CN206359528U - Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits - Google Patents
Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits Download PDFInfo
- Publication number
- CN206359528U CN206359528U CN201621476429.9U CN201621476429U CN206359528U CN 206359528 U CN206359528 U CN 206359528U CN 201621476429 U CN201621476429 U CN 201621476429U CN 206359528 U CN206359528 U CN 206359528U
- Authority
- CN
- China
- Prior art keywords
- pcr
- box body
- reagent
- reverse transcription
- hole
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The utility model discloses a kind of blood platelet RNA real-time fluorescence PCR cancer diagnosing kits, including the open box body in top and the demarcation strip being arranged vertically in box body；The demarcation strip is placed in the box body is divided into five regions by box body；The top left region of the box body, which is provided with horizontal reverse transcription dividing plate, reverse transcription dividing plate, is provided with multiple reverse transcription reagents holes；The most right areas of the box body is provided with horizontal PCR dividing plates, and the bottom of PCR dividing plates, which is provided with above two row PCR reagent holes, PCR reagent hole, is provided with the first reagent wells.The utility model is simple in construction, easy to operate, can optimize preparation of reagents process, improves operating efficiency, it is ensured that the accuracy of test data.Tested using this kit and its interior reagent, the expression change of specific gene in blood platelet can be judged and then determine whether to suffer from tumour, with the specific height of simple to operate, sensitivity, the characteristics of advantage of lower cost.
Description
Technical field
The utility model is related to medical auxiliary equipment field, more particularly to a kind of blood platelet RNA real-time fluorescence PCR cancers
Diagnostic kit.
Background technology
Kit is the box for holding the chemical reagent such as detection chemical composition, medicament residue, viral species.Kit
Generation experimenter has been broken away from heavy preparation of reagents process, optimize test program.
At present, in order to meet the demand and accurate test data of experiment, relevant speciality personage is to being applicable respective field
Kit done further improvement.But, it currently there are no and be directed to cancer liquid biopsy, detected using blood platelet RNA
Kit.
Utility model content
For defect of the prior art, the utility model provides a kind of blood platelet RNA real-time fluorescence PCRs cancer diagnosis examination
Agent box, can optimize preparation of reagents process, improve operating efficiency, it is ensured that the accuracy of test data.
A kind of blood platelet RNA real-time fluorescence PCR cancer diagnosing kits, including the open box body in top and be arranged vertically at
Demarcation strip in box body；The demarcation strip includes cross plate body portion and the end plate on the right side of cross plate body portion
Point, the demarcation strip is placed in the box body is divided into five regions by box body；The top left region of the box body is provided with level
Reverse transcription dividing plate, be provided with multiple reverse transcription reagents holes on reverse transcription dividing plate；The most right areas of the box body is provided with water
Flat PCR dividing plates, the bottom of PCR dividing plates, which is provided with above two row PCR reagent holes, PCR reagent hole, is provided with the first reagent wells,
The diameter of first reagent wells is more than PCR reagent hole.
Preferably, the quantity in each column PCR reagent hole is 5, and PCR reagent hole is equally spaced, PCR reagent hole
A diameter of 12mm；A diameter of 30mm of first reagent wells.
Preferably, the top in the two row PCR reagent hole is correspondingly arranged on F and R alphabetical designation, PCR reagent hole respectively
Left side vertical direction be correspondingly arranged on 1-5 number designation.
Preferably, it is provided with PCR labels location for paste above first reagent wells.
Preferably, the quantity in the reverse transcription reagents hole is 5, a diameter of 12mm in reverse transcription reagents hole, reverse transcription examination
Agent hole is divided to two rows to be equally spaced, and first row is disposed with 3 reverse transcription reagents holes, and second row is disposed with 2 reverse transcription reagents holes.
Preferably, it is provided with reverse transcription label location for paste above the reverse transcription reagents hole.
Preferably, blood platelet RNA real-time fluorescence PCRs cancer diagnosing kit also includes cover plate and lid, the covering
Plate is fitted with the top of box body；The edge of the lid is provided with button edge, and is fastened on the upper end of box body.
The beneficial effects of the utility model are embodied in：
1. the layout of kit is easy in the design of demarcation strip, make that it is more reasonable, conveniently.Lid can avoid some debris from entering
Enter in kit, and be easy to the stacking between kit, cover plate ensure that the cleaning ambient inside kit at the beginning of use.
2. the design of reverse transcription dividing plate and PCR dividing plates so that the storage of reagent is more easily discriminated, and optimize reagent and match somebody with somebody
Process processed, improves operating efficiency.
Label design on 3.PCR dividing plates so that the storage of reagent is easier to distinguish, while being easy to related personnel to record phase
Close data.
4. the utility model is simple in construction, easy to operate, preparation of reagents process can be optimized, operating efficiency is improved, it is ensured that examination
Test the accuracy of data.
5. quantitative fluorescent PCR is carried out by extracting the human body platelet RNA after purification, to the table of specific gene in blood platelet
Judged up to change and then determine whether to suffer from tumour.With the specific height of simple to operate, sensitivity, advantage of lower cost
Feature.
Brief description of the drawings
, below will be right in order to illustrate more clearly of the utility model embodiment or technical scheme of the prior art
The accompanying drawing used required in embodiment is briefly described.In all of the figs, similar element or part are general
Identified by similar reference.In accompanying drawing, each element or part might not be drawn according to actual ratio.
Fig. 1 is the explosive view of the present embodiment；
Fig. 2 is the structural representation of the box body of the present embodiment；
Fig. 3 is Fig. 2 top view；
Fig. 4 is the structural representation of the present embodiment lid.
In accompanying drawing, 1- box bodys, 2- demarcation strips, 21- cross plate body portions, 22- header portions, 24- reverse transcription dividing plates,
241- reverse transcription reagents hole, 242- reverse transcription labels location for paste, 25-PCR dividing plates, 251-PCR reagent wells, the reagents of 252- first
Hole, 253-PCR labels location for paste, 3- cover plates, 4- lids, 41- buttons edge
Embodiment
The embodiment of technical solutions of the utility model is described in detail below in conjunction with accompanying drawing.Following examples are only
For clearly illustrating the technical solution of the utility model, therefore example is only used as, and this patent can not be limited with this
Protection domain.
As shown in Figures 1 to 4, present embodiment discloses a kind of blood platelet RNA real-time fluorescence PCR cancer diagnosing kits,
Including the open box body 1 in top and the demarcation strip 2 being arranged vertically in box body 1；Demarcation strip 2 includes the He of cross plate body portion 21
Header portion 22 positioned at the right side of cross plate body portion 21, demarcation strip 2 is placed in box body 1 is divided into five regions by box body 1.
The layout of kit is easy in the design of demarcation strip 2, makes that it is more reasonable, conveniently.
Place a bag PCR pipe bag respectively in three cavity areas inside kit, pipe bag is using repeatable seal
70 250 μ l RNAse-free PCR pipes of packing in sealed bag, each bag PCR pipe bag.The top left region of box body 1 is provided with water
5 reverse transcription reagents holes 241 are provided with flat reverse transcription dividing plate 24, reverse transcription dividing plate 24；The diameter in reverse transcription reagents hole 241
For 12mm, 241 point two of reverse transcription reagents hole row is equally spaced, and first row is disposed with 3 reverse transcription reagents holes 241, second row
It is disposed with 2 reverse transcription reagents holes 241.The top of reverse transcription reagents hole 241 is provided with reverse transcription label location for paste 242.Above-mentioned 5
5 centrifuge tubes are respectively provided with individual reverse transcription reagents hole, it contains the μ l of 5*buffer 250, dNTP 120 μ l, oligo- respectively
The μ g of dT 100, the μ l of 60 μ l, AMV reverse transcriptases of RNase inhibitor 60.
The most right areas of box body 1 is provided with horizontal PCR dividing plates 25, and the bottom of PCR dividing plates 25 is provided with two row PCR examinations
Agent hole 251, the top in PCR reagent hole 251 is provided with the first reagent wells 252, and the diameter of the first reagent wells 252 is more than PCR reagent
Hole 251.The quantity in each column PCR reagent hole 251 is 5, and PCR reagent hole 251 is equally spaced, the diameter in PCR reagent hole 251
For 12mm；A diameter of 30mm of first reagent wells 252.The top of first reagent wells 252 is provided with PCR labels location for paste 253.
Wherein, the first reagent wells are built with bottle, and it is 2*PreMix 3ml that it is interior.
Two row PCR reagent holes are placed with centrifuge tube respectively, and its interior reagent is as follows：
| Symbol | Num. | F-primer | R-primer |
| MPHOSPH8 | 1 | CCCCACAGAACATACCAGAAG | ACAGAGCCGAGCAATAACTTC |
| CD3E | 2 | GCCTCCGCCATCTTAGTAAAG | TCTTCATTACCATCTTGCCCC |
| IL7R | 3 | CTGGAGAAAGTGGCTATGCTC | ACATCTGGGTCCTCAAAAGC |
| HPSE | 4 | CTCTATGGTCCTGATGTTGGTC | AAATCTTCCTTGGTAGCAGTCC |
| RHAG | 5 | AGCAGGCATCTTGTATCGATC | TGTCTCCAGGTTCAGCAATG |
And 10 centrifuge tubes in PCR reagent hole are different from the color of 5 centrifuge tubes in reverse transcription reagents hole, to show area
Point.
The design of reverse transcription dividing plate 24 and PCR dividing plates 25 so that the storage of reagent is more easily discriminated, and optimizes reagent
Process for preparation, improves operating efficiency.The top in two row PCR reagent holes 251 is correspondingly arranged on F and R alphabetical designation respectively,
The left side vertical direction in PCR reagent hole 251 is correspondingly arranged on 1-5 number designation.Label design on PCR dividing plates 251 so that
The storage of reagent is easier to distinguish, while being easy to related personnel to record related data.
Blood platelet RNA real-time fluorescence PCRs cancer diagnosing kit also includes cover plate 3 and lid 4, cover plate 3 and box body 1
Top laminating；The edge of lid 4 is provided with button along 41, and is fastened on the upper end of box body 1.Lid 4 can avoid some debris from entering
Enter in kit, and be easy to the stacking between kit, cover plate 3 ensure that the cleaning ambient inside kit at the beginning of use.
Finally it should be noted that：Above example is only to illustrate the technical solution of the utility model, rather than its limitations；
Although the utility model is described in detail with reference to foregoing embodiments, one of ordinary skill in the art should manage
Solution：It can still modify to the technical scheme described in foregoing embodiments, or to which part or whole skills
Art feature carries out equivalent substitution；And these modifications or replacement, the essence of appropriate technical solution is departed from the utility model
The scope of each embodiment technical scheme, it all should cover among claim of the present utility model and the scope of specification.
Claims (7)
1. a kind of blood platelet RNA real-time fluorescence PCR cancer diagnosing kits, it is characterised in that：Including the open box body in top and
It is arranged vertically at the demarcation strip in box body；The demarcation strip includes cross plate body portion and on the right side of cross plate body portion
Header portion, the demarcation strip is placed in the box body is divided into five regions by box body；The top left region of the box body is set
It is equipped with horizontal reverse transcription dividing plate, reverse transcription dividing plate and is provided with multiple reverse transcription reagents holes；The most right areas of the box body
Horizontal PCR dividing plates are provided with, the bottom of PCR dividing plates, which is provided with above two row PCR reagent holes, PCR reagent hole, is provided with
One reagent wells, the diameter of the first reagent wells is more than PCR reagent hole.
2. blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as claimed in claim 1, it is characterised in that：The each column
The quantity in PCR reagent hole is 5, and PCR reagent hole is equally spaced, a diameter of 12mm in PCR reagent hole；First reagent
A diameter of 30mm in hole.
3. blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as claimed in claim 2, it is characterised in that：Two row
The top in PCR reagent hole is correspondingly arranged on F and R alphabetical designation respectively, and the left side vertical direction in PCR reagent hole is correspondingly arranged on
1-5 number designation.
4. blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as claimed in claim 2, it is characterised in that：Described first
PCR labels location for paste is provided with above reagent wells.
5. blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as claimed in claim 1, it is characterised in that：It is described to reverse
The quantity for recording reagent wells is 5, and a diameter of 12mm in reverse transcription reagents hole, reverse transcription reagents hole is divided to two rows to be equally spaced, the
One arrangement is equipped with 3 reverse transcription reagents holes, and second row is disposed with 2 reverse transcription reagents holes.
6. blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as claimed in claim 5, it is characterised in that：It is described to reverse
Reverse transcription label location for paste is provided with above record reagent wells.
7. the blood platelet RNA real-time fluorescence PCR cancer diagnosing kits as described in any one of claim 1 to 6, its feature exists
In：Also include cover plate and lid, the cover plate is fitted with the top of box body；The edge of the lid is provided with button edge, and
It is fastened on the upper end of box body.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201621476429.9U CN206359528U (en) | 2016-12-29 | 2016-12-29 | Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201621476429.9U CN206359528U (en) | 2016-12-29 | 2016-12-29 | Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN206359528U true CN206359528U (en) | 2017-07-28 |
Family
ID=59378348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201621476429.9U Active CN206359528U (en) | 2016-12-29 | 2016-12-29 | Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN206359528U (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114104482A (en) * | 2021-11-05 | 2022-03-01 | 西南大学 | Kit for separating and decomposing cellulose microorganisms for teaching and application thereof |
-
2016
- 2016-12-29 CN CN201621476429.9U patent/CN206359528U/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114104482A (en) * | 2021-11-05 | 2022-03-01 | 西南大学 | Kit for separating and decomposing cellulose microorganisms for teaching and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN206051997U (en) | A kind of PCR detectable container and PCR preprocessing systems | |
| CN206359528U (en) | Blood platelet RNA real-time fluorescence PCR cancer diagnosing kits | |
| CN202558865U (en) | Biology sampling swab | |
| CN206270093U (en) | A kind of device collected and detect | |
| CN204846687U (en) | Can directly mark pathology specimen -box of stationary liquid | |
| CN102634448B (en) | Biological sampling swab | |
| CN204008229U (en) | A kind of segmentation urine collecting device | |
| CN207627351U (en) | A kind of forefront puncture specimen collection box | |
| CN205441255U (en) | Kit | |
| CN205678986U (en) | A kind of biological material low temperature storage device | |
| CN203569116U (en) | Multiple (Polymerase Chain Reaction) detection kit | |
| CN201275151Y (en) | Barrow type special vehicle for inspecting sample | |
| CN206358556U (en) | Human body platelet RNA extracts kits | |
| CN204269427U (en) | Clinical medical humor collecting cup | |
| CN203881768U (en) | Detection device for quantitatively collecting specimens | |
| CN103983766B (en) | A kind of pick-up unit of quantitative collection sample and the method for detection thereof | |
| CN110220753A (en) | A kind of device and method suitable for urine specimen acquisition | |
| CN201850272U (en) | Test sample transportation and preservation device | |
| CN216933280U (en) | Clinical amniotic fluid sampling assembly for obstetrics and gynecology department | |
| CN206020428U (en) | A kind of collection and detection device | |
| CN205473708U (en) | Last appearance device of PCR tubes | |
| CN211814391U (en) | Nucleic acid extraction and PCR detection kit | |
| CN202530082U (en) | Bacterial sampling swab | |
| CN218401710U (en) | Fluorescence quantitative PCR detection kit for pathogenic bacteria | |
| CN216404376U (en) | Cell product quality detection collection device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| GR01 | Patent grant | ||
| GR01 | Patent grant |