys Ile Arg Leu Ile Asp Leu Glu Asn Arg Val Gln Met Ala Arg Cys Leu Tyr Pro Met Glu Ala Gln Val Ala Met Asp Phe Ala Arg Met Lys Gly Thr Arg Glu Phe Val Val Thr Thr Ala Thr Asp Leu His Met Glu Pro Phe Lys Phe Val Glu Met His Gln Ser Arg Leu Thr Ala Leu Ser Lys Thr Val Glu Phe Gly Lys Arg Phe Phe Pro Arg Cys Ser Lys Val Leu Asp Asp Ile Val Asp Ser Glu Asp Leu Thr Ile Leu Ala Leu Val Glu Glu Asp Thr Pro Glu Gln Arg Gln Gln Lys Arg Gln Arg Phe Met Glu Ile Gln Glu Ile Val Gln Met Ala Phe Ser Lys Asp Lys Glu Asp Leu Gly Lys Ser Ser Leu Ser Ala Ser Ser Ser Ser Thr Ser Lys Leu Thr Gly Lys Lys Arg Ser Ile Ala Lys Pro Ser His Arg Arg Arg <210> 7 <211> 1761 <212> DNA
<213> Arabidopsis thaliana <220>
<221> CDS
<222> (1)..(1758) WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 <223> AtNMLc5 cDNA sequence <400>

atggetactttg actgagcca tcatcatct ttgagtttc acatcttct 48 MetAlaThrLeu ThrGluPro SerSerSer LeuSerPhe ThrSerSer catttctcttat ggttctatt gggtccaat cacttctca tcaagctca 96 HisPheSerTyr GlySerIle GlySerAsn HisPheSer SerSerSer gettctaatcct gaagttgtt agtctaacc aaactcagc tccaatctt 144 AlaSerAsnPro GluValVal SerLeuThr LysLeuSer SerAsnLeu gagcagcttctt agtaattca gattgtgat tacagtgat gcagagatc 192 GluGlnLeuLeu SerAsnSer AspCysAsp TyrSerAsp AlaGluIle attgttgatggt gttccagtt ggtgttcat agatgcatt ttagetgca 240 IleValAspGly ValProVal GlyValHis ArgCysIle LeuAlaAla agaagtaagttt ttccaagat ttgtttaag aaagaaaag aaaatttcg 288 ArgSerLysPhe PheGlnAsp LeuPheLys LysGluLys LysIleSer aaaactgagaaa ccaaagtat cagttgaga gagatgtta ccttatgga 336 LysThrGluLys ProLysTyr GlnLeuArg GluMetLeu ProTyrGly getgttgetcat gaagetttc ttgtatttc ttgagttat atatatact 384 AlaValAlaHis GluAlaPhe LeuTyrPhe LeuSerTyr IleTyrThr gggagattaaag ccttttcca ttggaggtt tcgacttgt gttgatcca 432 GlyArgLeuLys ProPhePro LeuGluVal SerThrCys ValAspPro gtttgttctcat gattgttgt cgacctgcc attgatttt gttgttcaa 480 ValCysSerHis AspCysCys ArgProAla IleAspPhe ValValGln ttgatgtatget tcctctgtt ctccaagtg cctgagcta gtttcatct 528 LeuMetTyrAla SerSerVal LeuGlnVal ProGluLeu ValSerSer tttcagcggcgg ctttgtaac tttgtggag aagaccctt gttgagaat 576 PheGlnArgArg LeuCysAsn PheValGlu LysThrLeu ValGluAsn gttcttcccatt cttatggtt getttcaat tgtaagttg actcagctt 624 ValLeuProIle LeuMetVal AlaPheAsn CysLysLeu ThrGlnLeu cttgatcagtgt attgagaga gtggcgagg tcagatctt tacaggttc 672 LeuAspGlnCys IleGluArg ValAlaArg SerAspLeu TyrArgPhe tgtattgaaaag gaagttcct cccgaagta gcagagaag attaaacag 720 CysIleGluLys GluValPro ProGluVal AlaGluLys IleLysGln WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 cttcgacttata tccccgcaa gacgaagaa accagtccc aagatttcg 768 LeuArgLeuIle SerProGln AspGluGlu ThrSerPro LysIleSer gagaaattgctt gaaagaatc ggtaaaatt ctcaaggcc ttggattca 816 GluLysLeuLeu GluArgIle GlyLysIle LeuLysAla LeuAspSer gatgatgttgag cttgtgaag cttcttttg actgagtca gatatcact 864 AspAspValGlu LeuValLys LeuLeuLeu ThrGluSer AspIleThr ctagatcaagcc aatggtctg cattattct gttgtgtat agtgatccg 912 LeuAspGlnAla AsnGlyLeu HisTyrSer ValValTyr SerAspPro aaagttgttgcc gagattctt getctggat atgggtgat gtgaactac 960 LysValValAla GluIleLeu AlaLeuAsp MetGlyAsp ValAsnTyr aggaattcccgg ggttacacg gttcttcat tttgetgcg atgcgtaga 1008 ArgAsnSerArg GlyTyrThr ValLeuHis PheAlaAla MetArgArg gagccatcgatc attatatcg cttatcgat aaaggcgcc aatgcatct 1056 GluProSerIle IleIleSer LeuIleAsp LysGlyAla AsnAlaSer gagtttacatct gacggacgc agcgcagtt aatatattg agaagactg 1104 GluPheThrSer AspGlyArg SerAlaVal AsnIleLeu ArgArgLeu acaaatccaaag gattatcat accaaaaca gcaaaaggg cgtgaatct 1152 ThrAsnProLys AspTyrHis ThrLysThr AlaLysGly ArgGluSer agtaaggccagg ctatgcatc gatatattg gaaagagaa atcaggaag 1200 SerLysAlaArg LeuCysIle AspIleLeu GluArgGlu IleArgLys aaccccatggtt ctagataca ccaatgtgt tccatttct atgcctgaa 1248 AsnProMetVal LeuAspThr ProMetCys SerIleSer MetProGlu gatctccagatg agactgttg tacctagaa aagagagtg ggtcttget 1296 AspLeuGlnMet ArgLeuLeu TyrLeuGlu LysArgVal GlyLeuAla cagttgttcttt ccaacggaa getaaagtg getatggac attggtaac 1344 GlnLeuPhePhe ProThrGlu AlaLysVal AlaMetAsp IleGlyAsn gtagaaggtaca agtgagttc acagggttg tcacctcct tcaagtggg 1392 ValGluGlyThr SerGluPhe ThrGlyLeu SerProPro SerSerGly ttaaccggaaac ttgagtcag gttgattta aacgaaact cctcatatg 1440 LeuThrGlyAsn LeuSerGln ValAspLeu AsnGluThr ProHisMet WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 caaacccaaaga cttcttact cgtatg gtggetcta atgaaaaca gtt 1488 GlnThrGlnArg LeuLeuThr ArgMet ValAlaLeu MetLysThr Val gagactggtcga aggtttttt ccatat ggttcagag gttctagat aag 1536 GluThrGlyArg ArgPhePhe ProTyr GlySerGlu ValLeuAsp Lys tacatggetgag tatatagac gacgac atcctcgac gatttccat ttt 1584 TyrMetAlaGlu TyrIleAsp AspAsp IleLeuAsp AspPheHis Phe gagaagggatct acacatgaa agaaga ttgaaaaga atgagatat aga 1632 GluLysGlySer ThrHisGlu ArgArg LeuLysArg MetArgTyr Arg gagcttaaggat gatgtccaa aaggca tatagcaaa gacaaagag tct 1680 GluLeuLysAsp AspValGln LysAla TyrSerLys AspLysGlu Ser aagattgcgcgg tcttgtctt tctget tcatcttct ccttcttct tct 1728 LysIleAlaArg SerCysLeu SerAla SerSerSer ProSerSer Ser tccataagagat gatctgcac aacaca acatga 1761 SerIleArgAsp AspLeuHis AsnThr Thr <210> 8 <211> 586 <212> PRT
<213> Arabidopsis thaliana <400> 8 Met Ala Thr Leu Thr Glu Pro Ser Ser Ser Leu Ser Phe Thr Ser Ser His Phe Ser Tyr Gly Ser Ile Gly Ser Asn His Phe Ser Ser Ser Ser Ala Ser Asn Pro Glu Val Val Ser Leu Thr Lys Leu Ser Ser Asn Leu Glu Gln Leu Leu Ser Asn Ser Asp Cys Asp Tyr Ser Asp Ala Glu Ile Ile Val Asp Gly Val Pro Val Gly Val His Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gln Asp Leu Phe Lys Lys Glu Lys Lys Ile Ser Lys Thr Glu Lys Pro Lys Tyr Gln Leu Arg Glu Met Leu Pro Tyr Gly Ala Val Ala His Glu Ala Phe Leu Tyr Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys Pro Phe Pro Leu Glu Val Ser Thr Cys Val Asp Pro WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Val Cys Ser His Asp Cys Cys Arg Pro Ala Ile Asp Phe Val Val Gln Leu Met Tyr Ala Ser Ser Val Leu Gln Val Pro Glu Leu Val Ser Ser Phe Gln Arg Arg Leu Cys Asn Phe Val Glu Lys Thr Leu Val Glu Asn Val Leu Pro Ile Leu Met Val Ala Phe Asn Cys Lys Leu Thr Gln Leu Leu Asp Gln Cys Ile Glu Arg Val Ala Arg Ser Asp Leu Tyr Arg Phe Cys Ile Glu Lys Glu Val Pro Pro Glu Val Ala Glu Lys Ile Lys Gln Leu Arg Leu Ile Ser Pro Gln Asp Glu Glu Thr Ser Pro Lys Ile Ser Glu Lys Leu Leu Glu Arg Ile Gly Lys Ile Leu Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Gln Ala Asn Gly Leu His Tyr Ser Val Val Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Ala Leu Asp Met Gly Asp Val Asn Tyr Arg Asn Ser Arg Gly Tyr Thr Val Leu His Phe Ala Ala Met Arg Arg Glu Pro Ser Ile Ile Ile Ser Leu Ile Asp Lys Gly Ala Asn Ala Ser Glu Phe Thr Ser Asp Gly Arg Ser Ala Val Asn Ile Leu Arg Arg Leu Thr Asn Pro Lys Asp Tyr His Thr Lys Thr Ala Lys Gly Arg Glu Ser Ser Lys Ala Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Lys Asn Pro Met Val Leu Asp Thr Pro Met Cys Ser Ile Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Lys Arg Val Gly Leu Ala Gln Leu Phe Phe Pro Thr Glu Ala Lys Val Ala Met Asp Ile Gly Asn Val Glu Gly Thr Ser Glu Phe Thr Gly Leu Ser Pro Pro Ser Ser Gly _18_ WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Leu Thr Gly Asn Leu Ser Gln Val Asp Leu Asn Glu Thr Pro His Met Gln Thr Gln Arg Leu Leu Thr Arg Met Val Ala Leu Met Lys Thr Val Glu Thr Gly Arg Arg Phe Phe Pro Tyr Gly Ser Glu Val Leu Asp Lys Tyr Met Ala Glu Tyr Ile Asp Asp Asp Ile Leu Asp Asp Phe His Phe Glu Lys Gly Ser Thr His Glu Arg Arg Leu Lys Arg Met Arg Tyr Arg Glu Leu Lys Asp Asp Val Gln Lys Ala Tyr Ser Lys Asp Lys Glu Ser Lys Ile Ala Arg Ser Cys Leu Ser Ala Ser Ser Ser Pro Ser Ser Ser Ser Ile Arg Asp Asp Leu His Asn Thr Thr <210> 9 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 9 agattattgt caagtctaat g 21 <210> 10 <211> 19 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 10 ttccatgtac ctttgcttc 19 <210> 11 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 11 gcggatccat ggataatagt agg 23 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <210> 12 <211> 23 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 12 gcggatccta tttcctaaaa ggg 23 <210> 13 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 13 tcaaggcctt ggattcagat g 21 <210> 14 <211> 21 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR Primer <400> 14 attaactgcg ctacgtccgt c 21 <210> 15 <211> 1477 <212> DNA
<213> Arabidopsis thaliana <220>
<221> CDS
<222> (1)..(1476) <223> AtNMLc2 genomic sequence <400> 15 atg agc aat ctt gaa gaa tct ttg aga tct cta tcg ttg gat ttc ctg 48 Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu aac cta cta atc aac ggt caa get ttc tcc gac gtg act ttc agc gtt 96 Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val gaa ggt cgt tta gtc cac get cac cgt tgt atc ctc gcc gca cgg agt 144 Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 cttttcttccgc aaattcttt tgtgggaca gactcacca caacctgtc 192 LeuPhePheArg LysPhePhe CysGlyThr AspSerPro GlnProVal acaggtatagac ccgacccaa catgggtcc gtacccget agcccaaca 240 ThrGlyIleAsp ProThrGln HisGlySer ValProAla SerProThr agaggctccacg gccccaget ggaattata ccagtgaac tcagtcggt 288 ArgGlySerThr AlaProAla GlyIleIle ProValAsn SerValGly tatgaggttttt ctgttgcta cttcagttt ctttatagc ggacaagtc 336 TyrGluValPhe LeuLeuLeu LeuGlnPhe LeuTyrSer GlyGlnVal tccatcgtgccg cagaaacac gagcctaga cctaattgt ggcgagaga 384 SerIleValPro GlnLysHis GluProArg ProAsnCys GlyGluArg ggatgttggcac actcattgc tcagccgcc gttgatctt getcttgat 432 GlyCysTrpHis ThrHisCys SerAlaAla ValAspLeu AlaLeuAsp actctcgccgcc tctcgttac ttcggcgtc gagcagctc gcattgctc 480 ThrLeuAlaAla SerArgTyr PheGlyVal GluGlnLeu AlaLeuLeu acccagaaacaa ttggcaagc atggtggag aaagcctct atcgaagat 528 ThrGlnLysGln LeuAlaSer MetValGlu LysAlaSer IleGluAsp gtgatgaaagtt ttaatagca tcaagaaag caagacatg catcaatta 576 ValMetLysVal LeuIleAla SerArgLys GlnAspMet HisGlnLeu tggaccacctgc tctcactta gttatgagc aatcttgaa gaatctttg 624 TrpThrThrCys SerHisLeu ValMetSer AsnLeuGlu GluSerLeu agatctctatcg ttggatttc ctgaaccta ctaatcaac ggtcaaget 672 ArgSerLeuSer LeuAspPhe LeuAsnLeu LeuIleAsn GlyGlnAla ttctccgacgtg actttcagc gttgaaggt cgtttagtc cacgetcac 720 PheSerAspVal ThrPheSer ValGluGly ArgLeuVal HisAlaHis cgttgtatcctc gccgcacgg agtcttttc ttccgcaaa ttcttttgt 768 ArgCysIleLeu AlaAlaArg SerLeuPhe PheArgLys PhePheCys gggacagactca ccacaacct gtcacaggt atagacccg acccaacat 816 GlyThrAspSer ProGlnPro ValThrGly IleAspPro ThrGlnHis gggtccgtaccc getagccca acaagaggc tccacggcc ccagetgga 864 GlySerValPro AlaSerPro ThrArgGly SerThrAla ProAlaGly att ata cca gtg aac tca gtc ggt tat gag gtt ttt ctg ttg cta ctt 912 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 IleIleProVal AsnSerVal GlyTyrGlu ValPhe LeuLeuLeu Leu cagtttctttat agcggacaa gtctccatc gtgccg cagaaacac gag 960 GlnPheLeuTyr SerGlyGln ValSerIle ValPro GlnLysHis Glu cctagacctaat tgtggcgag agaggatgt tggcac actcattgc tca 1008 ProArgProAsn CysGlyGlu ArgGlyCys TrpHis ThrHisCys Ser gccgccgttgat cttgetctt gatactctc gccgcc tctcgttac ttc 1056 AlaAlaValAsp LeuAlaLeu AspThrLeu AlaAla SerArgTyr Phe ggcgtcgagcag ctcgcattg ctcacccag aaacaa ttggcaagc atg 1104 GlyValGluGln LeuAlaLeu LeuThrGln LysGln LeuAlaSer Met gtggagaaagcc tctatcgaa gatgtgatg aaagtt ttaatagca tca 1152 ValGluLysAla SerIleGlu AspValMet LysVal LeuIleAla Ser agaaagcaagac atgcatcaa ttatggacc acctgc tctcactta gtt 1200 ArgLysGlnAsp MetHisGln LeuTrpThr ThrCys SerHisLeu Val atgagcaatctt gaagaatct ttgagatct ctatcg ttggatttc ctg 1248 MetSerAsnLeu GluGluSer LeuArgSer LeuSer LeuAspPhe Leu aacctactaatc aacggtcaa getttctcc gacgtg actttcagc gtt 1296 AsnLeuLeuIle AsnGlyGln AlaPheSer AspVal ThrPheSer Val gaaggtcgttta gtccacget caccgttgt atcctc gccgcacgg agt 1344 GluGlyArgLeu ValHisAla HisArgCys IleLeu AlaAlaArg Ser cttttcttccgc aaattcttt tgtgggaca gactca ccacaacct gtc 1392 LeuPhePheArg LysPhePhe CysGlyThr AspSer ProGlnPro Val acaggtatagac ccgacccaa catgggtcc gtaccc getagccca aca 1440 ThrGlyIleAsp ProThrGln HisGlySer ValPro AlaSerPro Thr agaggctccacg gccccaget ggaattata ccagtg a 1477 ArgGlySerThr AlaProAla GlyIleIle ProVal <210>

<211> 2 <212>
PRT

<213>
Arabidopsis thaliana <400> 16 Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu WO 00/53762 CA 02365968 2001-09-06 pCT~, P00/01978 Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val Asn Ser Val Gly Tyr Glu Val Phe Leu Leu Leu Leu Gln Phe Leu Tyr Ser Gly Gln Val Ser Ile Val Pro Gln Lys His Glu Pro Arg Pro Asn Cys Gly Glu Arg Gly Cys Trp His Thr His Cys Ser Ala Ala Val Asp Leu Ala Leu Asp Thr Leu Ala Ala Ser Arg Tyr Phe Gly Val Glu Gln Leu Ala Leu Leu Thr Gln Lys Gln Leu Ala Ser Met Val Glu Lys Ala Ser Ile Glu Asp Val Met Lys Val Leu Ile Ala Ser Arg Lys Gln Asp Met His Gln Leu Trp Thr Thr Cys Ser His Leu Val Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val Asn Ser Val Gly Tyr Glu Val Phe Leu Leu Leu Leu Gln Phe Leu Tyr Ser Gly Gln Val Ser Ile Val Pro Gln Lys His Glu Pro Arg Pro Asn Cys Gly Glu Arg Gly Cys Trp His Thr His Cys Ser Ala Ala Val Asp Leu Ala Leu Asp Thr Leu Ala Ala Ser Arg Tyr Phe WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Gly Val Glu Gln Leu Ala Leu Leu Thr Gln Lys Gln Leu Ala Ser Met Val Glu Lys Ala Ser Ile Glu Asp Val Met Lys Val Leu Ile Ala Ser Arg Lys Gln Asp Met His Gln Leu Trp Thr Thr Cys Ser His Leu Val Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Ser Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val <210>

<211>

<212>
DNA

<213>
Arabidopsis thaliana <220>

<221>
CDS

<222> (1803) (1)..

<223> genomic sequence AtNMLc4-1 <400>

atg get act gcaatagag ccatct tcatctata agtttcaca tct 48 gca Met Ala Thr AlaIleGlu ProSer SerSerIle SerPheThr Ser Ala tct cac tca aacccttct cctgtt gttactact tatcactca get 96 tta Ser His Ser AsnProSer ProVal ValThrThr TyrHisSer Ala Leu get aat gaa gagctcagc tctaac ttggagcag cttctcact aat 144 ctt Ala Asn Glu GluLeuSer SerAsn LeuGluGln LeuLeuThr Asn Leu cca gat gat tacactgac gcagag atcatcatt gaagaagaa get 192 tgc Pro Asp Asp TyrThrAsp AlaGlu IleIleIle GluGluGlu Ala Cys aac cct agt gttcataga tgtgtt ttagetget aggagcaag ttt 240 gtg Asn Pro Ser ValHisArg CysVal LeuAlaAla ArgSerLys Phe Val WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tttcttgatctg tttaagaaa gataaagat agtagtgag aagaaacct 288 PheLeuAspLeu PheLysLys AspLysAsp SerSerGlu LysLysPro aagtatcaaatg aaagattta ttaccatat ggaaatgtg ggacgtgag 336 LysTyrGlnMet LysAspLeu LeuProTyr GlyAsnVal GlyArgGlu gcatttctgcat ttcttgagc tatatctac actgggagg ttaaagcct 384 AlaPheLeuHis PheLeuSer TyrIleTyr ThrGlyArg LeuLysPro tttcctatcgag gtttcaact tgtgttgat tcagtttgt getcatgat 432 PheProIleGlu ValSerThr CysValAsp SerValCys AlaHisAsp tcttgtaaaccg gccattgat tttgetgtt gagttgatg tatgettca 480 SerCysLysPro AlaIleAsp PheAlaVal GluLeuMet TyrAlaSer tttgtgttccaa atcccggat cttgtttcg tcatttcag cggaagctt 528 PheValPheGln IleProAsp LeuValSer SerPheGln ArgLysLeu cgtaactatgtt gagaagtca ctagtagag aatgttctt cctatcctc 576 ArgAsnTyrVal GluLysSer LeuValGlu AsnValLeu ProIleLeu ttagttgcgttt cattgtgat ttgacacag cttcttgat caatgcatt 624 LeuValAlaPhe HisCysAsp LeuThrGln LeuLeuAsp GlnCysIle gagagagtggcg agatcagac ttagacaga ttctgtatc gaaaaggag 672 GluArgValAla ArgSerAsp LeuAspArg PheCysIle GluLysGlu cttcctttagaa gtattggaa aaaatcaaa cagcttcga gttaagtcg 720 LeuProLeuGlu ValLeuGlu LysIleLys GlnLeuArg ValLysSer gtgaacataccc gaggtggag gataaatcg atagagaga acagggaaa 768 ValAsnIlePro GluValGlu AspLysSer IleGluArg ThrGlyLys gtactcaaggca ttggattca gatgatgta gaactcgtg aagcttctt 816 ValLeuLysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu ttgactgagtca gatataact ctagaccaa gccaatggt ctacattat 864 LeuThrGluSer AspIleThr LeuAspGln AlaAsnGly LeuHisTyr gcagtggcatac agtgatccg aaagttgtg acacaggtt cttgatcta 912 AlaValAlaTyr SerAspPro LysValVal ThrGlnVal LeuAspLeu gatatggetgat gttaatttc agaaattcc agggggtat acggttctt 960 AspMetAlaAsp ValAsnPhe ArgAsnSer ArgGlyTyr ThrValLeu WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 catattgetgetatg cgtaga gagccaaca attatcatacca cttatt 1008 HisIleAlaAlaMet ArgArg GluProThr IleIleIlePro LeuIle caaaaaggagetaat gettca gatttcacg tttgatggacgc agtgcg 1056 GlnLysGlyAlaAsn AlaSer AspPheThr PheAspGlyArg SerAla gtaaatatatgtagg agactc actaggccg aaagattatcat accaaa 1104 ValAsnIleCysArg ArgLeu ThrArgPro LysAspTyrHis ThrLys acctcaaggaaagaa cctagt aaataccgc ttatgcatcgat atcttg 1152 ThrSerArgLysGlu ProSer LysTyrArg LeuCysIleAsp IleLeu gaaagggaaattaga aggaat ccattggtt agtggggataca cccact 1200 GluArgGluIleArg ArgAsn ProLeuVal SerGlyAspThr ProThr tgttcccattcgatg cccgag gatctccaa atgaggttgtta tactta 1248 CysSerHisSerMet ProGlu AspLeuGln MetArgLeuLeu TyrLeu gaaaagcgatgggac ttgcgt cagttgttc ttcccagcagaa gccaat 1296 GluLysArgTrpAsp LeuArg GlnLeuPhe PheProAlaGlu AlaAsn gtggetatggacgtt getaat gttgaaggg acaagcgagtgc acaggt 1344 ValAlaMetAspVal AlaAsn ValGluGly ThrSerGluCys ThrGly cttctaactccacct ccatca aatgataca actgaaaacttg ggtaaa 1392 LeuLeuThrProPro ProSer AsnAspThr ThrGluAsnLeu GlyLys gtcgatttaaatgaa acgcct tatgtgcaa acgaaaagaatg cttaca 1440 ValAspLeuAsnGlu ThrPro TyrValGln ThrLysArgMet LeuThr cgtatgaaagccctc atgaaa acaggtaaa agcttaaggaaa tgtact 1488 ArgMetLysAlaLeu MetLys ThrGlyLys SerLeuArgLys CysThr ttcaagttttattct ctgacc acaagattg actgattcgaaa ccgttc 1536 PheLysPheTyrSer LeuThr ThrArgLeu ThrAspSerLys ProPhe aacaacgcagttgag acaggt cggagatac ttcccatcttgt tatgag 1584 AsnAsnAlaValGlu ThrGly ArgArgTyr PheProSerCys TyrGlu gttctggataagtac atggat cagtatatg gacgaagaaatc cctgat 1632 ValLeuAspLysTyr MetAsp GlnTyrMet AspGluGluIle ProAsp atgtcgtatcccgag aaaggc actgtgaaa gagagaagacag aagagg 1680 MetSerTyrProGlu LysGly ThrValLys GluArgArgGln LysArg atg aga tat aac gag ctg aag aac gac gtt aaa aaa gca tat agc aaa 1728 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys Lys Ala Tyr Ser Lys gac aaa gtc gcg cgg tct tgt ctt tct tct tca tca cca get tct tct 1776 Asp Lys Val Ala Arg Ser Cys Leu Ser Ser Ser Ser Pro Ala Ser Ser ctt aga gaa gcc tta gag aat cca aca t 1804 Leu Arg Glu Ala Leu Glu Asn Pro Thr <210> 18 <211> 601 <212> PRT
<213> Arabidopsis thaliana <400> 18 Met Ala Ala Thr Ala Ile Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser His Leu Ser Asn Pro Ser Pro Val Val Thr Thr Tyr His Ser Ala Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gln Leu Leu Thr Asn Pro Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala Asn Pro Val Ser Val His Arg Cys Val Leu Ala Ala Arg Ser Lys Phe Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys Pro Lys Tyr Gln Met Lys Asp Leu Leu Pro Tyr Gly Asn Val Gly Arg Glu Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys Pro Phe Pro Ile Glu Val Ser Thr Cys Val Asp Ser Val Cys Ala His Asp Ser Cys Lys Pro Ala Ile Asp Phe Ala Val Glu Leu Met Tyr Ala Ser Phe Val Phe Gln Ile Pro Asp Leu Val Ser Ser Phe Gln Arg Lys Leu Arg Asn Tyr Val Glu Lys Ser Leu Val Glu Asn Val Leu Pro Ile Leu Leu Val Ala Phe His Cys Asp Leu Thr Gln Leu Leu Asp Gln Cys Ile Glu Arg Val Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu Leu Pro Leu Glu Val Leu Glu Lys Ile Lys Gln Leu Arg Val Lys Ser WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Val Asn Ile Pro Glu Val Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys Val Leu Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Gln Ala Asn Gly Leu His Tyr Ala Val Ala Tyr Ser Asp Pro Lys Val Val Thr Gln Val Leu Asp Leu Asp Met Ala Asp Val Asn Phe Arg Asn Ser Arg Gly Tyr Thr Val Leu His Ile Ala Ala Met Arg Arg Glu Pro Thr Ile Ile Ile Pro Leu Ile Gln Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile Cys Arg Arg Leu Thr Arg Pro Lys Asp Tyr His Thr Lys Thr Ser Arg Lys Glu Pro Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Arg Asn Pro Leu Val Ser Gly Asp Thr Pro Thr Cys Ser His Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Lys Arg Trp Asp Leu Arg Gln Leu Phe Phe Pro Ala Glu Ala Asn Val Ala Met Asp Val Ala Asn Val Glu Gly Thr Ser Glu Cys Thr Gly Leu Leu Thr Pro Pro Pro Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys Val Asp Leu Asn Glu Thr Pro Tyr Val Gln Thr Lys Arg Met Leu Thr Arg Met Lys Ala Leu Met Lys Thr Gly Lys Ser Leu Arg Lys Cys Thr Phe Lys Phe Tyr Ser Leu Thr Thr Arg Leu Thr Asp Ser Lys Pro Phe Asn Asn Ala Val Glu Thr Gly Arg Arg Tyr Phe Pro Ser Cys Tyr Glu Val Leu Asp Lys Tyr Met Asp Gln Tyr Met Asp Glu Glu Ile Pro Asp Met Ser Tyr Pro Glu Lys Gly Thr Val Lys Glu Arg Arg Gln Lys Arg WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys Lys Ala Tyr Ser Lys AspLysValAla ArgSerCys LeuSerSer SerSer ProAlaSer Ser LeuArgGluAla LeuGluAsn ProThr <210>

<211> 03 <212>
DNA

<213>
Arabidopsis thaliana <220>

<221>
CDS

<222> )..(1803) (1 <223> NMLc4-2 genomic sequence At <400>

atggccaccacc accaccacc accaccget agattc tctgattca tac 48 MetAlaThrThr ThrThrThr ThrThrAla ArgPhe SerAspSer Tyr gagttcagcaac acaagcggc aatagcttc ttcgcc gccgagtca tct 96 GluPheSerAsn ThrSerGly AsnSerPhe PheAla AlaGluSer Ser cttgattatccg acggaattt ctcacgcca ccggag gtatcaget ctt 144 LeuAspTyrPro ThrGluPhe LeuThrPro ProGlu ValSerAla Leu aaacttctgtct aactgcctc gagtctgtt ttcgac tcgccggag acg 192 LysLeuLeuSer AsnCysLeu GluSerVal PheAsp SerProGlu Thr ttctacagcgat getaagcta gttctcgcc ggcggc cgggaagtt tct 240 PheTyrSerAsp AlaLysLeu ValLeuAla GlyGly ArgGluVal Ser tttcaccgttgt attctttcc gcgagaatt cctgtc ttcaaaagc get 288 PheHisArgCys IleLeuSer AlaArgIle ProVal PheLysSer Ala ttagccaccgtg aaggaacaa aaatcctcc accacc gtgaagctc cag 336 LeuAlaThrVal LysGluGln LysSerSer ThrThr ValLysLeu Gln ctgaaagagatc gccagagat tacgaagtc ggcttt gactcggtt gtg 384 LeuLysGluIle AlaArgAsp TyrGluVal GlyPhe AspSerVal Val gcggttttggcg tatgtttac agcggcaga gtgagg tccccgccg aag 432 AlaValLeuAla TyrValTyr SerGlyArg ValArg SerProPro Lys ggagettctget tgcgtagac gacgattgt tgccac gtggettgc cgg 480 GlyAlaSerAla CysValAsp AspAspCys CysHis ValAlaCys Arg WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tcaaaggtggat ttcatggtg gaggtt ctttatctg tctttcgtt ttc 528 SerLysValAsp PheMetVal GluVal LeuTyrLeu SerPheVal Phe cagattcaagaa ttagttact ctgtat gagaggcag ttcttggaa att 576 GlnIleGlnGlu LeuValThr LeuTyr GluArgGln PheLeuGlu Ile gtagacaaagtt gtagtcgaa gacatc ttggttata ttcaagctt gat 624 ValAspLysVal ValValGlu AspIle LeuValIle PheLysLeu Asp actctatgtggt acaacatac aagaag cttttggat agatgcata gaa 672 ThrLeuCysGly ThrThrTyr LysLys LeuLeuAsp ArgCysIle Glu attatcgtgaag tctgatata gaacta gttagtctt gagaagtct tta 720 IleIleValLys SerAspIle GluLeu ValSerLeu GluLysSer Leu cctcaacacatt ttcaagcaa atcata gacatccgc gaagcgctc tgt 768 ProGlnHisIle PheLysGln IleIle AspIleArg GluAlaLeu Cys ctagagccacct aaactagaa aggcat gtcaagaac atatacaag gcg 816 LeuGluProPro LysLeuGlu ArgHis ValLysAsn IleTyrLys Ala ctagactcagat gatgttgag cttgtc aagatgctt ttgctagaa gga 864 LeuAspSerAsp AspValGlu LeuVal LysMetLeu LeuLeuGlu Gly cacaccaatctc gatgaggcg tatget cttcatttt getatcget cac 912 HisThrAsnLeu AspGluAla TyrAla LeuHisPhe AlaIleAla His tgcgetgtgaag accgcgtat gatctc ctcgagctt gagcttgcg gat 960 CysAlaValLys ThrAlaTyr AspLeu LeuGluLeu GluLeuAla Asp gttaaccttaga aatccgagg ggatac actgtgctt catgttget gcg 1008 ValAsnLeuArg AsnProArg GlyTyr ThrValLeu HisValAla Ala atgcggaaggag ccgaagttg ataata tctttgtta atgaaaggg gca 1056 MetArgLysGlu ProLysLeu IleIle SerLeuLeu MetLysGly Ala aatattttagac acaacattg gatggt agaaccget ttagtgatt gta 1104 AsnIleLeuAsp ThrThrLeu AspGly ArgThrAla LeuValIle Val aaacgactcact aaagcggat gactac aaaactagt acggaggac ggt 1152 LysArgLeuThr LysAlaAsp AspTyr LysThrSer ThrGluAsp Gly acgccttctctg aaaggcgga ttatgc atagaggta cttgagcat gaa 1200 ThrProSerLeu LysGlyGly LeuCys IleGluVal LeuGluHis Glu caaaaa ctagaatat ttgtcgcct atagagget tcactttct cttcca 1248 GlnLys LeuGluTyr LeuSerPro IleGluAla SerLeuSer LeuPro gtaact ccagaggag ttgaggatg aggttgctc tattatgaa aaccga 1296 ValThr ProGluGlu LeuArgMet ArgLeuLeu TyrTyrGlu AsnArg gttgca cttgetcga cttctcttt ccagtggaa actgaaact gtacag 1344 ValAla LeuAlaArg LeuLeuPhe ProValGlu ThrGluThr ValGln ggtatt gccaaattg gaggaaaca tgcgagttt acagettct agtctc 1392 GlyIle AlaLysLeu GluGluThr CysGluPhe ThrAlaSer SerLeu gagcct gatcatcac attggtgaa aagcggaca tcactagac ctaaat 1440 GluPro AspHisHis IleGlyGlu LysArgThr SerLeuAsp LeuAsn atggcg ccgttccaa atccatgag aagcatttg agtagacta agagca 1488 MetAla ProPheGln IleHisGlu LysHisLeu SerArgLeu ArgAla ctttgt aaaaccgtg gaactgggg aaacgctac ttcaaacga tgttcg 1536 LeuCys LysThrVal GluLeuGly LysArgTyr PheLysArg CysSer cttgat cactttatg gatactgag gacttgaat catcttget agcgta 1584 LeuAsp HisPheMet AspThrGlu AspLeuAsn HisLeuAla SerVal gaagaa gatactcct gagaaacgg ctacaaaag aagcaaagg tacatg 1632 GluGlu AspThrPro GluLysArg LeuGlnLys LysGlnArg TyrMet gaacta caagagact ctgatgaag acctttagt gaggacaag gaggaa 1680 GluLeu GlnGluThr LeuMetLys ThrPheSer GluAspLys GluGlu tgtgga aagtcttcc acaccgaaa ccaacctct gcggtgagg tctaat 1728 CysGly LysSerSer ThrProLys ProThrSer AlaValArg SerAsn agaaaa ctctctcac cggcgccta aaagtggac aaacgggat tttttg 1776 ArgLys LeuSerHis ArgArgLeu LysValAsp LysArgAsp PheLeu aaacga ccttacggg aacggggat taa LysArg ProTyrGly AsnGlyAsp <210>

<211> 0 <212>
PRT

<213> abidopsis Ar thaliana <400> 20 Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe Ser Asp Ser Tyr WO 00/53762 CA 02365968 2001-09-06 pC'T/EP00/01978 Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser Ser Leu Asp Tyr Pro Thr Glu Phe Leu Thr Pro Pro Glu Val Ser Ala Leu Lys Leu Leu Ser Asn Cys Leu Glu Ser Val Phe Asp Ser Pro Glu Thr Phe Tyr Ser Asp Ala Lys Leu Val Leu Ala Gly Gly Arg Glu Val Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ile Pro Val Phe Lys Ser Ala Leu Ala Thr Val Lys Glu Gln Lys Ser Ser Thr Thr Val Lys Leu Gln Leu Lys Glu Ile Ala Arg Asp Tyr Glu Val Gly Phe Asp Ser Val Val Ala Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Ser Pro Pro Lys Gly Ala Ser Ala Cys Val Asp Asp Asp Cys Cys His Val Ala Cys Arg Ser Lys Val Asp Phe Met Val Glu Val Leu Tyr Leu Ser Phe Val Phe Gln Ile Gln Glu Leu Val Thr Leu Tyr Glu Arg Gln Phe Leu Glu Ile Val Asp Lys Val Val Val Glu Asp Ile Leu Val Ile Phe Lys Leu Asp Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile Glu Ile Ile Val Lys Ser Asp Ile Glu Leu Val Ser Leu Glu Lys Ser Leu Pro Gln His Ile Phe Lys Gln Ile Ile Asp Ile Arg Glu Ala Leu Cys Leu Glu Pro Pro Lys Leu Glu Arg His Val Lys Asn Ile Tyr Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Leu Glu Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala His Cys Ala Val Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala Asp Val Asn Leu Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Leu Ile Ile Ser Leu Leu Met Lys Gly Ala Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Val Ile Val Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp Gly Thr Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His Glu Gln Lys Leu Glu Tyr Leu Ser Pro Ile Glu Ala Ser Leu Ser Leu Pro Val Thr Pro Glu Glu Leu Arg Met Arg Leu Leu Tyr Tyr Glu Asn Arg Val Ala Leu Ala Arg Leu Leu Phe Pro Val Glu Thr Glu Thr Val Gln Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser Leu Glu Pro Asp His His Ile Gly Glu Lys Arg Thr Ser Leu Asp Leu Asn Met Ala Pro Phe Gln Ile His Glu Lys His Leu Ser Arg Leu Arg Ala WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Leu Cys Lys Thr Val Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys Ser Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser Val Glu Glu Asp Thr Pro Glu Lys Arg Leu Gln Lys Lys Gln Arg Tyr Met Glu Leu Gln Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu Glu Cys Gly Lys Ser Ser Thr Pro Lys Pro Thr Ser Ala Val Arg Ser Asn Arg Lys Leu Ser His Arg Arg Leu Lys Val Asp Lys Arg Asp Phe Leu Lys Arg Pro Tyr Gly Asn Gly Asp <210> 21 <211> 28 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 21 gakattattg tcaagtctaa tgtwgata 28 <210> 22 <211> 25 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 22 aytkgaytck gatgatrttg artta 25 <210> 23 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 23 taaytcaaya tcatcmgart cmartgc 27 <210> 24 <211> 28 <212> DNA
<213> Artificial Sequence WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 <220>
<223> Description of Artificial Sequence: PCR primer NIM

<220>
<221> misc_feature <222> (1). (28) <223> n = a, t, c or g <400> 24 gttkagcmag nscaactcta ttttcaag 28 <210> 25 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 25 tgcatwgara twrttgtsaa gtctratgtw ga 32 <210> 26 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 26 ggcaytggay tcwgatgatg ttgaryt 27 <210> 27 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 27 arytcaacat catcwgartc cartgcc 27 <210> 28 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <400> 28 agttkagcma gdccaactck attttcaarr t 31 <210>

<211> 9 <212>
DNA

<213> cotiana tabacum Ni <220>

<221> S
CD

<222> )..(657) (1 <223> bacco To A

<400>

tgc atggagatt attgtcaag tctaat gttgatatcata acccttgat 48 Cys MetGluIle IleValLys SerAsn ValAspIleIle ThrLeuAsp aag gccttgcct catgacatt gtaaaa caaattaccgat tcacgagca 96 Lys AlaLeuPro HisAspIle ValLys GlnIleThrAsp SerArgAla gaa cttggtcta caagggcct gaaagc aatggttttcct gataaacat 144 Glu LeuGlyLeu GlnGlyPro GluSer AsnGlyPhePro AspLysHis gtt aagaggata catagggca ttagat tctgatgatgtt gaattactg 192 Val LysArgIle HisArgAla LeuAsp SerAspAspVal GluLeuLeu cag atgttgcta agagagggg catact actctagatgat gcatatget 240 Gln MetLeuLeu ArgGluGly HisThr ThrLeuAspAsp AlaTyrAla ctc cactatget gtagcatat tgcgat gcaaagactaca gcagaactt 288 Leu HisTyrAla ValAlaTyr CysAsp AlaLysThrThr AlaGluLeu cta gatcttgca cttgetgat gttaat catcaaaattca agaggatac 336 Leu AspLeuAla LeuAlaAsp ValAsn HisGlnAsnSer ArgGlyTyr aca gtgctgcat gttgcagcc atgagg aaagagcctaaa attatagtg 384 Thr ValLeuHis ValAlaAla MetArg LysGluProLys IleIleVal tcc cttttaacc aaaggaget agacct tctgatctgaca tccgatggc 432 Ser LeuLeuThr LysGlyAla ArgPro SerAspLeuThr SerAspGly aga aaagcactt caaattgcc aagagg ctcactaggctt gtggatttc 480 Arg LysAlaLeu GlnIleAla LysArg LeuThrArgLeu ValAspPhe agt aagtctcca gaggaagga aaatct gettcgaaggat cggttatgc 528 Ser LysSerPro GluGluGly LysSer AlaSerLysAsp ArgLeuCys att gagattctg gagcaagca gaaaga agagatccactg ctaggagaa 576 Ile GluIleLeu GluGlnAla GluArg ArgAspProLeu LeuGlyGlu get tct gta tct ctt get atg gcg ggc gat gat ttg cgt atg aag ctg 624 Ala Ser Val Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu tta tac ctt gaa aat aga gtt ggc ctt get caa ct 659 Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 30 <211> 219 <212> PRT
<213> Nicotiana tabacum <400> 30 Cys Met Glu Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ala Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Gln Met Leu Leu Arg Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ala Leu Ala Asp Val Asn His Gln Asn Ser Arg Gly Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Arg Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Ser Lys Ser Pro Glu Glu Gly Lys Ser Ala Ser Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Val Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <210> 31 <211> 498 <212> DNA
<213> Nicotiana tabacum <220>
<221> CDS
<222> (2)..(496) <223> Tobacco B
<400> 31 g gca ctg gat tct gat gat gtt gag ctg gtc aag ctt cta ctc aac gag 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Asn Glu tct gag ata agc tta gat gaa gcc tac get ctt cat tat get gtt gca 97 Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala tat tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt get 145 Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala gat gtc aat cta cgt aat act cgc ggt tac act gtg ctt cac att get 193 Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala gcc atg cgt aag gag cca gca ata att gta tcg ctt ttg act aag gga 241 Ala Met Arg Lys Glu Pro Ala Ile Ile Val Ser Leu Leu Thr Lys Gly get cat gtg tca gag att aca ttg gat ggg caa agt get gtt agt atc 289 Ala His Val Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile tgt agg agg cta act agg cct aag gag tac cat gca aaa aca gaa caa 337 Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg gag atg cgt cgc aac cca atg get gga gat gca ttg ctt tct tcc caa 433 Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Leu Ser Ser Gln atg ttg gcc gat gat ctg cac atg aaa ctg cac tat ttt gaa aat cga 481 Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Phe Glu Asn Arg gtt gga ctt get caa ct Val Gly Leu Ala Gln <210> 32 <211> 165 <212> PRT
<213> Nicotiana tabacum <400> 32 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Asn Glu Ser Glu Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala Ala Met Arg Lys Glu Pro Ala Ile Ile Val Ser Leu Leu Thr Lys Gly Ala His Val Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Leu Ser Ser Gln Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Phe Glu Asn Arg Val Gly Leu Ala Gln <210> 33 <211> 498 <212> DNA
<213> Nicotiana tabacum <220>
<221> CDS
<222> (2)..(496) <223> Tobacco C
<400> 33 g gca ctg gac tcw gat gat gtt gag ttt gtc aag ctt cta ctg agt gag 49 Ala Leu Asp Xaa Asp Asp Val Glu Phe Val Lys Leu Leu Leu Ser Glu tct aac ata agc tta gat gaa gcc tac get ctt cat tat get gtg gca 97 Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala tat tgt gat ccc aag gtt gtg act gag gtt ctt gga ctg ggt gtt gcg 145 Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala gat gtc aac cta cgt aat act cgt ggt tac act gtg ctt cac att get 193 Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala tcc atgcgtaag gagccagca gtaattgta tcgcttttg actaag gga 241 Ser MetArgLys GluProAla ValIleVal SerLeuLeu ThrLys Gly get cgtgcatca gagactaca ttggatggg cagagtget gttagt atc 289 Ala ArgAlaSer GluThrThr LeuAspGly GlnSerAla ValSer Ile tgt aggaggctg actaggcct aaggagtac catgcaaaa acagaa caa 337 Cys ArgArgLeu ThrArgPro LysGluTyr HisAlaLys ThrGlu Gln ggc caggaagca aacaaagat cgggtatgt attgatgtt ttggag aga 385 Gly GlnGluAla AsnLysAsp ArgValCys IleAspVal LeuGlu Arg gag atgcgtcgc aacccaatg getggagat gcattgttt tcttcc cca 433 Glu MetArgArg AsnProMet AlaGlyAsp AlaLeuPhe SerSer Pro atg ttggccgat gatctgcac atgaaactg cactacctt gaaaat aga 481 Met LeuAlaAsp AspLeuHis MetLysLeu HisTyrLeu GluAsn Arg gtt ggcctgget caact 498 Val GlyLeuAla Gln <210> 34 <211> 165 <212> PRT
<213> Nicotiana tabacum <400> 34 Ala Leu Asp Xaa Asp Asp Val Glu Phe Val Lys Leu Leu Leu Ser Glu Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala Ser Met Arg Lys Glu Pro Ala Val Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gln Ser Ala Val Ser Ile Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Glu Met Arg Arg Asn Pro Met Ala Gly Asp Ala Leu Phe Ser Ser Pro Met Leu Ala Asp Asp Leu His Met Lys Leu His Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 35 <211> 399 <212> DNA

<213> Nicotiana tabacum <220>

<221> CDS

<222> (1)..(399) <223> Tobacco D

<400> 35 act gat gatgat gttgagtta cttaagtta cttcttgaa gagtct 48 tcg Thr Asp AspAsp ValGluLeu LeuLysLeu LeuLeuGlu GluSer Ser aat gtc ttagac gatgettgt getcttcat tatgcaget gettat 96 act Asn Val LeuAsp AspAlaCys AlaLeuHis TyrAlaAla AlaTyr Thr tgt aac aaggtt gtgaatgag gtcctcgag ctggattta getgat 144 tcc Cys Asn LysVal ValAsnGlu ValLeuGlu LeuAspLeu AlaAsp Ser gtc aat cagaac tcccgagga tataacgtc cttcacgtt getget 192 ctt Val Asn GlnAsn SerArgGly TyrAsnVal LeuHisVal AlaAla Leu aga aga gagcca tcaataata atgggacta cttgaaaaa ggagca 240 aag Arg Arg GluPro SerIleIle MetGlyLeu LeuGluLys GlyAla Lys tct ttc aatact acacgggat ggaaacaca gcactatct atctgt 288 ttg Ser Phe AsnThr ThrArgAsp GlyAsnThr AlaLeuSer IleCys Leu cgg aga actcgg ccaaaggat tataatgag ccaacaaag caaggg 336 ttg Arg Arg ThrArg ProLysAsp TyrAsnGlu ProThrLys GlnGly Leu aaa gaa aataag gaccgcata tgcattgat attttggag agagag 384 act Lys Glu AsnLys AspArgIle CysIleAsp IleLeuGlu ArgGlu Thr acg aat aatcct 399 agg Thr Asn AsnPro Arg <210> 36 <211> 133 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <212> PRT
<213> Nicotiana tabacum <400> 36 Thr Asp Ser Asp Asp Val Glu Leu Leu Lys Leu Leu Leu Glu Glu Ser Asn Val Thr Leu Asp Asp Ala Cys Ala Leu His Tyr Ala Ala Ala Tyr Cys Asn Ser Lys Val Val Asn Glu Val Leu Glu Leu Asp Leu Ala Asp Val Asn Leu Gln Asn Ser Arg Gly Tyr Asn Val Leu His Val Ala Ala Arg Arg Lys Glu Pro Ser Ile Ile Met Gly Leu Leu Glu Lys Gly Ala Ser Phe Leu Asn Thr Thr Arg Asp Gly Asn Thr Ala Leu Ser Ile Cys Arg Arg Leu Thr Arg Pro Lys Asp Tyr Asn Glu Pro Thr Lys Gln Gly Lys Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Ile Leu Glu Arg Glu Thr Asn Arg Asn Pro <210> 37 <211> 498 <212> DNA
<213> Lycopersicon esculentum <220>
<221> CDS
<222> (2)..(496) <223> Tomato A
<400> 37 g gca ttg gat tct gat gat gtt gag tta cta agg atg ttg ctt aaa gag 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu ggg cat act act ctt gat gat gca tat get ctc cac tat get gta gca 97 Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala tat tgc gat gca aag act aca gca gaa ctt tta gat ctt tca ctt get 145 Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala gat gtt aat cat caa aat cct aga gga cac acg gta ctt cat gtt get 193 Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val Leu His Val Ala gcc atg agg aaa gaa cct aaa att ata gtg tcc ctt tta acc aaa gga 241 WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 AlaMetArgLys GluProLys IleIleVal SerLeuLeuThr LysGly getagaccttct gatctgaca tccgatggc aaaaaagcactt caaatt 289 AlaArgProSer AspLeuThr SerAspGly LysLysAlaLeu GlnIle getaagaggctc actaggctt gtagatttt accaagtctaca gaggaa 337 AlaLysArgLeu ThrArgLeu ValAspPhe ThrLysSerThr GluGlu ggaaaatctget ccaaaggat cggttatgc attgagattctg gagcaa 385 GlyLysSerAla ProLysAsp ArgLeuCys IleGluIleLeu GluGln gcagaaagaaga gatccacta ctaggagaa gettcattatct cttget 433 AlaGluArgArg AspProLeu LeuGlyGlu AlaSerLeuSer LeuAla atggcaggcgat gatttgcgt atgaagctg ttataccttgaa aataga 481 MetAlaGlyAsp AspLeuArg MetLysLeu LeuTyrLeuGlu AsnArg gttggccttget aaact 4gg ValGlyLeuAla Lys <210> 38 <211> 165 <212> PRT
<213> Lycopersicon esculentum <400> 38 Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly His Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys <210> 39 <211> 498 <212> DNA
<213> Beta vulgaris <220>
<221> CDS
<222> (2)..(496) <223> Sugarbeet <400> 39 g gca ttg gat tct gat gat gtt gag tta gtc aga atg ctt tta aaa gag 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Arg Met Leu Leu Lys Glu cgc cat aca act cta gat gat gca tat gcc ctt cac tat get gtg gca 97 Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala cat tgt gat gcc aag acc acc acg gag ctt ctt gag ctt ggg ctt gca 145 His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala gat gtt aat ctt aga aat cta agg ggt cac act gtg cta cat gtg gca 193 Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val Leu His Val Ala gcc atg aga aaa gag cct aag ata att gta tcc ttg tta acc aag gga 241 Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly gcc cat ccg tct gat ata aca tca gat gat aaa aaa gca ctg cag ata 289 Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gln Ile gca aag aga cta aca aaa get gtg gac ttc tat aaa act aca gaa caa 337 Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys Thr Thr Glu Gln gga aaa gat gca cca aag gat cgg ttg tgc att gaa ata ctg gag caa 385 Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln get gaa aga aga gaa cca ttg cta gga gaa ggt tct gtt tct ctt gca 433 Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser Val Ser Leu Ala aag gca gga gat gat ctg cgt atg aag cta tta tac ctt gaa aat cga 481 Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg gtt ggc ctt get caa ct Val Gly Leu Ala Gln WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 <210> 40 <211> 165 <212> PRT
<213> Beta vulgaris <400> 40 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Arg Met Leu Leu Lys Glu Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys Thr Thr Glu Gln Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser Val Ser Leu Ala Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 41 <211> 498 <212> DNA
<213> Helianthus annuus <220>
<221> CDS
<222> (2)..(496) <223> Sunflower A
<400> 41 g gca ttg gat tct gat gat gtt gag yta gtc aca atg tta tta cga gaa 49 Ala Leu Asp Ser Asp Asp Val Glu Xaa Val Thr Met Leu Leu Arg Glu ggt cat act tca tta gac ggt tct tgc get ctt cat tac get gtt gcg 97 Gly His Thr Ser Leu Asp Gly Ser Cys Ala Leu His Tyr Ala Val Ala WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tacgca gatget aaaacgaca accgaatta ctggattta gcacttget 145 TyrAla AspAla LysThrThr ThrGluLeu LeuAspLeu AlaLeuAla gacgta aatcat aaaaactcg aggggtttt accgtactt catgttgcc 193 AspVal AsnHis LysAsnSer ArgGlyPhe ThrValLeu HisValAla getatg agaaaa gagccgagt attatcgtt tcgcttctt acgaaaggg 241 AlaMet ArgLys GluProSer IleIleVal SerLeuLeu ThrLysGly gcccga ccctcg gatctcacc cctgatggg agaaaagca ctacagatt 289 AlaArg ProSer AspLeuThr ProAspGly ArgLysAla LeuGlnIle tcgaag aggttg accagagcg gttgactat tacaagtca aacgaggat 337 SerLys ArgLeu ThrArgAla ValAspTyr TyrLysSer AsnGluAsp gataaa gagtca acgaaaggt cgtttgtgt attgagata ttggaacaa 385 AspLys GluSer ThrLysGly ArgLeuCys IleGluIle LeuGluGln gccgaa agaaga aatccattg ttaggtgaa gettcgget tctcttgca 433 AlaGlu ArgArg AsnProLeu LeuGlyGlu AlaSerAla SerLeuAla atggcc ggagat gatttgcgt ggaaagttg ttgtacctt gaaaatcga 481 MetAla GlyAsp AspLeuArg GlyLysLeu LeuTyrLeu GluAsnArg gttggc ctgget caact 498 ValGly LeuAla Gln <210>

<211>

<212>
PRT

<213> annuus Helianthus <400>

Ala Leu Ser AspAspVal GluXaaVal ThrMetLeu LeuArgGlu Asp Gly His Ser LeuAspGly SerCysAla LeuHisTyr AlaValAla Thr Tyr Ala Ala LysThrThr ThrGluLeu LeuAspLeu AlaLeuAla Asp Asp Val His LysAsnSer ArgGlyPhe ThrValLeu HisValAla Asn Ala Met Lys GluProSer IleIleVal SerLeuLeu ThrLysGly Arg Ala Arg Pro Ser Asp Leu Thr Pro Asp Gly Arg Lys Ala Leu Gln Ile WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Ser Lys Arg Leu Thr Arg Ala Val Asp Tyr Tyr Lys Ser Asn Glu Asp Asp Lys Glu Ser Thr Lys Gly Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asn Pro Leu Leu Gly Glu Ala Ser Ala Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Gly Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 43 <211> 498 <212> DNA
<213> Helianthus annuus <220>
<221> CDS
<222> (2)..(496) <223> Sunflower B
<400> 43 g gca ttg gac tct gat gat gtt gag ctt gtg aaa atg att tta gac gaa 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Ile Leu Asp Glu tcc aaa atc acg tta gat gaa gcc tgc get ctt cat tat gcg gtc atg 97 Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Val Met tat tgt aat caa gaa gtt get aag gag att ctt aac tta aac cgt gcg 145 Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala gat gtt aat ctt aga aac tca cga gat tac acc gtg ctt cat gtt get 193 Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr Thr Val Leu His Val Ala gcc atg cgt aaa gaa cca tca ctt att gtt tcg att cta agc aaa ggc 241 Ala Met Arg Lys Glu Pro Ser Leu Ile Val Ser Ile Leu Ser Lys Gly gcg tgt gca tcg gat act act ttt gat gga caa agt gcg gtt agt att 289 Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gln Ser Ala Val Ser Ile tgc agg aga cga aca agg ccc aag gat tat tat gtg aaa acc gaa cac 337 Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr Tyr Val Lys Thr Glu His ggg caa gaa aca aat aaa gat cgt ata tgc atc gat gtt ttg gag cgg 385 Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Val Leu Glu Arg WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 gaa ata aag agg aat ccg atg ata ggc gat gtt tcc gtg tgt tct tca 433 Glu Ile Lys Arg Asn Pro Met Ile Gly Asp Val Ser Val Cys Ser Ser gca gtg get gat gat ttg cat atg aat tta ctc tac ttt gaa aat cga 481 Ala Val Ala Asp Asp Leu His Met Asn Leu Leu Tyr Phe Glu Asn Arg gtt ggc ctt get caa ct 498 Val Gly Leu Ala Gln <210> 44 <211> 165 <212> PRT
<213> Helianthus annuus <400> 44 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Ile Leu Asp Glu Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Val Met Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Ser Leu Ile Val Ser Ile Leu Ser Lys Gly Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gln Ser Ala Val Ser Ile Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr Tyr Val Lys Thr Glu His Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Val Leu Glu Arg Glu Ile Lys Arg Asn Pro Met Ile Gly Asp Val Ser Val Cys Ser Ser Ala Val Ala Asp Asp Leu His Met Asn Leu Leu Tyr Phe Glu Asn Arg Val Gly Leu Ala Gln <210> 45 <211> 653 <212> DNA
<213> Solanum tuberosum <220>

WO CA 02365968 2001-09-06 pCT/EP00/01978 <221> S
CD

<222> )..(651) (1 <223> tatoA
Po <400>

gakatt attgtcaagtct aatgttgat atcataacc cttgataag tcc 48 XaaIle IleValLysSer AsnValAsp IleIleThr LeuAspLys Ser ttgcct catgacatcgta aaacaaatc actgattca cgtgetgaa ctt 96 LeuPro HisAspIleVal LysGlnIle ThrAspSer ArgAlaGlu Leu ggtcta caagggcctgaa agcaatggt tttcctgat aaacatgtt aag 144 GlyLeu GlnGlyProGlu SerAsnGly PheProAsp LysHisVal Lys aggata catagggcattg gactctgat gatgttgag ttactaagg atg 192 ArgIle HisArgAlaLeu AspSerAsp AspValGlu LeuLeuArg Met ttgctt aaagaagggcat actactctc gatgatgca tatgetctc cac 240 LeuLeu LysGluGlyHis ThrThrLeu AspAspAla TyrAlaLeu His tatget gtagcatattgc gatgcaaag actacagca gaactttta gat 288 TyrAla ValAlaTyrCys AspAlaLys ThrThrAla GluLeuLeu Asp ctttca cttgetgatgtt aatcatcaa aatcctaga ggatacacg gta 336 LeuSer LeuAlaAspVal AsnHisGln AsnProArg GlyTyrThr Val cttcat gttgetgccatg aggaaagag cctaaaatt atagtgtcc ctt 384 LeuHis ValAlaAlaMet ArgLysGlu ProLysIle IleValSer Leu ttaacc aaaggagetaga ccttctgat ctgacatct gatggcaaa aaa 432 LeuThr LysGlyAlaArg ProSerAsp LeuThrSer AspGlyLys Lys gcactt caaattgetaag aggctcact aggcttgtg gattttact aag 480 AlaLeu GlnIleAlaLys ArgLeuThr ArgLeuVal AspPheThr Lys tctaca gaggaaggaaaa tctgetcca aaagatcgg ttatgcatt gag 528 SerThr GluGluGlyLys SerAlaPro LysAspArg LeuCysIle Glu attctg gagcaagcagaa agaagagat ccactacta ggagaaget tca 576 IleLeu GluGlnAlaGlu ArgArgAsp ProLeuLeu GlyGluAla Ser ttatct cttgetatggca ggcgatgat ttgcgtatg aagctgtta tac 624 LeuSer LeuAlaMetAla GlyAspAsp LeuArgMet LysLeuLeu Tyr cttgaa aatcgagttggc ctkgetcaa ct 653 LeuGlu AsnArgValGly XaaAlaGln WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 <210> 46 <211> 217 <212> PRT
<213> Solanum tuberosum <400> 46 Xaa Ile Ile Val Lys Ser Asn Val Asp Ile Ile Thr Leu Asp Lys Ser Leu Pro His Asp Ile Val Lys Gln Ile Thr Asp Ser Arg Ala Glu Leu Gly Leu Gln Gly Pro Glu Ser Asn Gly Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala Leu Asp Ser Asp Asp Val Glu Leu Leu Arg Met Leu Leu Lys Glu Gly His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Ala Lys Thr Thr Ala Glu Leu Leu Asp Leu Ser Leu Ala Asp Val Asn His Gln Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Pro Ser Asp Leu Thr Ser Asp Gly Lys Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Arg Leu Val Asp Phe Thr Lys Ser Thr Glu Glu Gly Lys Ser Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Asp Pro Leu Leu Gly Glu Ala Ser Leu Ser Leu Ala Met Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Xaa Ala Gln <210> 47 <211> 498 <212> DNA
<213> Solanum tuberosum <220>
<221> CDS
<222> (2)..(496) <223> Potato B

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <400> 47 g gca ttg gat tca gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 49 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu tct gac ata agt tta gat gga gcc tac get ctt cat tac get gtt gca 97 Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala tat tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt get 145 Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala aat gtc aac ctt cgg aat aca cgt ggt tac act gtg ctt cac att get 193 Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala gcc atg cgt aag gaa ccc tca atc att gta tca ctt ttg act aag gga 241 Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly get cat gca tca gaa att aca ttg gat ggg cag agt get gtt ggc atc 289 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Gly Ile tgt agg agg ctg agt agg cct aag gag tac cat gca aaa aca gaa caa 337 Cys Arg Arg Leu Ser Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln ggc cag gaa gca aac aaa gat cgg gta tgt att gat gtt ttg gag aga 385 Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg gag atg cgt cac aac cca atg acc gga gat gca tta ttt tct tcc ccc 433 Glu Met Arg His Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro atg ttg gcc gat gat ctg ccc atg aaa ctg ctc tac ctt gaa aat cga 481 Met Leu Ala Asp Asp Leu Pro Met Lys Leu Leu Tyr Leu Glu Asn Arg gtt ggc ctt get aaa ct Val Gly Leu Ala Lys <210> 48 <211> 165 <212> PRT
<213> Solanum tuberosum <400> 48 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Gly Ile Cys Arg Arg Leu Ser Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg Glu Met Arg His Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro Met Leu Ala Asp Asp Leu Pro Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys <210> 49 <211> 477 <212> DNA
<213> Solanum tuberosum <220>
<221> CDS
<222> (2)..(475) <223> Potato C
<400> 49 g gca ctg gac tct gat gat gtt gag ttt gtc aag ctt cta ctt aat gag 49 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu tct gac ata agt tta gat gga gcc tac get ctt cat tac get gtt gca 97 Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala tat tgt gac ccc aag gtt gtt act gag gtt ctt gga ctg ggt gtt get 145 Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala aat gtc aac ctt cgg aat aca cgt ggt tac act gtg ctt cac att get 193 Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala gcc atg cgt aag gaa ccc tca atc att gta tca ctt ttg act aag gga 241 Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly get cat gca tca gaa att aca ttg gat ggg cag agt get gtt agc atc 289 Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tgtagg aggctgact aggcct aaggagtac catgcaaaa acagaacaa 337 CysArg ArgLeuThr ArgPro LysGluTyr HisAlaLys ThrGluGln ggccag gaagcaaac aaagat cgggtatgt attgatgtt ttggagaga 385 GlyGln GluAlaAsn LysAsp ArgValCys IleAspVal LeuGluArg gagatg cgtcgcaac ccaatg accggagat gcattattt tcttccccc 433 GluMet ArgArgAsn ProMet ThrGlyAsp AlaLeuPhe SerSerPro atgaaa cagctctac cttgaa aatagagtt ggccttget aaact 477 MetLys GlnLeuTyr LeuGlu AsnArgVal GlyLeuAla Lys <210> 50 <211> 158 <212> PRT
<213> Solanum tuberosum <400> 50 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Asn Glu Ser Asp Ile Ser Leu Asp Gly Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala Asn Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala Ala Met Arg Lys Glu Pro Ser Ile Ile Val Ser Leu Leu Thr Lys Gly Ala His Ala Ser Glu Ile Thr Leu Asp Gly Gln Ser Ala Val Ser Ile Cys Arg Arg Leu Thr Arg Pro Lys Glu Tyr His Ala Lys Thr Glu Gln Gly Gln Glu Ala Asn Lys Asp Arg Val Cys Ile Asp Val Leu Glu Arg Glu Met Arg Arg Asn Pro Met Thr Gly Asp Ala Leu Phe Ser Ser Pro Met Lys Gln Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys <210> 51 <211> 501 <212> DNA
<213> Brassica napes <220>

<221> CDS
<222> (2)..(499) <223> Canola A
<400> 51 g gca ttg gat tct gat gat gtt gag ttt gtg aag ttg ctt ttg act gag 49 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu tca gat atc act cta gat gaa gcc aat ggt ctt cat tac tca gtg gtg 97 Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val tat agt gat ccc aaa gtt gtt gcc gag att ctt act ctt gat atg ggt 145 Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly gat gtc aac cac aga aac tca cgt ggc tac acg gtt ctt cat ctc gca 193 Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala gcc atg cgc aaa gag ccg tcc atc atc ata tct ctt ctc aag aga ggt 241 Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly gcc aat gcg tct ggc ttc acg tgt gat gga cgc agt gcg gtt aat ata 289 Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile tgt aga aga ttg aca act cca aag gat tat cat acg aaa aca get gcg 337 Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala aaa ggg agg gaa get agt aaa gca cgg tta tgt ata gat ctc ttg gaa 385 Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu aga gaa gta agg agg aac cct atg gtt gtt gat tca cca atg tgt tcc 433 Arg Glu Val Arg Arg Asn Pro Met Val Val Asp Ser Pro Met Cys Ser ctt tct atg cct gaa gat ctc caa atg aga ctg tta tac ctt gaa aat 481 Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn cga gtt ggc ctt get caa ct Arg Val Gly Leu Ala Gln <210> 52 <211> 166 <212> PRT
<213> Brassica napus <400> 52 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Arg Gly Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg Glu Val Arg Arg Asn Pro Met Val Val Asp Ser Pro Met Cys Ser Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 53 <211> 501 <212> DNA
<213> Brassica napus <220>
<221> CDS
<222> (2)..(499) <223> Canola B
<400> 53 g gca ttg gat tct gat gat gtt gag ttt gtg aag ctt ctt ttg acc gag 49 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu tca gat atc act cta gat gaa gcc aat ggt ctt cat tac tca gtg gtg 97 Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val tat agt gat ccc aaa gtt gtt gcc gag att ctt act ctt gat atg ggt 145 Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly gat gtt aac cac aga aac tca cgt ggc tac acg gtt ctg cat ctc gca 193 Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala gcc atg cgc aaa gag ccg tcc atc atc ata tct ctt ctc aag aaa ggt 241 Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Lys Gly -54~

WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 gccaat gcgtctggc ttcacctgt gatgga cgcagtgcggtt aatata 289 AlaAsn AlaSerGly PheThrCys AspGly ArgSerAlaVal AsnIle tgtaga agattgaca actccaaag gattat catactaaaaca getgcg 337 CysArg ArgLeuThr ThrProLys AspTyr HisThrLysThr AlaAla aaaggg agggaaget agtaaagca cggtta tgtatagatctc ttggaa 385 LysGly ArgGluAla SerLysAla ArgLeu CysIleAspLeu LeuGlu agagaa gtaaggagg aaccctatg gttgtt gagtcaccaatg tgttct 433 ArgGlu ValArgArg AsnProMet ValVal GluSerProMet CysSer ctttct atgcctgaa gatctccaa atgaga ctgttatacctt gaaaat 481 LeuSer MetProGlu AspLeuGln MetArg LeuLeuTyrLeu GluAsn cgagtt ggcctgget caact 501 ArgVal GlyLeuAla Gln <210> 54 <211> 166 <212> PRT
<213> Brassica napus <400> 54 Ala Leu Asp Ser Asp Asp Val Glu Phe Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Thr Leu Asp Met Gly Asp Val Asn His Arg Asn Ser Arg Gly Tyr Thr Val Leu His Leu Ala Ala Met Arg Lys Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Lys Gly Ala Asn Ala Ser Gly Phe Thr Cys Asp Gly Arg Ser Ala Val Asn Ile Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ala Ala Lys Gly Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg Glu Val Arg Arg Asn Pro Met Val Val Glu Ser Pro Met Cys Ser Leu Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Arg Val Gly Leu Ala Gln <210> 55 <211> 498 <212> DNA
<213> Brassica napus <220>
<221> CDS
<222> (2)..(496) <223> Canola C
<400> 55 g gca ctg gat tct gat gat gtt gag ctt gtg aag ctt ctt ttg acc gag 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu tca gat atc act cta gat gaa gcc aat ggt ctg cat tac tca gtg gtg 97 Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val tat agt gat ccc aaa gtt gtt gca gag ata ctt gcc ctt ggt tta ggt 145 Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Ala Leu Gly Leu Gly gat gtc aat cac aga aac tca cgt ggc tac tcg gtt ctt cat ttc get 193 Asp Val Asn His Arg Asn Ser Arg Gly Tyr Ser Val Leu His Phe Ala gcc atg cgt aga gag cct tcc atc atc ata tct ctt ctc aag gaa ggc 241 Ala Met Arg Arg Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly gcc aat gcg tct agc ttc act ttt gat gga cgc agt gcg gtt aat ata 289 Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile tgt agg aga ctg aca act cca aag gat tat cat aca aag aca tcc aaa 337 Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ser Lys aag agg gaa get agt aaa gca agg ctg tgc ata gat ctc ttg gaa aga 385 Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg gag gtt agg agg aac cct atg ctt get gat acg cca atg tgt tca ctt 433 Glu Val Arg Arg Asn Pro Met Leu Ala Asp Thr Pro Met Cys Ser Leu act atg cct gaa gat ctc caa atg aga ctg tta tac ctt gaa aat cga 481 Thr Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn Arg gtt ggt ctt get aaa ct Val Gly Leu Ala Lys WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <210> 56 <211> 165 <212> PRT
<213> Brassica napus <400> 56 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Glu Ala Asn Gly Leu His Tyr Ser Val Val Tyr Ser Asp Pro Lys Val Val Ala Glu Ile Leu Ala Leu Gly Leu Gly Asp Val Asn His Arg Asn Ser Arg Gly Tyr Ser Val Leu His Phe Ala Ala Met Arg Arg Glu Pro Ser Ile Ile Ile Ser Leu Leu Lys Glu Gly Ala Asn Ala Ser Ser Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile Cys Arg Arg Leu Thr Thr Pro Lys Asp Tyr His Thr Lys Thr Ser Lys Lys Arg Glu Ala Ser Lys Ala Arg Leu Cys Ile Asp Leu Leu Glu Arg Glu Val Arg Arg Asn Pro Met Leu Ala Asp Thr Pro Met Cys Ser Leu Thr Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Lys <210> 57 <211> 498 <212> DNA
<213> Brassica napus <220>
<221> CDS
<222> (2)..(496) <223> Canola D
<400> 57 g gca ctg gac tct gat gat gtt gag ctt gtc aag atg ctt ttg aca gaa 49 Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Thr Glu gga cac acg agt cta gac gac gcc tac get ctt cac tac get gtt gca 97 Gly His Thr Ser Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala cat tcc gat gtg aag acg gcc tct gat ctc ata gac ctt gag ctt gcg 145 WO CA 02365968 pCT/EP00/01978 HisSer AspValLys ThrAlaSer AspLeu IleAspLeu GluLeuAla gatgtt gaccataga aacctgagg gggtac acggcgctt cacgttget 193 AspVal AspHisArg AsnLeuArg GlyTyr ThrAlaLeu HisValAla gcgatg aggaacgag ccgaagctg atggtt tatttattg actaaaggt 241 AlaMet ArgAsnGlu ProLysLeu MetVal TyrLeuLeu ThrLysGly gcgaat gcgtcggag acaacgttt gacggt agaacgget cttgtgatt 289 AlaAsn AlaSerGlu ThrThrPhe AspGly ArgThrAla LeuValIle gcaaaa agactcact aaagettct gagtat aatgetagt acggagcaa 337 AlaLys ArgLeuThr LysAlaSer GluTyr AsnAlaSer ThrGluGln gggaag ccttctctg aaaggaggg ctatgc atagaggta ctagagcat 385 GlyLys ProSerLeu LysGlyGly LeuCys IleGluVal LeuGluHis gcgcgg aaactaggt aggttgcct agagat ggtttacct tctcttcca 433 AlaArg LysLeuGly ArgLeuPro ArgAsp GlyLeuPro SerLeuPro getact cctgatgaa ctgaggatg aggttg ctctacctt gaaaatcga 481 AlaThr ProAspGlu LeuArgMet ArgLeu LeuTyrLeu GluAsnArg gttggc ctggetcaa ct 498 ValGly LeuAlaGln <210>

<211>

<212>
PRT

<213>
Brassica napus <400>

Ala Leu SerAsp AspVal GluLeuVal LysMetLeu LeuThrGlu Asp Gly His SerLeu AspAsp AlaTyrAla LeuHisTyr AlaValAla Thr His Ser ValLys ThrAla SerAspLeu IleAspLeu GluLeuAla Asp Asp Val HisArg AsnLeu ArgGlyTyr ThrAlaLeu HisValAla Asp Ala Met AsnGlu ProLys LeuMetVal TyrLeuLeu ThrLysGly Arg Ala Asn SerGlu ThrThr PheAspGly ArgThrAla LeuValIle Ala Ala Lys LeuThr LysAla SerGluTyr AsnAlaSer ThrGluGln Arg WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 Gly Lys Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His Ala Arg Lys Leu Gly Arg Leu Pro Arg Asp Gly Leu Pro Ser Leu Pro Ala Thr Pro Asp Glu Leu Arg Met Arg Leu Leu Tyr Leu Glu Asn Arg Val Gly Leu Ala Gln <210> 59 <211> 31 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 59 tagatgawgc mtaygctcty caytatgctg t 31 <210> 60 <211> 32 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: PCR primer NIM

<400> 60 ggctcyttmc kcatggcagc aayrtgaags ac 32 <210> 61 <211> 148 <212> DNA
<213> Lycopersicon esculentum <220>
<221> CDS
<222> (4)..(147) <223> Tomato B
<400> 61 tag atg atg cat atg ctc ttc att atg ctg ttg cat att gtg acc cca 48 Met Met His Met Leu Phe Ile Met Leu Leu His Ile Val Thr Pro agg ttg ttg ctg agg ttc ttg gac tgg gtg ttg cta atg tca acc ttc 96 Arg Leu Leu Leu Arg Phe Leu Asp Trp Val Leu Leu Met Ser Thr Phe WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 gga atg cac gtg gtt aca ctg tcc ttc acg ttg ctg cca tgc gga aag 144 Gly Met His Val Val Thr Leu Ser Phe Thr Leu Leu Pro Cys Gly Lys agc c 148 Ser <210>

<211>

<212>
PRT

<213>
Lycopersicon esculentum <400>

Met Met Met Leu Phe Ile LeuLeu His Ile ThrPro Arg His Met Val Leu Leu Arg Phe Leu Asp ValLeu Leu Met ThrPhe Gly Leu Trp Ser Met His Val Thr Leu Ser ThrLeu Leu Pro GlyLys Ser Val Phe Cys <210> 63 <211> 2296 <212> DNA
<213> Beta vulgaris <220>
<221> CDS
<222> (113)..(1927) <223> full-length Sugarbeet cDNA sequence <400> 63 cacacacaca cccgacgccg tatgcgtatc cattctctct cctcaacctc cctttgactt 60 cctcttactc caccatcttc aatgtcgtcg atttccaatc tctaacattc ac atg aca 118 Met Thr acc acc tcc aca aca atg gtg atc gat tct cgc acc get ttc tcc gat 166 Thr Thr Ser Thr Thr Met Val Ile Asp Ser Arg Thr Ala Phe Ser Asp tcc aac gac atc agc aat ggc agt agc atc tgc tgc gtc gcc gca aca 214 Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Val Ala Ala Thr aca act aca aca aca acc gcc gca gaa aac tct ctc tcc ttt act ccc 262 Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe Thr Pro gac gcc gcc get ctt ctc cgc ctc tct gaa aac ctc gac tcg ctt ttc 310 Asp Ala Ala Ala Leu Leu Arg Leu Ser Glu Asn Leu Asp Ser Leu Phe caa ccc tcg ctt tct ctc tcc gac tcc gac tct ttc gcc gac get aaa 358 Gln Pro Ser Leu Ser Leu Ser Asp Ser Asp Ser Phe Ala Asp Ala Lys WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 atc gtc gtt tcc ggt gat tcg cgt gaa gtc gcc gtt cat cgg tgt gtt 406 Ile Val Val Ser Gly Asp Ser Arg Glu Val Ala Val His Arg Cys Val ctc tcg tct cgg agc tcg ttc ttt cgg tcc get ttt get tcg aaa cga 454 Leu Ser Ser Arg Ser Ser Phe Phe Arg Ser Ala Phe Ala Ser Lys Arg gag aag gag aag gag agg gat aaa gag aga gtg gtg aag ctt gag ctt 502 Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Val Val Lys Leu Glu Leu aaggatttaget ggtgat tttgaggtt ggatttgat tcggttgtt gcg 550 LysAspLeuAla GlyAsp PheGluVal GlyPheAsp SerValVal Ala gttttaggttat ttgtat agtggcaaa gttaggaat ttgcctaga gga 598 ValLeuGlyTyr LeuTyr SerGlyLys ValArgAsn LeuProArg Gly atttgtgtttgt gttgat gaggattgc tctcatgaa gettgtcgt cct 646 IleCysValCys ValAsp GluAspCys SerHisGlu AlaCysArg Pro getgttgatttt gttgtt gaggttctc tatttgtct cacaaattc gag 694 AlaValAspPhe ValVal GluValLeu TyrLeuSer HisLysPhe Glu attgtcgaattg gtttcg ctttatcag aggcaccta ctggatatt ctt 742 IleValGluLeu ValSer LeuTyrGln ArgHisLeu LeuAspIle Leu gacaagattgca ccagat gacgttcta gtagtgtta tctgtcget gag 790 AspLysIleAla ProAsp AspValLeu ValValLeu SerValAla Glu atgtgtggaaat gcgtgt gacggattg ctggcaagg tgtattgac aag 838 MetCysGlyAsn AlaCys AspGlyLeu LeuAlaArg CysIleAsp Lys attgtgaggtcc gatatt gacgtaacc accattgat aaatccttg ccg 886 IleValArgSer AspIle AspValThr ThrIleAsp LysSerLeu Pro cagaatgttgtg aaacag ataatcgac acgcgaaag gaacttggg ttt 934 GlnAsnValVal LysGln IleIleAsp ThrArgLys GluLeuGly Phe actgaacctggg cgtgtt gagtttcct gataagcat gtgaagaga ata 982 ThrGluProGly ArgVal GluPhePro AspLysHis ValLysArg Ile cacagagetttg gaatcc gatgatgta gagttagtc agaatgctt tta 1030 HisArgAlaLeu GluSer AspAspVal GluLeuVal ArgMetLeu Leu aaagagcgccat acaact ctagatgat gcatatgcc cttcactat get 1078 LysGluArgHis ThrThr LeuAspAsp AlaTyrAla LeuHisTyr Ala WO 00/53762 CA 02365968 2001-09-06 pCT/EP00/01978 gtggca cattgtgat gccaagacc accacg gagcttctt gagcttggg 1126 ValAla HisCysAsp AlaLysThr ThrThr GluLeuLeu GluLeuGly cttgca gatgttaat cttagaaat ctaagg ggtcacact gtgctacat 1174 LeuAla AspValAsn LeuArgAsn LeuArg GlyHisThr ValLeuHis gtggca gccatgaga aaagagcct aagata attgtatcc ttgttaacc 1222 ValAla AlaMetArg LysGluPro LysIle IleValSer LeuLeuThr aaggga gcccatccg tctgatata acatca gatgataaa aaagcactg 1270 LysGly AlaHisPro SerAspIle ThrSer AspAspLys LysAlaLeu cagata gcaaagaga ctaacaaaa getgtg gacttctat aaaactaca 1318 GlnIle AlaLysArg LeuThrLys AlaVal AspPheTyr LysThrThr gaacaa ggaaaagat gcaccaaag gatcgg ttgtgcatt gaaatactg 1366 GluGln GlyLysAsp AlaProLys AspArg LeuCysIle GluIleLeu gagcaa getgaaaga agagaacca ttgcta ggagaaggt tctgtttct 1414 GluGln AlaGluArg ArgGluPro LeuLeu GlyGluGly SerValSer cttgca aaggcagga gatgatctg cgtatg aagctatta tatcttgaa 1462 LeuAla LysAlaGly AspAspLeu ArgMet LysLeuLeu TyrLeuGlu aataga gttgcactt getcggttg ctcttt ccaatggaa gcgaaagtg 1510 AsnArg ValAlaLeu AlaArgLeu LeuPhe ProMetGlu AlaLysVal getatg gatattget caagtggac ggaact tctgaattc acattgtca 1558 AlaMet AspIleAla GlnVa1Asp GlyThr SerGluPhe ThrLeuSer aagaat atagetgat gcacgaaga aatgcg gtggacttg aatgagget 1606 LysAsn IleAlaAsp AlaArgArg AsnAla ValAspLeu AsnGluAla cccttt atattgaaa gaggagcat ttgcag aggatgaaa gcactgtct 1654 ProPhe IleLeuLys GluGluHis LeuGln ArgMetLys AlaLeuSer aaaact gttgagctt ggcaagcgt ttcttt ccacgctgc tccgatgtt 1702 LysThr ValGluLeu GlyLysArg PhePhe ProArgCys SerAspVal cttaat aagattatg gacgccgaa gatcta tcacagctt gcattttta 1750 LeuAsn LysIleMet AspAlaGlu AspLeu SerGlnLeu AlaPheLeu ggaaaa gatactcca gaggaacgg caaagg aagagaaaa cgatacctt 1798 GlyLys AspThrPro GluGluArg GlnArg LysArgLys ArgTyrLeu gaa ctg caa gac get tta act aag get ttt aca gag gac aaa gaa gag 1846 Glu Leu Gln Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu ttt gac cgt tct aca tta tca tca tcg tcg tcg tcg act cca atg ggg 1894 Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr Pro Met Gly agg cca tat ggt aag acc aat ttc aag agg taa ctccttagca gctcaaagtt 1947 Arg Pro Tyr Gly Lys Thr Asn Phe Lys Arg gcatacgacg tcacttgtat aatattcatg tatatgtatg aaaatttctt tttgttctcc 2007 ccttctattg atggccacgg tttcgatctt tttggtctgt attataattt ttgaccgatt 2067 acttgataga attgtattct atacatcttt ataagctcat agtaacacca gatttaggta 2127 ctatccgttg gagacacata ctcttgtgtg cgatgatgaa tcaatcatca gattacatta 2187 cacgagccat ttcctgccat attgtaattc atgtatcaag gtacaaataa atagcgtcgt 2247 ggggttgcac ctcttgcatt atcgaaaaaa aaaaaaaaaa aaaaaaaaa 2296 <210> 64 <211> 604 <212> PRT
<213> Beta wlgaris <400> 64 Met Thr Thr Thr Ser Thr Thr Met Val Ile Asp Ser Arg Thr Ala Phe Ser Asp Ser Asn Asp Ile Ser Asn Gly Ser Ser Ile Cys Cys Val Ala Ala Thr Thr Thr Thr Thr Thr Thr Ala Ala Glu Asn Ser Leu Ser Phe Thr Pro Asp Ala Ala Ala Leu Leu Arg Leu Ser Glu Asn Leu Asp Ser Leu Phe Gln Pro Ser Leu Ser Leu Ser Asp Ser Asp Ser Phe Ala Asp Ala Lys Ile Val Val Ser Gly Asp Ser Arg Glu Val Ala Val His Arg Cys Val Leu Ser Ser Arg Ser Ser Phe Phe Arg Ser Ala Phe Ala Ser Lys Arg Glu Lys Glu Lys Glu Arg Asp Lys Glu Arg Val Val Lys Leu Glu Leu Lys Asp Leu Ala Gly Asp Phe Glu Val Gly Phe Asp Ser Val Val Ala Val Leu Gly Tyr Leu Tyr Ser Gly Lys Val Arg Asn Leu Pro Arg Gly Ile Cys Val Cys Val Asp Glu Asp Cys Ser His Glu Ala Cys Arg Pro Ala Val Asp Phe Val Val Glu Val Leu Tyr Leu Ser His Lys Phe Glu Ile Val Glu Leu Val Ser Leu Tyr Gln Arg His Leu Leu Asp Ile Leu Asp Lys Ile Ala Pro Asp Asp Val Leu Val Val Leu Ser Val Ala Glu Met Cys Gly Asn Ala Cys Asp Gly Leu Leu Ala Arg Cys Ile Asp Lys Ile Val Arg Ser Asp Ile Asp Val Thr Thr Ile Asp Lys Ser Leu Pro Gln Asn Val Val Lys Gln Ile Ile Asp Thr Arg Lys Glu Leu Gly Phe Thr Glu Pro Gly Arg Val Glu Phe Pro Asp Lys His Val Lys Arg Ile His Arg Ala Leu Glu Ser Asp Asp Val Glu Leu Val Arg Met Leu Leu Lys Glu Arg His Thr Thr Leu Asp Asp Ala Tyr Ala Leu His Tyr Ala Val Ala His Cys Asp Ala Lys Thr Thr Thr Glu Leu Leu Glu Leu Gly Leu Ala Asp Val Asn Leu Arg Asn Leu Arg Gly His Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Ile Ile Val Ser Leu Leu Thr Lys Gly Ala His Pro Ser Asp Ile Thr Ser Asp Asp Lys Lys Ala Leu Gln Ile Ala Lys Arg Leu Thr Lys Ala Val Asp Phe Tyr Lys Thr Thr Glu Gln Gly Lys Asp Ala Pro Lys Asp Arg Leu Cys Ile Glu Ile Leu Glu Gln Ala Glu Arg Arg Glu Pro Leu Leu Gly Glu Gly Ser Val Ser Leu Ala Lys Ala Gly Asp Asp Leu Arg Met Lys Leu Leu Tyr Leu Glu Asn Arg Val Ala Leu Ala Arg Leu Leu Phe Pro Met Glu Ala Lys Val Ala Met Asp Ile Ala Gln Val Asp Gly Thr Ser Glu Phe Thr Leu Ser Lys Asn Ile Ala Asp Ala Arg Arg Asn Ala Val Asp Leu Asn Glu Ala Pro Phe Ile Leu Lys Glu Glu His Leu Gln Arg Met Lys Ala Leu Ser Lys Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Asp Val Leu Asn Lys Ile Met Asp Ala Glu Asp Leu Ser Gln Leu Ala Phe Leu Gly Lys Asp Thr Pro Glu Glu Arg Gln Arg Lys Arg Lys Arg Tyr Leu Glu Leu Gln Asp Ala Leu Thr Lys Ala Phe Thr Glu Asp Lys Glu Glu Phe Asp Arg Ser Thr Leu Ser Ser Ser Ser Ser Ser Thr Pro Met Gly Arg Pro Tyr Gly Lys Thr Asn Phe Lys Arg <210> 65 <211> 2844 <212> DNA
<213> Helianthus annuus <220>
<221> CDS
<222> (737)..(2512) <223> full-length Sunflower B cDNA sequence <400> 65 gacgataaaa cccctctctc tttttgctac caagaacctt cctactttct tgcaccaaag 60 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tttctttgca ggttctttga agcttcttta tcatcatacg ttggtttgat attgtttttg 120 atgcatcttt tcacatgggt tttgcttatt gagtgattat ctgttgtggg tatttgatac 180 aaattgaaaa aaagatgatt agatttggta tttagggttt tggttattga agattttatt 240 aattagggtt tgattagggt ttgattaaga ttcttgtatt ggatgggttg atttagatcc 300 agctgtttgt gggtttcaaa tttttgtttt ggtatttgca tatctcattc taatctattc 360 agaggttgag gttctttagg tttgactttg actttgactt ttgggtactt tcttgtacat 420 gtataatgtt tgatttgatc cattatatgt gttttgtaat tgaatcatag caaattttct 480 tgcctgtata tatatgtttt attgaggatt tggttcaagt tttgaccttt ttgggaaaaa 540 aagtcaaaca catattcttg ttcatgtagt tttgcaaatc aatcatttca caaatctttc 600 tttatgttgg gaatccatct caatcataaa aaagtttctt tctttctttg agttcttgtt 660 agctatgaaa gtttatgatt tgtccttttt gtgataaagt caaaccccta atcatcctgg 720 gactttgact aaatcg atg gcg aat tca tcc gaa ccg tca tca tcc ata agc 772 Met Ala Asn Ser Ser Glu Pro Ser Ser Ser Ile Ser ttc acc tca tct tca cac ata tct aac ggc gca act agc tac aac ata 820 Phe Thr Ser Ser Ser His Ile Ser Asn Gly Ala Thr Ser Tyr Asn Ile ccc cca cca tca atc ccc gag cca cgg tcg aat att gaa atc att ggc 868 Pro Pro Pro Ser Ile Pro Glu Pro Arg Ser Asn Ile Glu Ile Ile Gly tta aat aga ctc agc aca aac cta gag aag ctc gta ttc gat tca ggt 916 Leu Asn Arg Leu Ser Thr Asn Leu Glu Lys Leu Val Phe Asp Ser Gly tct gaa tct gat tgc aat tac agc gat get gaa gtt gtt gtt gag ggt 964 Ser Glu Ser Asp Cys Asn Tyr Ser Asp Ala Glu Val Val Val Glu Gly att tct gta ggc att cat cgg tgt att tta gcc act aga agt acg ttt 1012 Ile Ser Val Gly Ile His Arg Cys Ile Leu Ala Thr Arg Ser Thr Phe ttt agc gat ttg ttt aag aag aac aaa ggt tgt gta gag aag gac agt 1060 Phe Ser Asp Leu Phe Lys Lys Asn Lys Gly Cys Val Glu Lys Asp Ser aag ccg aaa tat aac atg agt gat ttg ttg ccg tat ggg agc gtt ggg 1108 Lys Pro Lys Tyr Asn Met Ser Asp Leu Leu Pro Tyr Gly Ser Val Gly tat gat gcg ttt ctc gtg ttt tta agc tat gtt tat act ggg aaa ctg 1156 Tyr Asp Ala Phe Leu Val Phe Leu Ser Tyr Val Tyr Thr Gly Lys Leu aaa gcg tct cct ccg gag gtt tca acc tgc gtt gat gat ggg tgt ctt 1204 Lys Ala Ser Pro Pro Glu Val Ser Thr Cys Val Asp Asp Gly Cys Leu WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 catgat gettgt tggcctget attaacttt getgttgag ttgacttat 1252 HisAsp AlaCys TrpProAla IleAsnPhe AlaValGlu LeuThrTyr gcgtct tcggtt tttcaagtt ccggaatta gtttcgctt tttcagcgt 1300 AlaSer SerVal PheGlnVal ProGluLeu ValSerLeu PheGlnArg cgtctt ctcaac tttgtggac aaggetctt gttgaagac gtgatcccg 1348 ArgLeu LeuAsn PheValAsp LysAlaLeu ValGluAsp ValIlePro atcctt gttgtg gcctttcac tgtcagttg caaaacgtc ttatctcgt 1396 IleLeu ValVal AlaPheHis CysGlnLeu GlnAsnVal LeuSerArg tgcatt gaccga gtagttagg tcaaagctc gatactatt tccattgaa 1444 CysIle AspArg ValValArg SerLysLeu AspThrIle SerIleGlu aaagag cttcca tttgaagtc acccaaatg atcaaatcc attgataac 1492 LysGlu LeuPro PheGluVal ThrGlnMet IleLysSer IleAspAsn atcatc caagaa gatgacgaa catacagtc gaatcagaa gtcgtgtta 1540 IleIle GlnGlu AspAspGlu HisThrVal GluSerGlu ValValLeu cgtgaa aagaga attaaaagc atacacaaa gcattagac tgtgacgat 1588 ArgGlu LysArg IleLysSer IleHisLys AlaLeuAsp CysAspAsp gttgag cttgtg aaaatgatt ttagacgaa tccaaaatc acgttagat 1636 ValGlu LeuVal LysMetIle LeuAspGlu SerLysIle ThrLeuAsp gaagcc tgcget cttcattat gcggtcatg tattgtaat caagaagtt 1684 GluAla CysAla LeuHisTyr AlaValMet TyrCysAsn GlnGluVal getaag gagatt cttaactta aaccgtgcg gatgttaat cttagaaac 1732 AlaLys GluIle LeuAsnLeu AsnArgAla AspValAsn LeuArgAsn tcacga gattac accgtgctt catgttget gccatgcgt aaagaacca 1780 SerArg AspTyr ThrValLeu HisValAla AlaMetArg LysGluPro tcactt attgtt tcgattcta agcaaaggc gcgtgtgca tcggatact 1828 SerLeu IleVal SerIleLeu SerLysGly AlaCysAla SerAspThr actttt gatgga caaagtgcg gttagtatt tgcaggaga cgaacaagg 1876 ThrPhe AspGly GlnSerAla ValSerIle CysArgArg ArgThrArg cccaag gattat tatgtgaaa accgaacac gggcaagaa acaaataaa 1924 ProLys AspTyr TyrValLys ThrGluHis GlyGlnGlu ThrAsnLys WO CA 02365968 2001-09-06 pCT~P00/01978 gatcgtatatgc atcgat gttttggag cgggaaata aagaggaat ccg 1972 AspArgIleCys IleAsp ValLeuGlu ArgGluIle LysArgAsn Pro atgataggcgat gtttcc gtgtgttct tcagcagtg getgatgat ttg 2020 MetIleGlyAsp ValSer ValCysSer SerAlaVal AlaAspAsp Leu catatgaattta ctctac ttagaaaac cgagtggca tttgetcga ctg 2068 HisMetAsnLeu LeuTyr LeuGluAsn ArgValAla PheAlaArg Leu ttatttccgtca gaagcg aaactagca atggaaatt gcgcatgcc caa 2116 LeuPheProSer GluAla LysLeuAla MetGluIle AlaHisAla Gln acgactgcacag tatccg ggtctattg gcatcgaaa gggtcaaat ggt 2164 ThrThrAlaGln TyrPro GlyLeuLeu AlaSerLys GlySerAsn Gly aacttaagggag atggat ttgaacgag acaccgttg gtgcagaac aaa 2212 AsnLeuArgGlu MetAsp LeuAsnGlu ThrProLeu ValGlnAsn Lys agattgctttca agaatg gaagccctt tcccggaca gtggaaatg ggt 2260 ArgLeuLeuSer ArgMet GluAlaLeu SerArgThr ValGluMet Gly aggcgatatttc cctcat tgttcagag gttctggat aagttcatg gag 2308 ArgArgTyrPhe ProHis CysSerGlu ValLeuAsp LysPheMet Glu gacgatctacag gatctt tttatcctc gagaagggt accgaagaa gaa 2356 AspAspLeuGln AspLeu PheIleLeu GluLysGly ThrGluGlu Glu caagaaatcaaa aggacg cgatttatg gagcttaaa gaagatgtc caa 2404 GlnGluIleLys ArgThr ArgPheMet GluLeuLys GluAspVal Gln agagcctttacc aaggac aaggccgag cttcatcgc ggtttgtcc tca 2452 ArgAlaPheThr LysAsp LysAlaGlu LeuHisArg GlyLeuSer Ser tcaatgtacacc cccaca gtgagaaac gggtcaaag agtaaagcc cgc 2500 SerMetTyrThr ProThr ValArgAsn GlySerLys SerLysAla Arg aaatactcatga aacccccgtg tttctttgat ttta 2552 gatcttttaa cacgct LysTyrSer cgtgcctaat attagaggca aaacatatgt atgaagaaat aatggtggtg catgatgatg 2612 tttagggctc aggtttaggg tttatatgta ctaaattttg tgatttgacg ctaaaaatgc 2672 tatgttgttt tttttttttt ttggataata tggtgtgaaa gctaacgcct tttactagta 2732 gcatgttaat gtttgtgttt gaatcatagt tttttatgca tgtttgtttt acttgcacaa 2792 caactaataa atataatttt tcataataaa aaaaaaaaaa aaaaaaaaaa as 2844 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <210> 66 <211> 591 <212> PRT
<213> Helianthus annuus <400> 66 Met Ala Asn Ser Ser Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser Ser His Ile Ser Asn Gly Ala Thr Ser Tyr Asn Ile Pro Pro Pro Ser Ile Pro Glu Pro Arg Ser Asn Ile Glu Ile Ile Gly Leu Asn Arg Leu Ser Thr Asn Leu Glu Lys Leu Val Phe Asp Ser Gly Ser Glu Ser Asp Cys Asn Tyr Ser Asp Ala Glu Val Val Val Glu Gly Ile Ser Val Gly Ile His Arg Cys Ile Leu Ala Thr Arg Ser Thr Phe Phe Ser Asp Leu Phe Lys Lys Asn Lys Gly Cys Val Glu Lys Asp Ser Lys Pro Lys Tyr Asn Met Ser Asp Leu Leu Pro Tyr Gly Ser Val Gly Tyr Asp Ala Phe Leu Val Phe Leu Ser Tyr Val Tyr Thr Gly Lys Leu Lys Ala Ser Pro Pro Glu Val Ser Thr Cys Val Asp Asp Gly Cys Leu His Asp Ala Cys Trp Pro Ala Ile Asn Phe Ala Val Glu Leu Thr Tyr Ala Ser Ser Val Phe Gln Val Pro Glu Leu Val Ser Leu Phe Gln Arg Arg Leu Leu Asn Phe Val Asp Lys Ala Leu Val Glu Asp Val Ile Pro Ile Leu Val Val Ala Phe His Cys Gln Leu Gln Asn Val Leu Ser Arg Cys Ile Asp Arg Val Val Arg Ser Lys Leu Asp Thr Ile Ser Ile Glu Lys Glu Leu Pro Phe Glu Val Thr Gln Met Ile Lys Ser Ile Asp Asn Ile Ile Gln Glu Asp Asp Glu His Thr Val Glu Ser Glu Val Val Leu Arg Glu Lys Arg Ile Lys Ser Ile His Lys Ala Leu Asp Cys Asp Asp Val Glu Leu Val Lys Met Ile Leu Asp Glu Ser Lys Ile Thr Leu Asp Glu Ala Cys Ala Leu His Tyr Ala Val Met Tyr Cys Asn Gln Glu Val Ala Lys Glu Ile Leu Asn Leu Asn Arg Ala Asp Val Asn Leu Arg Asn Ser Arg Asp Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Ser Leu Ile Val Ser Ile Leu Ser Lys Gly Ala Cys Ala Ser Asp Thr Thr Phe Asp Gly Gln Ser Ala Val Ser Ile Cys Arg Arg Arg Thr Arg Pro Lys Asp Tyr Tyr Val Lys Thr Glu His Gly Gln Glu Thr Asn Lys Asp Arg Ile Cys Ile Asp Val Leu Glu Arg Glu Ile Lys Arg Asn Pro Met Ile Gly Asp Val Ser Val Cys Ser Ser Ala Val Ala Asp Asp Leu His Met Asn Leu WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Leu Tyr Leu Glu Asn Arg Val Ala Phe Ala Arg Leu Leu Phe Pro Ser Glu Ala Lys Leu Ala Met Glu Ile Ala His Ala Gln Thr Thr Ala Gln Tyr Pro Gly Leu Leu Ala Ser Lys Gly Ser Asn Gly Asn Leu Arg Glu Met Asp Leu Asn Glu Thr Pro Leu Val Gln Asn Lys Arg Leu Leu Ser Arg Met Glu Ala Leu Ser Arg Thr Val Glu Met Gly Arg Arg Tyr Phe Pro His Cys Ser Glu Val Leu Asp Lys Phe Met Glu Asp Asp Leu Gln Asp Leu Phe Ile Leu Glu Lys Gly Thr Glu Glu Glu Gln Glu Ile Lys Arg Thr Arg Phe Met Glu Leu Lys Glu Asp Val Gln Arg Ala Phe Thr Lys Asp Lys Ala Glu Leu His Arg Gly Leu Ser Ser Ser Met Tyr Thr Pro Thr Val Arg Asn Gly Ser Lys Ser Lys Ala Arg Lys Tyr Ser <210> 67 <211> 1477 <212> DNA

<213> Arabidopsis haliana t <220>

<221> CDS

<222> (1)..(804) <223> AtNMLc2 sequence cDNA

<220>

<221> misc_feature <222> (1)..(1477) <223> n = c r a, t, o g <400> 67 atg agc aat gaagaa tctttgaga tctctatcg ttggat ttcctg 48 ctt Met Ser Asn GluGlu SerLeuArg SerLeuSer LeuAsp PheLeu Leu aac cta cta aacggt caagetttc tccgacgtg actttc agcgtt 96 atc Asn Leu Leu AsnGly GlnAlaPhe SerAspVal ThrPhe SerVal Ile gaa ggt cgt gtccac getcaccgt tgtatcctc gccgca cggagg 144 tta Glu Gly Arg ValHis AlaHisArg CysIleLeu AlaAla ArgArg Leu ctt ttc ttc aaattc ttttgtggg acagactca ccacaa cctgtc 192 cgc Leu Phe Phe LysPhe PheCysGly ThrAspSer ProGln ProVal Arg aca ggt ata ccgacc caacatggg tccgtaccc getagc ccaaca 240 gac Thr Gly Ile ProThr GlnHisGly SerValPro AlaSer ProThr Asp aga ggc tcc acg gcc cca get gga att ata cca gtg aac tca gtc ggt 288 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 ArgGly SerThrAla ProAlaGly IleIlePro ValAsn SerValGly tatgag gtttttctg ttgctactt cagtttctt tatagc ggacaagtc 336 TyrGlu ValPheLeu LeuLeuLeu GlnPheLeu TyrSer GlyGlnVal tccatc gtgccgcag aaacacgag cctagacct aattgt ggcgagaga 384 SerIle ValProGln LysHisGlu ProArgPro AsnCys GlyGluArg ggatgt tggcacact cattgctca gccgccgtt gatctt getcttgat 432 GlyCys TrpHisThr HisCysSer AlaAlaVal AspLeu AlaLeuAsp actctc gccgcctct cgttacttc ggcgtcgag cagctc gcattgctc 480 ThrLeu AlaAlaSer ArgTyrPhe GlyValGlu GlnLeu AlaLeuLeu acccag aaacaattg gcaagcatg gtggagaaa gcctct atcgaagat 528 ThrGln LysGlnLeu AlaSerMet ValGluLys AlaSer IleGluAsp gtgatg aaagtttta atagcatca agaaagcaa gacatg catcaatta 576 ValMet LysValLeu IleAlaSer ArgLysGln AspMet HisGlnLeu tggacc acctgctct cacttagtt getaaatca ggtctc ccaccagag 624 TrpThr ThrCysSer HisLeuVal AlaLysSer GlyLeu ProProGlu attctt gccaagcat ctccctatt gacgtcgtc accaaa atagaagag 672 IleLeu AlaLysHis LeuProIle AspValVal ThrLys IleGluGlu cttcgt cttaaatct tctataget cgccgttct ctaatg cctcacaac 720 LeuArg LeuLysSer SerIleAla ArgArgSer LeuMet ProHisAsn caccac catgatctc agcggngnt caanaccta aagntc aaagttaga 768 HisHis HisAspLeu SerXaaXaa GlnXaaLeu LysXaa LysValArg aggttg agccgactt ggattcttc aacgngaac tagtaaagctgat 814 ArgLeu SerArgLeu GlyPhePhe AsnXaaAsn ggtaatggan aaggactcca ttcttgatga agtcgtaagc attgcattac cgcttgttaa 874 aagctgtaga agagaagttg tgaagncttt ngcttgaagc ttggaagctg ccgatgtgaa 934 ttatccggcg ggtccggcaa ggnaaancac ctttgcactt cgcgggntga gatggtctct 994 ccagacatgg tggctgttct gttagcccnc catgcttgat cctaatgtga ggacagttgg 1054 tggaatcacg cctcttgata tccttagaac attaacttcg gatttcttgt tcaaggggca 1114 gttcctggat tgactcacat tgaaccgaat aaacttaggc tttgcctcga gcttgttcaa 1174 tccgctgcaa tggtgatatc tcgagaagaa ggaaacaata gcaacaacca aaacaatgat 1234 WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 aacaataccg ggatttaccc tcatatgaat gaggagcaca atagtggaag cagtggaggg 1294 agcaataaca atttggattc aagattggtt tatctcaatc ttggagcagg tacgggtcag 1354 atgggtccag gtcgagatca aggggatgac cataacagtc agagggaagg tatgagtcgg 1414 catcatcatc atcatcaaga cccatctaca atgtatcatc accatcatca acatcacttc 1474 tag 1477 <210> 68 <211> 267 <212> PRT
<213> Arabidopsis thaliana <400> 68 Met Ser Asn Leu Glu Glu Ser Leu Arg Ser Leu Ser Leu Asp Phe Leu Asn Leu Leu Ile Asn Gly Gln Ala Phe Ser Asp Val Thr Phe Ser Val Glu Gly Arg Leu Val His Ala His Arg Cys Ile Leu Ala Ala Arg Arg Leu Phe Phe Arg Lys Phe Phe Cys Gly Thr Asp Ser Pro Gln Pro Val Thr Gly Ile Asp Pro Thr Gln His Gly Ser Val Pro Ala Ser Pro Thr Arg Gly Ser Thr Ala Pro Ala Gly Ile Ile Pro Val Asn Ser Val Gly Tyr Glu Val Phe Leu Leu Leu Leu Gln Phe Leu Tyr Ser Gly Gln Val Ser Ile Val Pro Gln Lys His Glu Pro Arg Pro Asn Cys Gly Glu Arg Gly Cys Trp His Thr His Cys Ser Ala Ala Val Asp Leu Ala Leu Asp Thr Leu Ala Ala Ser Arg Tyr Phe Gly Val Glu Gln Leu Ala Leu Leu Thr Gln Lys Gln Leu Ala Ser Met Val Glu Lys Ala Ser Ile Glu Asp Val Met Lys Val Leu Ile Ala Ser Arg Lys Gln Asp Met His Gln Leu Trp Thr Thr Cys Ser His Leu Val Ala Lys Ser Gly Leu Pro Pro Glu Ile Leu Ala Lys His Leu Pro Ile Asp Val Val Thr Lys Ile Glu Glu Leu Arg Leu Lys Ser Ser Ile Ala Arg Arg Ser Leu Met Pro His Asn His His His Asp Leu Ser Xaa Xaa Gln Xaa Leu Lys Xaa Lys Val Arg Arg Leu Ser Arg Leu Gly Phe Phe Asn Xaa Asn <210> 69 <211> 1725 <212> DNA
<213> Arabidopsis thaliana <220>
<221> CDS

WOOU/53762 CA 02365968 2001-09-06 pCT~,P00/01978 <222>
(1)..(1725) <223> cDNA
AtNMLc4-1 sequence <400>

atgget gcaactgca atagagcca tcttcatct ataagtttc acatct 48 MetAla AlaThrAla IleGluPro SerSerSer IleSerPhe ThrSer tctcac ttatcaaac ccttctcct gttgttact acttatcac tcaget 96 SerHis LeuSerAsn ProSerPro ValValThr ThrTyrHis SerAla gccaat cttgaagag ctcagctct aacttggag cagcttctc actaat 144 AlaAsn LeuGluGlu LeuSerSer AsnLeuGlu GlnLeuLeu ThrAsn ccagat tgcgattac actgacgca gagatcatc attgaagaa gaaget 192 ProAsp CysAspTyr ThrAspAla GluIleIle IleGluGlu GluAla aaccct gtgagtgtt catagatgt gttttaget getaggagc aagttt 240 AsnPro ValSerVal HisArgCys ValLeuAla AlaArgSer LysPhe tttctt gatctgttt aagaaagat aaagatagt agtgagaag aaacct 288 PheLeu AspLeuPhe LysLysAsp LysAspSer SerGluLys LysPro aagtat caaatgaaa gatttatta ccatatgga aatgtggga cgtgag 336 LysTyr GlnMetLys AspLeuLeu ProTyrGly AsnValGly ArgGlu gcattt ctgcatttc ttgagctat atctacact gggaggtta aagcct 384 AlaPhe LeuHisPhe LeuSerTyr IleTyrThr GlyArgLeu LysPro tttcct atcgaggtt tcaacttgt gttgattca gtttgtget catgat 432 PhePro IleGluVal SerThrCys ValAspSer ValCysAla HisAsp tcttgt aaaccggcc attgatttt getgttgag ttgatgtat gettca 480 SerCys LysProAla IleAspPhe AlaValGlu LeuMetTyr AlaSer tttgtg ttccaaatc ccggatctt gtttcgtca tttcagcgg aagctt 528 PheVal PheGlnIle ProAspLeu ValSerSer PheGlnArg LysLeu cgtaac tatgttgag aagtcacta gtagagaat gttcttcct atcctc 576 ArgAsn TyrValGlu LysSerLeu ValGluAsn ValLeuPro IleLeu ttagtt gcgtttcat tgtgatttg acacagctt cttgatcaa tgcatt 624 LeuVal AlaPheHis CysAspLeu ThrGlnLeu LeuAspGln CysIle gagaga gtggcgaga tcagactta gacagattc tgtatcgaa aaggag 672 GluArg ValAlaArg SerAspLeu AspArgPhe CysIleGlu LysGlu ctt cct tta gaa gta ttg gaa aaa atc aaa cag ctt cga gtt aag tcg 720 LeuPro LeuGlu ValLeuGlu LysIleLys GlnLeuArg ValLysSer gtgaac ataccc gaggtggag gataaatcg atagagaga acagggaaa 768 ValAsn IlePro GluValGlu AspLysSer IleGluArg ThrGlyLys gtactc aaggca ttggattca gatgatgta gaactcgtg aagcttctt 816 ValLeu LysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu ttgact gagtca gatataact ctagaccaa gccaatggt ctacattat 864 LeuThr GluSer AspIleThr LeuAspGln AlaAsnGly LeuHisTyr gcagtg gcatac agtgatccg aaagttgtg acacaggtt cttgatcta 912 AlaVal AlaTyr SerAspPro LysValVal ThrGlnVal LeuAspLeu gatatg getgat gttaatttc agaaattcc agggggtat acggttctt 960 AspMet AlaAsp ValAsnPhe ArgAsnSer ArgGlyTyr ThrValLeu catatt getget atgcgtaga gagccaaca attatcata ccacttatt 1008 HisIle AlaAla MetArgArg GluProThr IleIleIle ProLeuIle caaaaa ggaget aatgettca gatttcacg tttgatgga cgcagtgcg 1056 GlnLys GlyAla AsnAlaSer AspPheThr PheAspGly ArgSerAla gtaaat atatgt aggagactc actaggccg aaagattat cataccaaa 1104 ValAsn IleCys ArgArgLeu ThrArgPro LysAspTyr HisThrLys acctca aggaaa gaacctagt aaataccgc ttatgcatc gatatcttg 1152 ThrSer ArgLys GluProSer LysTyrArg LeuCysIle AspIleLeu gaaagg gaaatt agaaggaat ccattggtt agtggggat acacccact 1200 GluArg GluIle ArgArgAsn ProLeuVal SerGlyAsp ThrProThr tgttcc cattcg atgcccgag gatctccaa atgaggttg ttatactta 1248 CysSer HisSer MetProGlu AspLeuGln MetArgLeu LeuTyrLeu gaaaag cgagtg ggacttget cagttgttc ttcccagca gaagccaat 1296 GluLys ArgVal GlyLeuAla GlnLeuPhe PheProAla GluAlaAsn gtgget atggac gttgetaat gttgaaggg acaagcgag tgcacaggt 1344 ValAla MetAsp ValAlaAsn ValGluGly ThrSerGlu CysThrGly cttcta actcca cctccatca aatgataca actgaaaac ttgggtaaa 1392 LeuLeu ThrPro ProProSer AsnAspThr ThrGluAsn LeuGlyLys gtcgat ttaaat gaaacgcct tatgtgcaa acgaaaaga atgcttaca 1440 ValAsp LeuAsn GluThrPro TyrValGln ThrLysArg MetLeuThr WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 cgt atg aaa gcc ctc atg aaa aca gtt gag aca ggt cgg aga tac ttc 1488 Arg Met Lys Ala Leu Met Lys Thr Val Glu Thr Gly Arg Arg Tyr Phe ccatcttgttat gaggttctg gataagtac atggat cagtatatggac 1536 ProSerCysTyr GluValLeu AspLysTyr MetAsp GlnTyrMetAsp gaagaaatccct gatatgtcg tatcccgag aaaggc actgtgaaagag 1584 G1uGluIlePro AspMetSer TyrProGlu LysGly ThrValLysGlu agaagacagaag aggatgaga tataacgag ctgaag aacgacgttaaa 1632 ArgArgGlnLys ArgMetArg TyrAsnGlu LeuLys AsnAspValLys aaagcatatagc aaagacaaa gtcgcgcgg tcttgt ctttcttcttca 1680 LysAlaTyrSer LysAspLys ValAlaArg SerCys LeuSerSerSer tcaccagettct tctcttaga gaagcctta gagaat ccaacatga 1725 SerProAlaSer SerLeuArg GluAlaLeu GluAsn ProThr <210>

<211> 4 <212>
PRT

<213>
Arabidopsis thaliana <400> 70 Met Ala Ala Thr Ala Ile Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser His Leu Ser Asn Pro Ser Pro Val Val Thr Thr Tyr His Ser Ala Ala Asn Leu Glu Glu Leu Ser Ser Asn Leu Glu Gln Leu Leu Thr Asn Pro Asp Cys Asp Tyr Thr Asp Ala Glu Ile Ile Ile Glu Glu Glu Ala Asn Pro Val Ser Val His Arg Cys Val Leu Ala Ala Arg Ser Lys Phe Phe Leu Asp Leu Phe Lys Lys Asp Lys Asp Ser Ser Glu Lys Lys Pro Lys Tyr Gln Met Lys Asp Leu Leu Pro Tyr Gly Asn Val Gly Arg Glu Ala Phe Leu His Phe Leu Ser Tyr Ile Tyr Thr Gly Arg Leu Lys Pro Phe Pro Ile Glu Val Ser Thr Cys Val Asp Ser Val Cys Ala His Asp Ser Cys Lys Pro Ala Ile Asp Phe Ala Val Glu Leu Met Tyr Ala Ser Phe Val Phe Gln Ile Pro Asp Leu Val Ser Ser Phe Gln Arg Lys Leu Arg Asn Tyr Val Glu Lys Ser Leu Val Glu Asn Val Leu Pro Ile Leu Leu Val Ala Phe His Cys Asp Leu Thr Gln Leu Leu Asp Gln Cys Ile Glu Arg Val Ala Arg Ser Asp Leu Asp Arg Phe Cys Ile Glu Lys Glu WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Leu Pro Leu Glu Val Leu Glu Lys Ile Lys Gln Leu Arg Val Lys Ser Val Asn Ile Pro Glu Val Glu Asp Lys Ser Ile Glu Arg Thr Gly Lys Val Leu Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Thr Glu Ser Asp Ile Thr Leu Asp Gln Ala Asn Gly Leu His Tyr Ala Val Ala Tyr Ser Asp Pro Lys Val Val Thr Gln Val Leu Asp Leu Asp Met Ala Asp Val Asn Phe Arg Asn Ser Arg Gly Tyr Thr Val Leu His Ile Ala Ala Met Arg Arg Glu Pro Thr Ile Ile Ile Pro Leu Ile Gln Lys Gly Ala Asn Ala Ser Asp Phe Thr Phe Asp Gly Arg Ser Ala Val Asn Ile Cys Arg Arg Leu Thr Arg Pro Lys Asp Tyr His Thr Lys Thr Ser Arg Lys Glu Pro Ser Lys Tyr Arg Leu Cys Ile Asp Ile Leu Glu Arg Glu Ile Arg Arg Asn Pro Leu Val Ser Gly Asp Thr Pro Thr Cys Ser His Ser Met Pro Glu Asp Leu Gln Met Arg Leu Leu Tyr Leu Glu Lys Arg Val Gly Leu Ala Gln Leu Phe Phe Pro Ala Glu Ala Asn Val Ala Met Asp Val Ala Asn Val Glu Gly Thr Ser Glu Cys Thr Gly Leu Leu Thr Pro Pro Pro Ser Asn Asp Thr Thr Glu Asn Leu Gly Lys Val Asp Leu Asn Glu Thr Pro Tyr Val Gln Thr Lys Arg Met Leu Thr Arg Met Lys Ala Leu Met Lys Thr Val Glu Thr Gly Arg Arg Tyr Phe Pro Ser Cys Tyr Glu Val Leu Asp Lys Tyr Met Asp Gln Tyr Met Asp Glu Glu Ile Pro Asp Met Ser Tyr Pro Glu Lys Gly Thr Val Lys Glu Arg Arg Gln Lys Arg Met Arg Tyr Asn Glu Leu Lys Asn Asp Val Lys Lys Ala Tyr Ser Lys Asp Lys Val Ala Arg Ser Cys Leu Ser Ser Ser Ser Pro Ala Ser Ser Leu Arg Glu Ala Leu Glu Asn Pro Thr <210> 71 <211> 1818 <212> DNA
<213> Arabidopsis thaliana <220>
<221> CDS
<222> (13)..(1818) <223> AtNMLc4-2 cDNA sequence <400> 71 gccgatctcg tg atg atg gcc acc acc acc acc acc acc acc get aga ttc 51 Met Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe W~ 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 tctgattcatac gagttc agcaacaca agcggcaatagc ttcttc gcc 99 SerAspSerTyr GluPhe SerAsnThr SerGlyAsnSer PhePhe Ala gccgagtcatct cttgat tatccgacg gaatttctcacg ccaccg gag 147 AlaGluSerSer LeuAsp TyrProThr GluPheLeuThr ProPro Glu gtatcagetctt aaactt ctgtctaac tgcctcgagtct gttttc gac 195 ValSerAlaLeu LysLeu LeuSerAsn CysLeuGluSer ValPhe Asp tcgccggagacg ttctac agcgatget aagctagttctc gccggc ggc 243 SerProGluThr PheTyr SerAspAla LysLeuValLeu AlaGly Gly cgggaagtttct tttcac cgttgtatt ctttccgcgaga attcct gtc 291 ArgGluValSer PheHis ArgCysIle LeuSerAlaArg IlePro Val ttcaaaagcget ttagcc accgtgaag gaacaaaaatcc tccacc acc 339 PheLysSerAla LeuAla ThrValLys GluGlnLysSer SerThr Thr gtgaagctccag ctgaaa gagatcgcc agagattacgaa gtcggc ttt 387 ValLysLeuGln LeuLys GluIleAla ArgAspTyrGlu ValGly Phe gactcggttgtg gcggtt ttggcgtat gtttacagcggc agagtg agg 435 AspSerValVal AlaVal LeuAlaTyr ValTyrSerGly ArgVal Arg tccccgccgaag ggaget tctgettgc gtagacgacgat tgttgc cac 483 SerProProLys GlyAla SerAlaCys ValAspAspAsp CysCys His gtggettgccgg tcaaag gtggatttc atggtggaggtt ctttat ctg 531 ValAlaCysArg SerLys ValAspPhe MetValGluVal LeuTyr Leu tctttcgttttc cagatt caagaatta gttactctgtat gagagg cag 579 SerPheValPhe GlnIle GlnGluLeu ValThrLeuTyr GluArg Gln ttcttggaaatt gtagac aaagttgta gtcgaagacatc ttggtt ata 627 PheLeuGluIle ValAsp LysValVal ValGluAspIle LeuVal Ile ttcaagcttgat actcta tgtggtaca acatacaagaag cttttg gat 675 PheLysLeuAsp ThrLeu CysGlyThr ThrTyrLysLys LeuLeu Asp agatgcatagaa attatc gtgaagtct gatatagaacta gttagt ctt 723 ArgCysIleGlu IleIle ValLysSer AspIleGluLeu ValSer Leu gagaagtcttta cctcaa cacattttc aagcaaatcata gacatc cgc 771 GluLysSerLeu ProGln HisIlePhe LysGlnIleIle AspIle Arg WO CA 02365968 2001-09-06 pCT/EP00/01978 gaa gcg ctctgtcta gagccacct aaactagaa aggcatgtc aagaac 819 Glu Ala LeuCysLeu GluProPro LysLeuGlu ArgHisVal LysAsn ata tac aaggcgcta gactcagat gatgttgag cttgtcaag atgctt 867 Ile Tyr LysAlaLeu AspSerAsp AspValGlu LeuValLys MetLeu ttg cta gaaggacac accaatctc gatgaggcg tatgetctt catttt 915 Leu Leu GluGlyHis ThrAsnLeu AspGluAla TyrAlaLeu HisPhe get atc getcactgc getgtgaag accgcgtat gatctcctc gagctt 963 Ala Ile AlaHisCys AlaValLys ThrAlaTyr AspLeuLeu GluLeu gag ctt gcggatgtt aaccttaga aatccgagg ggatacact gtgctt 1011 Glu Leu AlaAspVal AsnLeuArg AsnProArg GlyTyrThr ValLeu cat gtt getgcgatg cggaaggag ccgaagttg ataatatct ttgtta 1059 His Val AlaAlaMet ArgLysGlu ProLysLeu IleIleSer LeuLeu atg aaa ggggcaaat attttagac acaacattg gatggtaga accget 1107 Met Lys GlyAlaAsn IleLeuAsp ThrThrLeu AspGlyArg ThrAla tta gtg attgtaaaa cgactcact aaagcggat gactacaaa actagt 1155 Leu Val IleValLys ArgLeuThr LysAlaAsp AspTyrLys ThrSer acg gag gacggtacg ccttctctg aaaggcgga ttatgcata gaggta 1203 Thr Glu AspGlyThr ProSerLeu LysGlyGly LeuCysIle GluVal ctt gag catgaacaa aaactagaa tatttgtcg cctatagag gettca 1251 Leu Glu HisGluGln LysLeuGlu TyrLeuSer ProIleGlu AlaSer ctt tct cttccagta actccagag gagttgagg atgaggttg ctctat 1299 Leu Ser LeuProVal ThrProGlu GluLeuArg MetArgLeu LeuTyr tat gaa aaccgagtt gcacttget cgacttctc tttccagtg gaaact 1347 Tyr Glu AsnArgVal AlaLeuAla ArgLeuLeu PheProVal GluThr gaa act gtacagggt attgccaaa ttggaggaa acatgcgag tttaca 1395 Glu Thr ValGlnGly IleAlaLys LeuGluGlu ThrCysGlu PheThr get tct agtctcgag cctgatcat cacattggt gaaaagcgg acatca 1443 Ala Ser SerLeuGlu ProAspHis HisIleGly GluLysArg ThrSer cta gac ctaaatatg gcgccgttc caaatccat gagaagcat ttgagt 1491 Leu Asp LeuAsnMet AlaProPhe GlnIleHis GluLysHis LeuSer aga cta agagcactt tgtaaaacc gtggaactg gggaaacgc tacttc 1539 _77_ WO CA 02365968 pCT/EP00/01978 Arg Leu Ala LeuCysLysThr ValGlu LeuGlyLys ArgTyrPhe Arg aaa cga tcg cttgatcacttt atggat actgaggac ttgaatcat 1587 tgt Lys Arg Ser LeuAspHisPhe MetAsp ThrGluAsp LeuAsnHis Cys ctt get gta gaagaagatact cctgag aaacggcta caaaagaag 1635 agc Leu Ala Val GluGluAspThr ProGlu LysArgLeu GlnLysLys Ser caa agg atg gaactacaagag actctg atgaagacc tttagtgag 1683 tac Gln Arg Met GluLeuGlnGlu ThrLeu MetLysThr PheSerGlu Tyr gac aag gaa tgtggaaagtct tccaca ccgaaacca acctctgcg 1731 gag Asp Lys Glu CysGlyLysSer SerThr ProLysPro ThrSerAla Glu gtg agg aat agaaaactctct caccgg cgcctaaaa gtggacaaa 1779 tct Val Arg Asn ArgLysLeuSer HisArg ArgLeuLys ValAspLys Ser cgg gat ttg aaacgaccttac gggaac ggggattaa 1818 ttt Arg Asp Leu LysArgProTyr GlyAsn GlyAsp Phe <210>

<211>

<212>
PRT

<213>
Arabidopsis thaliana <400> 72 Met Met Ala Thr Thr Thr Thr Thr Thr Thr Ala Arg Phe Ser Asp Ser Tyr Glu Phe Ser Asn Thr Ser Gly Asn Ser Phe Phe Ala Ala Glu Ser Ser Leu Asp Tyr Pro Thr Glu Phe Leu Thr Pro Pro Glu Val Ser Ala Leu Lys Leu Leu Ser Asn Cys Leu Glu Ser Val Phe Asp Ser Pro Glu Thr Phe Tyr Ser Asp Ala Lys Leu Val Leu Ala Gly Gly Arg Glu Val Ser Phe His Arg Cys Ile Leu Ser Ala Arg Ile Pro Val Phe Lys Ser Ala Leu Ala Thr Val Lys Glu Gln Lys Ser Ser Thr Thr Val Lys Leu Gln Leu Lys Glu Ile Ala Arg Asp Tyr Glu Val Gly Phe Asp Ser Val Val Ala Val Leu Ala Tyr Val Tyr Ser Gly Arg Val Arg Ser Pro Pro Lys Gly Ala Ser Ala Cys Val Asp Asp Asp Cys Cys His Val Ala Cys Arg Ser Lys Val Asp Phe Met Val Glu Val Leu Tyr Leu Ser Phe Val Phe Gln Ile Gln Glu Leu Val Thr Leu Tyr Glu Arg Gln Phe Leu Glu Ile Val Asp Lys Val Val Val Glu Asp Ile Leu Val Ile Phe Lys Leu Asp Thr Leu Cys Gly Thr Thr Tyr Lys Lys Leu Leu Asp Arg Cys Ile _78_ WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 Glu Ile Ile Val Lys Ser Asp Ile Glu Leu Val Ser Leu Glu Lys Ser Leu Pro Gln His Ile Phe Lys Gln Ile Ile Asp Ile Arg Glu Ala Leu Cys Leu Glu Pro Pro Lys Leu Glu Arg His Val Lys Asn Ile Tyr Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Met Leu Leu Leu Glu Gly His Thr Asn Leu Asp Glu Ala Tyr Ala Leu His Phe Ala Ile Ala His Cys Ala Val Lys Thr Ala Tyr Asp Leu Leu Glu Leu Glu Leu Ala Asp Val Asn Leu Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala Ala Met Arg Lys Glu Pro Lys Leu Ile Ile Ser Leu Leu Met Lys Gly Ala Asn Ile Leu Asp Thr Thr Leu Asp Gly Arg Thr Ala Leu Val Ile Val Lys Arg Leu Thr Lys Ala Asp Asp Tyr Lys Thr Ser Thr Glu Asp Gly Thr Pro Ser Leu Lys Gly Gly Leu Cys Ile Glu Val Leu Glu His Glu Gln Lys Leu Glu Tyr Leu Ser Pro Ile Glu Ala Ser Leu Ser Leu Pro Val Thr Pro Glu Glu Leu Arg Met Arg Leu Leu Tyr Tyr Glu Asn Arg Val Ala Leu Ala Arg Leu Leu Phe Pro Val Glu Thr Glu Thr Val Gln Gly Ile Ala Lys Leu Glu Glu Thr Cys Glu Phe Thr Ala Ser Ser Leu Glu Pro Asp His His Ile Gly Glu Lys Arg Thr Ser Leu Asp Leu Asn Met Ala Pro Phe Gln Ile His Glu Lys His Leu Ser Arg Leu Arg Ala Leu Cys Lys Thr Val Glu Leu Gly Lys Arg Tyr Phe Lys Arg Cys Ser Leu Asp His Phe Met Asp Thr Glu Asp Leu Asn His Leu Ala Ser Val Glu Glu Asp Thr Pro Glu Lys Arg Leu Gln Lys Lys Gln Arg Tyr Met Glu Leu Gln Glu Thr Leu Met Lys Thr Phe Ser Glu Asp Lys Glu Glu Cys Gly Lys Ser Ser Thr Pro Lys Pro Thr Ser Ala Val Arg Ser Asn Arg Lys Leu Ser His Arg Arg Leu Lys Val Asp Lys Arg Asp Phe Leu Lys Arg Pro Tyr Gly Asn Gly Asp <210> 73 <211> 2673 <212> DNA
<213> Nicotiana tabacum <220>
<221> CDS
<222> (661)..(1767) <223> full-length Tobacco B cDNA sequence _79_ WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 <220>
<221> misc_feature <222> (1). (2673) <223> n = a, t, c or g <400> 73 tcgagcggcc gcccgggcag gtaaactcta acccttttaa tctttttttg gttgcatttc 60 ggatctaacc tcaggaaaaa aaacagtatt tttagcctct gcaattgcaa attttctcgt 120 ttttttagcc gaagtgaatg ttattccaat tgggtaagct gtgatcaagc agttgaagtt 180 ttttgttgca aaatttgcca gttatcttga ctttttgtga agttggtaaa tttttcattt 240 gggtaagttg tgatcaagca gttgaagatt tgcactttgt attcttactg tgaaattgca 300 gttttgttga ttatagatgg ggtggaattg ttaatttctt ctaaagtttt aaagggttga 360 tttggtttta cctgaaatag ggagaatatg acttgtagtt ttggaatttg cttcttttct 420 tggtctgcat agttgaatgt tattagaaaa cttatggaaa gttttggtca aacttttgtc 480 ctttgagaag aatttcttgt attggtgatt ggttatggtc ttggagaggt tctttttttt 540 tttgcataga gcctgtgcgg agaatattat acatggttaa aaacattaga ttttctggac 600 tttgactatc ttagatgtag ataaattttg tatatgtttt tagaccatta gaattgggaa 660 atg get tgt tct get gaa cca tca tca tct ata agc ttt act tca tct 708 Met Ala Cys Ser Ala Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser tcc att aca tcg aat ggg tcg att ggc gtt ggc caa aac act cat get 756 Ser Ile Thr Ser Asn Gly Ser Ile Gly Val Gly Gln Asn Thr His Ala tat ggc ggc tct gag aca ggg agt agt tat gaa atc atc agc ttg agt 804 Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser aaa ctc agt aac aat tta gag caa ctc ttg tca gat tcc agc tct gat 852 Lys Leu Ser Asn Asn Leu Glu Gln Leu Leu Ser Asp Ser Ser Ser Asp ttt act gat get gag att gtt gtt gag ggt gtt tca ctt ggt gtt cac 900 Phe Thr Asp Ala Glu Ile Val Val Glu Gly Val Ser Leu Gly Val His cgt tgt ata tta get gcc agg agt aaa ttt ttt cag gat ctt ttt agg 948 Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gln Asp Leu Phe Arg aaa gag aag gga agt tgt gga aag gaa ggt aaa cca aga tat tct atg 996 Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys Pro Arg Tyr Ser Met acc gat att ttg cct tat ggt aag gtt gga tat gag get ttc gtt acc 1044 Thr Asp Ile Leu Pro Tyr Gly Lys Val Gly Tyr Glu Ala Phe Val Thr WO 00/53762 CA 02365968 2001-09-06 pCT~P00/01978 ttcctaagctat ttgtactca ggaaaattg aagcatttc cctccggag 1092 PheLeuSerTyr LeuTyrSer GlyLysLeu LysHisPhe ProProGlu gtatcaacatgt atggacact atatgtget catgactct tgcagacca 1140 ValSerThrCys MetAspThr IleCysAla HisAspSer CysArgPro gcaattaatttt agtgtggag ttgatgtat gcctcttcc atgtttcag 1188 AlaIleAsnPhe SerValGlu LeuMetTyr AlaSerSer MetPheGln gttccagagcta gtatcactt ttcctgaga cgccttatc aattttgtt 1236 ValProGluLeu ValSerLeu PheLeuArg ArgLeuIle AsnPheVal gggaaggetctt gtggaagat gttatccca atacttaga gttgetttt 1284 GlyLysAlaLeu ValGluAsp ValIlePro IleLeuArg ValAlaPhe cattgccaattg agcgagctt ctcactcat tccgttgat agagtagca 1332 HisCysGlnLeu SerGluLeu LeuThrHis SerValAsp ArgValAla cgatcagatctt gaaatcaca tgcattgag aaagaggtt ccctttgaa 1380 ArgSerAspLeu GluIleThr CysIleGlu LysGluVal ProPheGlu gttgcagagaat attaaatta ttgtggccg aaatgtcag gttgatgaa 1428 ValAlaGluAsn IleLysLeu LeuTrpPro LysCysGln ValAspGlu agtaaggttcta cctgtggat cccttgcat gaaaagaga aaaaatagg 1476 SerLysValLeu ProValAsp ProLeuHis GluLysArg LysAsnArg atatacaaggca ttggattcg gatgatgtt gaacttgtc aagcttcta 1524 IleTyrLysAla LeuAspSer AspAspVal GluLeuVal LysLeuLeu ctgagtgagtct aacataagc ttagatgaa gcctacget cttcattat 1572 LeuSerGluSer AsnIleSer LeuAspGlu AlaTyrAla LeuHisTyr getgtggcatat tgtgatccc aaggttgtg actgaggtt cttggactg 1620 AlaValAlaTyr CysAspPro LysValVal ThrGluVal LeuGlyLeu ggtgttgcggat gtcaaccta cgtaatact cgtggttac actgtgctt 1668 GlyValAlaAsp ValAsnLeu ArgAsnThr ArgGlyTyr ThrValLeu cacattgettcc atgcgtaag gagccagca gtaattgta tcgcttttg 1716 HisIleAlaSer MetArgLys GluProAla ValIleVal SerLeuLeu actaagggaget cgtgcatca gagactaca ttggatggg cagagtget 1764 ThrLysGlyAla ArgAlaSer GluThrThr LeuAspGly GlnSerAla gtt agtatctgta ggaggctgac taggcctaag gagtaccatg caaaaacaga 1817 _81 _ Val acaaggccag gaagcaaaca aagatcgggt atgtattgat gttttggaga gagagatgcg 1877 tcgcaaccca atggctggag atgcattgtt ttcttcccca atgttggccg atgatctgca 1937 catgaaactg cactacctgg aaaatagagt ggcatttgca cggttactgt tccctcttga 1997 agccagacta gccatgcaaa ttgcaaatgc tgagactgca gctgaagtag cagtccgttt 2057 ggcatctaaa agtacatctg ggaacttgag ggaggttgat ttgaatgaga cacccataaa 2117 gcagaaagaa agacttcttt caaggatgca agccctctcg aagacagttg aacttggcaa 2177 gcgctatttt ccacattgct ctcaagttct ggacaagttt atggaggatg acttacccga 2237 cttaattttc cttgagatgg gccctccaga ggagcaaaag atcaagagga agcgatttaa 2297 ggagctcaaa gatgacgttc ancgggcatt taacaaagac aaagctgaac ttcattgctc 2357 ccgcttgtcc tcatcatcat gttcctcttc ttttaaagat ggngcaagtg tcaaacttag 2417 gaaactatga gtaaataggg ttttgtccta tagtttctct nccatctcag ttttgaatgt 2477 aagattaata gtttttataa agacttgtct tgtacancct tcattagagc gcctgctttg 2537 tcgctatcca tttccctatt cagcttgtta aacttccatg tttncagtag aaagaaattt 2597 gcttaggaac aagcttttgg aatagcttat atggaaaatt gattgtaaaa aaaaaaaaaa 2657 aaaaaaaaaa aaaaaa 2673 <210> 74 <211> 369 <212> PRT
<213> Nicotiana tabacum <400> 74 Met Ala Cys Ser Ala Glu Pro Ser Ser Ser Ile Ser Phe Thr Ser Ser Ser Ile Thr Ser Asn Gly Ser Ile Gly Val Gly Gln Asn Thr His Ala Tyr Gly Gly Ser Glu Thr Gly Ser Ser Tyr Glu Ile Ile Ser Leu Ser Lys Leu Ser Asn Asn Leu Glu Gln Leu Leu Ser Asp Ser Ser Ser Asp Phe Thr Asp Ala Glu Ile Val Val Glu Gly Val Ser Leu Gly Val His Arg Cys Ile Leu Ala Ala Arg Ser Lys Phe Phe Gln Asp Leu Phe Arg Lys Glu Lys Gly Ser Cys Gly Lys Glu Gly Lys Pro Arg Tyr Ser Met Thr Asp Ile Leu Pro Tyr Gly Lys Val Gly Tyr Glu Ala Phe Val Thr Phe Leu Ser Tyr Leu Tyr Ser Gly Lys Leu Lys His Phe Pro Pro Glu Val Ser Thr Cys Met Asp Thr Ile Cys Ala His Asp Ser Cys Arg Pro Ala Ile Asn Phe Ser Val Glu Leu Met Tyr Ala Ser Ser Met Phe Gln Val Pro Glu Leu Val Ser Leu Phe Leu Arg Arg Leu Ile Asn Phe Val Gly Lys Ala Leu Val Glu Asp Val Ile Pro Ile Leu Arg Val Ala Phe His Cys Gln Leu Ser Glu Leu Leu Thr His Ser Val Asp Arg Val Ala Arg Ser Asp Leu Glu Ile Thr Cys Ile Glu Lys Glu Val Pro Phe Glu Val Ala Glu Asn Ile Lys Leu Leu Trp Pro Lys Cys Gln Val Asp Glu 245 250 255.
Ser Lys Val Leu Pro Val Asp Pro Leu His Glu Lys Arg Lys Asn Arg Ile Tyr Lys Ala Leu Asp Ser Asp Asp Val Glu Leu Val Lys Leu Leu Leu Ser Glu Ser Asn Ile Ser Leu Asp Glu Ala Tyr Ala Leu His Tyr Ala Val Ala Tyr Cys Asp Pro Lys Val Val Thr Glu Val Leu Gly Leu Gly Val Ala Asp Val Asn Leu Arg Asn Thr Arg Gly Tyr Thr Val Leu His Ile Ala Ser Met Arg Lys Glu Pro Ala Val Ile Val Ser Leu Leu Thr Lys Gly Ala Arg Ala Ser Glu Thr Thr Leu Asp Gly Gln Ser Ala Val

Claims

What Is Claimed Is:

1. An isolated nucleic acid molecule comprising:
(a) a nucleotide sequence that encodes SEQ ID NO:2, 4, 6, 8, 16, 18, 20, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68, 70, 72, or 74;
(b) SEQ ID NO:1, 3, 5, 7, 15, 17, 19, 29-31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 89, 71, or 73;
(c) a nucleotide sequence that comprises an at least 20 consecutive base pair portion identical in sequence to an at least 20 consecutive base pair portion of SEQ
ID NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73;
(d) a nucleotide sequence that can be amplified from a Lycopersicon esculentum DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:9 and 10, SEQ ID NO:21 and 24, SEQ ID NO:22 and 24, SEQ ID
NO:25 and 28, SEQ ID NO:26 and 28, or SEQ ID NO:59 and 60;
(e) a nucleotide sequence that can be amplified from a Beta vulgaris DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ ID
NO:22 and 24 or SEQ ID NO:26 and 28;
(f) a nucleotide sequence that can be amplified from a Helianthus annuus DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ
ID
NO:26 and 28;
(g) a nucleotide sequence that can be amplified from a Solanum tuberosum DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ 1D NO:21 and 24, SEQ ID NO:21 and 23, SEQ 1D NO:22 and 24, SEQ ID
NO:25 and 28, or SEQ ID NO:26 and 28;
(h) a nucleotide sequence that can be amplified from a Brassica napus DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ
ID
NO:9 and 10 or SEQ ID NO:26 and 28;
(i) a nucleotide sequence that can be amplified from an Arabidopsis thaliana DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:13 and 14, SEQ ID NO:21 and 24, or SEQ ID NO:22 and 24;
(j) a nucleotide sequence that can be amplified from an Nicotiana tabacum DNA
library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:21 and 24, SEQ ID
NO:22 and 24, SEQ ID NO:25 and 28, or SEQ ID NO:26 and 28; or (k) a nucleotide sequence that can be amplified from an plant DNA library using the polymerase chain reaction with a pair of primers comprising the first 20 nucleotides and the reverse complement of the last 20 nucleotides of the coding sequence (CDS) of SEQ ID NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47;
49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.

2. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that encodes SEQ ID NO:2, 4, 6, 8, 16, 18, 20, 30; 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 62, 64, 66, 68, 70, 72, or 74.

3. An isolated nucleic acid molecule according to claim 1, comprising SEQ ID
NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.

4. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that comprises an at least 20 consecutive base pair portion identical in sequence to an at least 20 consecutive base pair portion of SEQ ID NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.

5. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a Lycopersicon esculentum DNA library using the polymerase chain reaction with the pair of primes set forth as SEQ ID NO:9 and 10, SEQ ID NO:21 and 24, SEQ ID NO:22 and 24, SEQ ID NO:25 and 28, SEQ ID NO:26 and 28, or SEQ ID NO:59 and 60.

6. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a Beta vulgaris DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:22 and 24 or SEQ ID
NO:26 and 28.

7. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a Hellanthus annuus DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:26 and 28.

8. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a Solanum tuberosum DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:21 and 24, SEQ ID NO:21 and 23, SEQ ID NO:22 and 24, SEQ ID NO:25 and 28, or SEQ ID
NO:26 and 28.

9. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a Brassica napus DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:9 and 10 or SEQ ID NO:26 and 28.

10. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from an Arabidopsis thaliana DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:13 and 14, SEQ ID NO:21 and 24, or SEQ ID NO:22 and 24.

11. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from an Nicotiana tabacum DNA library using the polymerase chain reaction with the pair of primers set forth as SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ ID NO:21 and 24, SEQ ID NO:22 and 24, SEQ ID NO:25 and 28, or SEQ ID NO:26 and 28.

12. An isolated nucleic acid molecule according to claim 1, comprising a nucleotide sequence that can be amplified from a plant DNA library using the polymerase chain reaction with a pair of primers corresponding to the first 20 nucleotides and the reverse complement of the last 20 nucleotides of the coding sequence (CDS) of SEQ ID
NO:1, 3, 5, 7, 15, 17, 19, 29, 31. 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73.

13. A chimeric gene comprising a promoter active in plants operatively linked to a nucleic acid molecule according to any one of the preceding claims.

14. A recombinant vector comprising the chimeric gene of claim 13.

15. A host cell comprising the chimeric gene of claim 13.

16. A plant comprising the chimeric gene of claim 13.

17. The giant of claim 16, which is selected from the following: rice, wheat, barley, rye, corn, potato, canola, sunflower, carrot, sweet potato, sugarbeet, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum and sugarcane.

18. Seed from the plant of claim 16.

19. A method of increasing SAR gene expression in a plant, comprising expressing the chimeric gene of claim 13 in said plant.

20. A method of enhancing disease resistance in a plant, comprising expressing the chimeric gene of claim 13 in said plant.

21. A PCR primer selected from the group consisting of SEQ ID NO:9-14, 21-28, 59, and 60.

22. A method for isolating a NIM1 homologue involved in the signal transduction cascade leading to systemic acquired resistance in plants comprising amplifying a DNA
molecule from a plant DNA library using the polymerase chain reaction with a pair of primers corresponding to the first 20 nucleotides and the reverse complement of the last 20 nucleotides of the coding sequence (CDS) of SEQ ID NO:1, 3, 5, 7, 15, 17, 19, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 61, 63, 65, 67, 69, 71, or 73 or with the pair of primers set forth as SEQ ID NO:9 and 10, SEQ ID NO:11 and 12, SEQ
ID
NO:13 and 14, SEQ ID NO:21 and 24, SEQ ID NO:22 and 24, SEQ ID NO:21 and 23, SEQ ID NO:25 and 28, SEQ ID NO:26 and 28, or SEQ ID NO:59 and 60.

23. The method of claim 22, wherein said plant DNA library is a Nicotiana tabacum (tobacco), Lycopersicon esculentum (tomato), Brassica napus (oilseed rape), Arabidopsis thaliana, Beta vulgaris (sugarbeet), Helianthus annuus (sunflower), or Solanum tuberosum.