CN1928084A - Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 - Google Patents
Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 Download PDFInfo
- Publication number
- CN1928084A CN1928084A CN 200610037558 CN200610037558A CN1928084A CN 1928084 A CN1928084 A CN 1928084A CN 200610037558 CN200610037558 CN 200610037558 CN 200610037558 A CN200610037558 A CN 200610037558A CN 1928084 A CN1928084 A CN 1928084A
- Authority
- CN
- China
- Prior art keywords
- glu
- lys
- leu
- aag
- gag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention designs degenerating primer in the conservation region of CDS sequence in kindred species actin gene to extract total RNA from gonad of tiger prawn, and clone the expression sequence of heat shock protein 90 gene of tiger prawn through PCR process amplification. The separation of heat shock protein 90 gene of tiger prawn is important theoretically and practically for the research on the stress response of heat shock protein 90 gene in mollusk body on the polluting environment factors and the study of whether to use this molecule as one biological index.
Description
Technical field
The present invention relates to gene clone field in the molecular biology, relate in particular to the Nucleotide and the aminoacid sequence of the gene of tigar prawn heat shock protein 90.
Background technology
Heat shock protein(HSP) Hsp90 is the special molecular chaperones of a class, has high conservative in evolution.Think that in early days it can assist metaprotein renaturation from high temperature or other stress environment, and can promote to have produced the protein degradation of sudden change.The Hsp90 that studies show that in recent years has physiological function widely, its participate in to regulate the biological activity of multiple proteins under non-stressed condition, comprising protein transfer, cell signalling, immunne response and the growth of regulating the duplicating of DNA, genetic transcription, subcellular structure, growth, apoptosis etc.Hsp90 also with the Ras signal pathway in many signaling molecules folding closely related with assembling, mainly be Hsp90 combination with dissociate, mediated the conversion or under certain condition of these molecules between inactive form and the activity form, from the mixture that Hsp90 etc. forms with it, discharge, just can be indexed into after birth, exercise kinase whose active function.Hsp90 also has the mutein of making and possesses the active effect of similar wild-type conformation.Therefore, studying proteic gene expression regulation mechanism very conservative in this class evolution is very important with relevant signal transduction.
Summary of the invention
The objective of the invention is by degenerate primer, and with the amplification of PCR method, be cloned into the full expressed sequence of tigar prawn heat shock protein(HSP) pane gene in conjunction with the RACE technology with the conserved regions design of the CDS sequence of the gene of nearly source species heat shock protein(HSP).
Above-mentioned purpose is achieved through the following technical solutions:
Dissect tigar prawn and take out sexual gland, extract total RNA, make it to mix, carry out reverse transcription, the synthetic first chain cDNA with reverse transcription primer (oligo-dT joint primer).
From GenBank, download nearly source species (as people, ox, zebra fish, the pawl frog etc.) heat shock protein 90 homologous gene CDS sequence, utilize Clustal W software to carry out the multisequencing comparison, determine conserved regions, according to conserved regions sequences Design degenerate primer, the amplified fragments size is about 680bp.Adopt β-second eyeball phosphoramidite chemical method to carry out that DNA is synthetic to obtain following primer sequence after the design of primers:
X90F：5’-ATgATTggACAgTTYggTgT-3’
X90R：5’-TACAgYTTgATITTgTTCTT-3’。
As template, carry out pcr amplification with degenerate primer with the synthetic first chain cDNA, institute's amplification PCR products detects with 1.2% agarose gel electrophoresis, and purifying reclaims the purpose product from gel.Then with the PCR product cloning of purifying in the pMD-18T carrier, transformed into escherichia coli JM-109 competent cell, the picking positive colony extracts plasmid DNA.After degenerated primer PCR detects, will have the segmental plasmid DNA of insertion and carry out two-way order-checking with the M13 universal primer.
The present invention is in addition again according to the first chain cDNA fragment sequence design Auele Specific Primer that has obtained, utilize the terminal rapid amplifying technology of cDNA (Rapid Amplification of cDNA ends, RACE) to 3 of goal gene ' and 5 ' end carry out pcr amplification.
In the rapid amplifying of 3 ' end, utilize half-nest type (semi-nested) PCR method, at first carry out the PCR reaction by gene primer and joint primer, the amplified fragments size is about 1500bp.Described gene primer and joint primer sequence are:
Gene primer: 5 ' TCGGGGACTTCGCATACATC 3 '
Joint primer: 5 ' GGCCACGCGACTAGTAC 3 '.
Behind the rapid amplifying of 3 ' end, carry out the rapid amplifying of 5 ' end, utilize terminal enzyme (DNA) and dCTP after the cDNA end adds poly (C) tail, with the cDNA behind the tailing as template, utilize outside Auele Specific Primer and OligodG to carry out the pcr amplification first time, gained PCR product utilizes inboard primer and OligodG to carry out the pcr amplification second time again.Described primer sequence is:
oligo-dG：5’GGGGGGGGGGGGGGGH?3’
Gene outside primer: 5 ' GGCCACGCGACTAGTAC 3 '
The inboard primer of gene: 5 ' GCCGACAAGGTGACCGTAGT 3 '.
After terminal rapid amplifying technology carries out carrying out separation detection on the agarose gel electrophoresis of the resulting PCR product of PCR 1.2%, behind the PCR product purification, be cloned in the pMD-18T carrier, transformed into escherichia coli JM-109 competent cell, the picking positive colony, with the M13 primer plasmid DNA is checked order, order-checking institute calling sequence utilizes Clustal W software to splice with the sequence of degenerate primer amplification gained again and obtains goal gene.
The separation of tigar prawn heat shock protein(HSP) pane gene, for the stress reaction of the intravital heat shock protein 90 of research mollusk, this molecule can be had important significance for theories and practice significance as a kind of biological indicator thereby inquire into to the pollution factor in the environment.And come in to find that this gene pairs gonad development has promoted effect, and therefore can obtain the albumen of purifying by clone to gene, further detect the gonad development whether this gene influences tigar prawn.
Embodiment
The present invention is further elaborated below by following embodiment, but content of the present invention is not limited to this fully.
1. the extraction of total RNA
Get fresh and alive healthy tigar prawn (the about 300g of body weight) and in the laboratory, support temporarily (about 24 ℃ of water temperature behind the 2d, air-pump inflating), dissects the shrimp body and take out the about 100mg of sexual gland, put into 1mL Trizol (Gibco, Japan) carry out homogenate in, extract total RNA according to the test kit operation instruction.
2.cDNA first chain is synthetic
Getting the total RNA 5 μ g of tigar prawn mixes with reverse transcription primer (oligo-dT joint primer) 1 μ L (10pmol/L), behind 70 ℃ of heating 5min, place on ice immediately, add 5 * buffer then, 2.5mmol/L dNTP mixed solution, Ribonuclease Inhibitor, M-MLV ThermoScript II, reaction system are 25 μ L.Reaction process is 42 ℃ of 60min, 70 ℃ of 15min, and it is standby to put into-80 ℃ of preservations at last.
3. degenerate primer design considerations, primer synthetic method
From GenBank, download nearly source species (as people, ox, zebra fish, the pawl frog etc.) Hsp90 homologous gene CDS sequence, utilize Clustal W software to carry out the multisequencing comparison, determine conserved regions, according to conserved regions sequences Design degenerate primer, the amplified fragments size is about 680bp.Adopting β-second eyeball phosphoramidite chemical method to carry out DNA after the design of primers synthesizes.
Primer sequence:
X90F：5’-ATgATTggACAgTTYggTgT-3’
X90R：5’-TACAgYTTgATITTgTTCTT-3’。
4. the clone of tigar prawn heat shock protein 90 gene cDNA complete sequence
With the degenerate primer of the conserved regions design of nearly source species Hsp90 gene C DS sequence, the amplified fragments size is about 680bp.
4.1 the first chain cDNA carries out pcr amplification with degenerate primer
As template, carry out pcr amplification with degenerate primer with the above-mentioned synthetic first chain cDNA, reaction system is: 10x PCR reaction buffer 5 μ L, 25mmol/L MgCl
23 μ L, 2.5mmol/L dNTP 2 μ L, each 2 μ L of 10nmol/L primer dTF and dTR, Taq enzyme 1.25U is supplemented to 50 μ L with PCR water with reaction system.Reaction conditions is: 1 circulation, 94 ℃ of sex change 5min; 35 circulations: 94 ℃ of sex change 45s, 55 ℃ of annealing 45s, 72 ℃ are extended 45s; 1 circulation, 72 ℃ are extended 10min; 4 ℃ of insulations.Institute's amplification PCR products detects with 1.2% agarose gel electrophoresis, and purifying reclaims the purpose product from gel.Then with the PCR product cloning of purifying in the pMD-18T carrier, transformed into escherichia coli JM-109 competent cell, the picking positive colony extracts plasmid DNA.After degenerate primer PCR detects, will have the segmental plasmid DNA of insertion and carry out two-way order-checking with the M13 universal primer.
4.2 the rapid amplifying technology of the first chain cDNA is carried out pcr amplification
According to the cDNA fragment sequence design Auele Specific Primer that has obtained.Utilize the terminal rapid amplifying technology of cDNA (Rapid Amplification of cDNA ends, RACE) to 3 of goal gene ' and 5 ' end carry out pcr amplification.
In 3 ' RACE, carry out the PCR reaction by gene primer and joint primer, the amplified fragments size is about 1500bp.Primer sequence is:
Joint primer: 5 ' GGCCACGCGACTAGTAC 3 '
Gene primer: 5 ' GCCGACAAGGTGACCGTAGT 3 '
Reaction system is with the degenerate primer amplification system.
Reaction conditions is: 1 circulation, 94 ℃ of sex change 5min; 35 circulations: 94 ℃ of sex change 45s, 59 ℃ of annealing 30s, 72 ℃ are extended 1min; 1 circulation, 72 ℃ are extended 10min; 4 ℃ of insulations.
In 5 ' RACE, utilize terminal enzyme (DNA) and dCTP after the cDNA end adds poly (C) tail, with the cDNA behind the tailing as template, utilize outside Auele Specific Primer and OligodG to carry out the pcr amplification first time, gained PCR product is got 1 μ L as template, utilizes inboard primer and OligodG to carry out the pcr amplification second time again.Primer sequence is:
oligo-dG：5’GGGGGGGGGGGGGGGH?3’
Outside gene primer: 5 ' TGTTCTTCTGCTTGCGGTTC 3 '
Inboard gene primer: 5 ' TCCTCCCAGTCGTTGGTCAG 3 '
The reaction system reaction system is with the degenerate primer amplification system.
Reaction conditions:
Pcr amplification is for the first time: 1 circulation, 94 ℃ of sex change 5min; 35 circulations: 94 ℃ of sex change 45s, 60 ℃ of annealing 30s, 72 ℃ are extended 1min; 1 circulation, 72 ℃ are extended 10min; 4 ℃ of insulations.
Pcr amplification is for the second time: 1 circulation, 94 ℃ of sex change 5min; 35 circulations: 94 ℃ of sex change 45s, 58 ℃ of annealing 30s, 72 ℃ are extended 1min; 1 circulation, 72 ℃ are extended 10min; 4 ℃ of insulations.
Resulting PCR product is after carrying out separation detection on 1.2% the agarose gel electrophoresis, behind the PCR product purification, be cloned in the pMD-18T carrier, transformed into escherichia coli JM-109 competent cell, the picking positive colony, with the M13 primer plasmid DNA is checked order, order-checking institute calling sequence utilizes Clustal W software to splice with the sequence of degenerate primer amplification gained again and promptly gets goal gene.
5. the mensuration of tigar prawn cell periodic protein B gene
Resulting PCR product is after carrying out separation detection on 1.2% the agarose gel electrophoresis, behind the PCR product purification, be cloned in the pMD-18T carrier transformed into escherichia coli JM-109 competent cell, the picking positive colony checks order to plasmid DNA with 3730 sequenators.Sequencing result BLAST software (
Http:// www.ncbi.nim.nih.gov/) carry out homology mensuration, be defined as tigar prawn heat shock protein 90 dna homolog sequence.Comparison result is:
Score E
Sequences?producing?significant?alignments： (Bits) Value
gi|70997669|gb|AAZ17403.1|90?kDa?heat?shock?protein[Bemisia?ta
939 0.0
gi|54873686|gb|AAV41061.1|Hsp90beta[Xenopus?laevis]＞gi|506...
937 0.0
gi|70997651|gb|AAZ17402.1|90?kDa?heat?shock?protein[Bemisia?ta
934 0.0
gi|4835864|gb|AAD30275.1|heat?shock?protein?hsp90?beta[salmo?s
922 0.0
gi|42556386|gb|AAS19788.1|hsp-90[Chiromantes?haematocheir]
653 0.0
According to the report of Iron1995,, prove that promptly sequence is with a kind of gene order as long as then have absolute homology between two sequences with E-Value value after the comparison of BLAST software less than 0.005 between two sequences.After seeing tigar prawn target gene sequences BLAST comparison from comparing result, with the E value of the heat shock protein(HSP) pane gene of other species definitely less than 0.005, so prove that the goal gene of being cloned is the homologous sequence of heat shock protein(HSP) pane gene.
Sequence table
＜110〉Nanhai Aquatic Inst., Chinese Aquatic Scientific Research Inst
＜120〉Nucleotide of the gene of tigar prawn heat shock protein 90 and aminoacid sequence
<160>2
<210>1
<211>2514
<212>RNA
＜213〉tigar prawn (Penaeus monodon)
<220>
<221>3’UTP
<222>(2227)...(2514)
<220>
<221>5’UTP
<222>(1)...(63)
<220>
<221>CDS
<222>(64)...(2226)
<220>
<221>PolyA?site
<222>(2491)...(2514)
<220>
<221>PolyA?signal
<222>(2471)...(2475)
<400>1
caacacattccaaagccaacaactttttgttcctttgtcggtcaaagcttcacacattcc 60
aaaatg?cct?gag?gag?gtc?acc?acc?ggg?gag?gag?gag?gtc?ttc?gcg?ttc?cag?111
Met?Phe?Glu?Glu?Val?Thr?Thr?Gly?Glu?Glu?Glu?Val?Phe?Ala?Phe?Gln 16
1 7 13
gcg?gag?atc?gcg?cag?ctg?atg?tcc?ctg?atc?atc?aac?acc?ttc?tac?agc 159
Ala?Glu?Ile?Ala?Gln?Leu?Met?Ser?Leu?Ile?Ile?Asn?Thr?Phe?Tyr?Ser 32
17 23 29
aac?aag?gag?atc?ttc?ctg?cga?gag?ctg?atc?tcg?aac?tcg?tcc?gac?gcc 207
Asn?Lys?Glu?Ile?Phe?Leu?Arg?Glu?Leu?Ile?Ser?Asn?Ser?Ser?Asp?Ala 48
33 39 45
ctc?gac?aag?atc?cgc?tac?gag?tcg?ctg?acg?gac?ccg?tcc?aag?ctg?gag 255
Leu?Asp?Lys?Ile?Arg?Tyr?Glu?Ser?Leu?Thr?Asp?Pro?Ser?Lys?Leu?Glu 64
49 55 61
agc?ggc?aag?gac?ctg?ttc?atc?aag?ctg?gtg?ccc?aac?aag?gac?gac?cgc 303
Ser?Gly?Lys?Asp?Leu?Phe?Ile?Lys?Leu?Val?Pro?Asn?Lys?Asp?Asp?Arg 80
65 71 77
acg?ctc?acc?atc?atc?gac?agt?ggc?atc?ggc?atg?acc?aag?gcc?gac?ctg 351
Thr?Leu?Thr?Ile?Ile?Asp?Ser?Gly?Ile?Gly?Met?Thr?Lys?Ala?Asp?Leu 96
81 87 93
gtg?aac?aac?ctg?ggc?acc?atc?gcc?aag?tcg?ggc?aca?aag?gcc?ttc?atg 399
Val?Asn?Asn?Leu?Gly?Thr?Ile?Ala?Lys?Ser?Gly?Thr?Lys?Ala?Phe?Met 112
97 103 109
gag?gcg?ctg?cag?gcg?ggc?gcc?gac?atc?tcg?atg?atc?ggc?cag?ttc?ggc 447
Glu?Ala?Leu?Gln?Ala?Gly?Ala?Asp?Ile?Ser?Met?Ile?Gly?Gln?Phe?Gly 128
113 119 125
gtg?ggc?ttc?tac?tcc?gcg?tac?ctg?gtg?gcc?gac?aag?gtg?acc?gta?gtg 495
Val?Gly?Phe?Tyr?Ser?Ala?Tyr?Leu?Val?Ala?Asp?Lys?Val?Thr?Val?Val 144
129 135 141
tcg?agg?aac?aac?gac?gac?gaa?cag?tac?atc?tgg?gag?tcg?tcg?gcg?ggc 543
Ser?Arg?Asn?Asn?Asp?Asp?Glu?Gln?Tyr?Ile?Trp?Glu?Ser?Ser?Ala?Gly 160
145 151 157
ggg?tcg?ttc?acg?gtg?cgc?cac?gac?acc?ggt?gaa?ccc?atc?ggc?cgt?ggt 591
Gly?Ser?Phe?Thr?Val?Arg?His?Asp?Thr?Gly?Glu?Pro?Ile?Gly?Arg?Gly 176
161 167 173
aca?aag?atc?acc?ctc?cac?ctg?aag?gag?gac?cag?aca?gag?tac?ctc?gag 639
Thr?Lys?Ile?Thr?Leu?His?Leu?Lys?Glu?Asp?Gln?Thr?Glu?Tyr?Leu?Glu 192
177 183 189
gag?cgt?cgc?gtg?aag?gag?atc?gtg?aag?aag?cac?tcg?caa?ttc?att?ggc 687
Glu?Arg?Arg?Val?Lys?Glu?Ile?Val?Lys?Lys?His?Ser?Gln?Phe?Ile?Gly 208
193 199 205
tat?ccc?atc?aag?ctc?ctc?gtc?gag?aag?gag?agg?gac?aag?gaa?gtg?tct 735
Tyr?Pro?Ile?Lys?Leu?Leu?Val?Glu?Lys?Glu?Arg?Asp?Lys?Glu?Val?Ser 224
209 215 221
gac?gat?gag?gaa?gag?gag?aaa?gaa?gag?aag?gaa?gag?gaa?gca?gag?gag 783
Asp?Asp?Glu?Glu?Glu?Glu?Lys?Glu?Glu?Lys?Glu?Glu?Glu?Ala?Glu?Glu 240
225 231 237
gac?aag?ccc?aaa?atc?gaa?gat?gta?ggc?gag?gac?gaa?gaa?gcc?gac?aaa 831
Asp?Lys?Pro?Lys?Ile?Glu?Asp?Val?Gly?Glu?Asp?Glu?Glu?Ala?Asp?Lys 256
241 247 253
gag?aag?ggc?gaa?gac?aag?aag?aaa?aag?aag?acg?gtg?aag?gag?aag?tac 879
Glu?Lys?Gly?Glu?Asp?Lys?Lys?Lys?Lys?Lys?Thr?Val?Lys?Glu?Lys?Tyr 272
257 263 269
acg?gag?gac?gaa?gag?ctg?aac?aag?acg?aag?ccc?ctg?tgg?acg?cgc?aac 927
Thr?Glu?Asp?Glu?Glu?Leu?Asn?Lys?Thr?Lys?Pro?Leu?Trp?Thr?Arg?Asn 288
273 279 285
ccc?gac?gac?atc?tcg?aag?gag?gag?tac?ggc?gag?ttc?tac?aag?tcg?ctg 975
Pro?Asp?Asp?Ile?Ser?Lys?Glu?Glu?Tyr?Gly?Glu?Phe?Tyr?Lys?Ser?Leu 304
289 295 301
acc?aac?gac?tgg?gag?gac?cac?ctg?gcc?gtg?aag?cac?ttc?agc?gtg?gag 1023
Thr?Asn?Asp?Trp?Glu?Asp?His?Leu?Ala?Val?Lys?His?Phe?Ser?Val?Glu 320
305 311 317
ggc?cag?ctt?gag?ttc?cgc?gcc?ctc?ctg?ttc?ctg?ccg?cgc?cgc?gcc?ccc 1071
Gly?Gln?Leu?Glu?Phe?Arg?Ala?Leu?Leu?Phe?Leu?Pro?Arg?Arg?Ala?Pro 336
321 327 333
ttc?gac?ctg?ttc?gag?aac?cgc?aag?cag?aag?aac?aag?atc?aag?ctg?tac 1119
Phe?Asp?Leu?Phe?Glu?Asn?Arg?Lys?Gln?Lys?Asn?Lys?Ile?Lys?Leu?Tyr 352
337 343 349
gtg?cgt?cgc?gtg?ttc?atc?atg?gag?aac?tgc?gag?gaa?ctg?atc?ccc?gag 1167
Val?Arg?Arg?Val?Phe?Ile?Met?Glu?Asn?Cys?Glu?Glu?Leu?Ile?Pro?Glu 368
353 359 365
tac?ctg?aac?ttc?atc?aac?ggt?gtc?gtc?gac?tcc?gag?gat?ctg?cct?ctc 1215
Tyr?Leu?Asn?Phe?Ile?Asn?Gly?Val?Val?Asp?Ser?Glu?Asp?Leu?Pro?Leu 384
369 375 381
aac?atc?tct?cgt?gag?atg?ctg?caa?cag?aac?aag?atc?ctg?aaa?gtt?atc 1263
Asn?Ile?Ser?Arg?Glu?Met?Leu?Gln?Gln?Asn?Lys?Ile?Leu?Lys?Val?Ile 400
385 391 397
agg?aag?aat?ctc?gtc?aag?aag?acc?ctc?gaa?ctt?ttt?gaa?gaa?att?gtt 1311
Arg?Lys?Asn?Leu?Val?Lys?Lys?Thr?Leu?Glu?Leu?Phe?Glu?Glu?Ile?Val 416
401 407 413
gac?gac?aag?gaa?agc?tac?aag?aag?ttc?tac?gaa?aac?ttc?tcc?aag?aac 1359
Asp?Asp?Lys?Glu?Ser?Tyr?Lys?Lys?Phe?Tyr?Glu?Asn?Phe?Ser?Lys?Asn 432
417 423 429
ctc?aaa?ctc?gga?atc?cac?gag?gat?tcc?acc?aac?cgc?aag?aag?ctt?gcc 1407
Leu?Lys?Leu?Gly?Ile?His?Glu?Asp?Ser?Thr?Asn?Arg?Lys?Lys?Leu?Ala 448
433 439 445
gaa?ttc?ctg?agg?tac?cac?act?tct?gcc?tct?ggc?gac?gaa?atg?tcc?tcc 1455
Glu?Phe?Leu?Arg?Tyr?His?Thr?Ser?Ala?Ser?Gly?Asp?Glu?Met?Ser?Ser 464
449 455 461
ctc?aag?gag?tac?gtg?tcc?cgc?atg?aag?gag?aac?cag?aag?cac?atc?tac 1503
Leu?Lys?Glu?Tyr?Val?Ser?Arg?Met?Lys?Glu?Asn?Gln?Lys?His?Ile?Tyr 480
465 471 477
ttc?atc?act?ggc?gag?act?cgc?gaa?cag?gtg?cag?aac?tct?gcc?ttc?gtg 1551
Phe?Ile?Thr?Gly?Glu?Thr?Arg?Glu?Gln?Val?Gln?Asn?Ser?Ala?Phe?Val 496
481 487 493
gag?agg?gtg?aag?aag?cgc?ggc?ttc?gag?gtc?atc?tac?atg?acc?gaa?ccc 1599
Glu?Arg?Val?Lys?Lys?Arg?Gly?Phe?Glu?Val?Ile?Tyr?Met?Thr?Glu?Pro 512
497 503 509
atc?gac?gaa?tac?tgc?gtt?cag?cag?ctg?aag?gaa?tac?gac?ggg?aag?cag 1647
Ile?Asp?Glu?Tyr?Cys?Val?Gln?Gln?Leu?Lys?Glu?Tyr?Asp?Gly?Lys?Gln 528
513 519 525
ctt?gtc?tcg?gtg?acg?aag?gaa?ggc?ctt?gaa?ctc?ccc?gag?gac?gag?gag 1696
Leu?Val?Ser?Val?Thr?Lys?Glu?Gly?Leu?Glu?Leu?Pro?Glu?Asp?Glu?Glu 544
529 535 541
gag?aaa?aag?aag?ttc?gag?gaa?cag?aag?acc?aag?ttc?gag?aac?ctg?tgc 1743
Glu?Lys?Lys?Lys?Phe?Glu?Glu?Gln?Lys?Thr?Lys?Phe?Glu?Asn?Leu?Cys 560
545 551 557
aag?gta?atg?aag?gac?att?ttg?gac?aag?cgc?gtt?gag?aag?gtg?gtg?gtg 1791
Lys?Val?Met?Lys?Asp?Ile?Leu?Asp?Lys?Arg?Val?Glu?Lys?Val?Val?Val 576
561 567 573
agc?aac?cgg?ctg?gtg?acc?tct?ccg?tgc?tgc?atc?gtg?acc?tcc?cag?tac 1839
Ser?Asn?Arg?Leu?Val?Thr?Ser?Pro?Cys?Cys?Ile?Val?Thr?Ser?Gln?Tyr 592
577 583 589
ggc?tgg?acc?gcc?aac?atg?gag?cgc?atc?atg?aag?gct?cag?gcg?ctg?agg 1887
Gly?Trp?Thr?Ala?Asn?Met?Glu?Arg?Ile?Met?Lys?Ala?Gln?Ala?Leu?Arg 608
593 599 605
gac?acc?tcg?acc?atg?ggc?tac?atg?gcc?gcc?aag?aag?cac?ctt?gag?atc 1935
Asp?Thr?Ser?Thr?Met?Gly?Tyr?Met?Ala?Ala?Lys?Lys?His?Leu?Glu?Ile 624
609 615 621
aac?ccc?gac?cac?agc?atc?atc?gaa?acc?ctg?aga?caa?aag?gcg?gat?gcc 1983
Asn?Pro?Asp?His?Ser?Ile?Ile?Glu?Thr?Leu?Arg?Gln?Lys?Ala?Asp?Ala 640
625 631 637
gac?aag?aac?gac?aag?tct?gtg?aag?gat?ctg?gtg?atg?ctg?ctg?ttc?gag 2031
Asp?Lys?Asn?Asp?Lys?Ser?Val?Lys?Asp?Leu?Val?Met?Leu?Leu?Phe?Glu 656
641 647 653
agc?tcc?ctt?ctg?tcg?tct?ggc?ttc?agc?ctg?gag?gac?cca?ggt?gtc?cac 2079
Ser?Ser?Leu?Leu?Ser?Ser?Gly?Phe?Ser?Leu?Glu?Asp?Pro?Gly?Val?His 672
657 663 669
gcc?agc?cgc?atc?tac?aga?atg?atc?aag?ctt?ggc?ctg?ggt?att?gac?gag 2127
Ala?Ser?Arg?Ile?Tyr?Arg?Met?Ile?Lys?Leu?Gly?Leu?Gly?Ile?Asp?Glu 688
673 679 685
gag?gac?gcc?ccg?atg?gag?gag?gcc?gag?acc?ttg?gag?gag?gat?atg?ccc 2175
Glu?Asp?Ala?Pro?Met?Glu?Glu?Ala?Glu?Thr?Leu?Glu?Glu?Asp?Met?Pro 704
689 695 701
ccc?ctc?gaa?ggt?gat?gac?gag?gac?gcc?tct?cgc?atg?gaa?gaa?gtc?gat 2223
Pro?Leu?Glu?Gly?Asp?Asp?Glu?Asp?Ala?Ser?Arg?Met?Glu?Glu?Val?Asp 720
705 711 717
taa 2226
atattcgtcacaacttaaaatattcacccattatataccaaagctaatcattgtcattca 2286
ttcgggaaccaaaatacttctctaatcttggtatattttggcttctctggctttcatcat 2346
tccgatcacgcccaacattccataagatttaaacaagcattagttttagttatagacaaa 2406
gatatattctgttataaggatttattctttcgtttatgtaaataatttgtaacaactttg 2466
ttacaataaaactcgagaccatttaaaaaaaaaaaaaaaaaaaaaaaa 2514
<210>2
<211>720
<212>PRT
＜213〉tigar prawn (Penaeus monodon)
<400>2
Met?Phe?Glu?Glu?Val?Thr?Thr?Gly?Glu?Glu?Glu?Val?Phe?Ala?Phe?Gln 16
1 7 13
Ala?Glu?Ile?Ala?Gin?Leu?Met?Ser?Leu?Ile?Ile?Asn?Thr?Phe?Tyr?Ser 32
17 23 29
Asn?Lys?Glu?Ile?Phe?Leu?Arg?Glu?Leu?Ile?Ser?Ash?Ser?Ser?Asp?Ala 48
33 39 45
Leu?Asp?Lys?Ile?Arg?Tyr?Glu?Ser?Leu?Thr?Asp?Pro?Ser?Lys?Leu?Glu 64
49 55 61
Ser?Gly?Lys?Asp?Leu?Phe?Ile?Lys?Leu?Val?Pro?Asn?Lys?Asp?Asp?Arg 80
65 71 77
Thr?Leu?Thr?Ile?Ile?Asp?Ser?Gly?Ile?Gly?Met?Thr?Lys?Ala?Asp?Leu 96
81 87 93
Val?Asn?Asn?Leu?Gly?Thr?Ile?Ala?Lys?Ser?Gly?Thr?Lys?Ala?Phe?Met 112
97 103 109
Glu?Ala?Leu?Gln?Ala?Gly?Ala?Asp?Ile?Ser?Met?Ile?Gly?Gln?Phe?Gly 128
113 119 125
Val?Gly?Phe?Tyr?Ser?Ala?Tyr?Leu?Val?Ala?Asp?Lys?Val?Thr?Val?Val 144
129 135 141
Ser?Arg?Asn?Asn?Asp?Asp?Glu?Gln?Tyr?Ile?Trp?Glu?Ser?Ser?Ala?Gly 160
145 151 157
Gly?Ser?Phe?Thr?Val?Arg?His?Asp?Thr?Gly?Glu?Pro?Ile?Gly?Arg?Gly 176
161 167 173
Thr?Lys?Ile?Thr?Leu?His?Leu?Lys?Glu?Asp?Gln?Thr?Glu?Tyr?Leu?Glu 192
177 183 189
Glu?Arg?Arg?Val?Lys?Glu?Ile?Val?Lys?Lys?His?Ser?Gln?Phe?Ile?Gly 208
193 199 205
Tyr?Pro?Ile?Lys?Leu?Leu?Val?Glu?Lys?Glu?Arg?Asp?Lys?Glu?Val?Ser 224
209 215 221
Asp?Asp?Glu?Glu?Glu?Glu?Lys?Glu?Glu?Lys?Glu?Glu?Glu?Ala?Glu?Glu 240
225 231 237
Asp?Lys?Pro?Lys?Ile?Glu?Asp?Val?Gly?Glu?Asp?Glu?Glu?Ala?Asp?Lys 256
241 247 253
Glu?Lys?Gly?Glu?Asp?Lys?Lys?Lys?Lys?Lys?Thr?Val?Lys?Glu?Lys?Tyr 272
257 263 269
Thr?Glu?Asp?Glu?Glu?Leu?Asn?Lys?Thr?Lys?Pro?Leu?Trp?Thr?Arg?Asn 288
273 279 285
Pro?Asp?Asp?Ile?Ser?Lys?Glu?Glu?Tyr?Gly?Glu?Phe?Tyr?Lys?Ser?Leu 304
289 295 301
Thr?Asn?Asp?Trp?Glu?Asp?His?Leu?Ala?Val?Lys?His?Phe?Ser?Val?Glu 320
305 311 317
Gly?Gln?Leu?Glu?Phe?Arg?Ala?Leu?Leu?Phe?Leu?Pro?Arg?Arg?Ala?Pro 336
321 327 333
Phe?Asp?Leu?Phe?Glu?Asn?Arg?Lys?Gln?Lys?Asn?Lys?Ile?Lys?Leu?Tyr 352
337 343 349
Val?Arg?Arg?Val?Phe?Ile?Met?Glu?Asn?Cys?Glu?Glu?Leu?Ile?Pro?Glu 368
353 359 365
Tyr?Leu?Asn?Phe?Ile?Asn?Gly?Val?Val?Asp?Ser?Glu?Asp?Leu?Pro?Leu 384
369 375 381
Asn?Ile?Ser?Arg?Glu?Met?Leu?Gln?Gln?Asn?Lys?Ile?Leu?Lys?Val?Ile 400
385 391 397
Arg?Lys?Asn?Leu?Val?Lys?Lys?Thr?Leu?Glu?Leu?Phe?Glu?Glu?Ile?Val 416
401 407 413
Asp?Asp?Lys?Glu?Ser?Tyr?Lys?Lys?Phe?Tyr?Glu?Asn?Phe?Ser?Lys?Asn 432
417 423 429
Leu?Lys?Leu?Gly?Ile?His?Glu?Asp?Ser?Thr?Asn?Arg?Lys?Lys?Leu?Ala 448
433 439 445
Glu?Phe?Leu?Arg?Tyr?His?Thr?Ser?Ala?Ser?Gly?Asp?Glu?Met?Ser?Ser 464
449 455 461
Leu?Lys?Glu?Tyr?Val?Ser?Arg?Met?Lys?Glu?Asn?Gln?Lys?His?Ile?Tyr 480
465 471 477
Phe?Ile?Thr?Gly?Glu?Thr?Arg?Glu?Gln?Val?Gln?Asn?Ser?Ala?Phe?Val 496
481 487 493
Glu?Arg?Val?Lys?Lys?Arg?Gly?Phe?Glu?Val?Ile?Tyr?Met?Thr?Glu?Pro 512
497 503 509
Ile?Asp?Glu?Tyr?Cys?Val?Gln?Gln?Leu?Lys?Glu?Tyr?Asp?Gly?Lys?Gln 528
513 519 525
Leu?Val?Ser?Val?Thr?Lys?Glu?Gly?Leu?Glu?Leu?Pro?Glu?Asp?Glu?Glu 544
529 535 541
Glu?Lys?Lys?Lys?Phe?Glu?Glu?Gln?Lys?Thr?Lys?Phe?Glu?Asn?Leu?Cys 560
545 551 557
Lys?Val?Met?Lys?Asp?Ile?Leu?Asp?Lys?Arg?Val?Glu?Lys?Val?Val?Val 576
561 567 573
Ser?Asn?Arg?Leu?Val?Thr?Ser?Pro?Cys?Cys?Ile?Val?Thr?Ser?Gln?Tyr 592
577 583 589
Gly?Trp?Thr?Ala?Asn?Met?Glu?Arg?Ile?Met?Lys?Ala?Gln?Ala?Leu?Arg 608
593 599 605
Asp?Thr?Ser?Thr?Met?Gly?Tyr?Met?Ala?Ala?Lys?Lys?His?Leu?Glu?Ile 624
609 615 621
Asn?Pro?Asp?His?Ser?Ile?Ile?Glu?Thr?Leu?Arg?Gln?Lys?Ala?Asp?Ala 640
625 631 637
Asp?Lys?Asn?Asp?Lys?Ser?Val?Lys?Asp?Leu?Val?Met?Leu?Leu?Phe?Glu 656
641 647 653
Ser?Ser?Leu?Leu?Ser?Ser?Gly?Phe?Ser?Leu?Glu?Asp?Pro?Gly?Val?His 672
657 663 669
Ala?Ser?Arg?Ile?Tyr?Arg?Met?Ile?Lys?Leu?Gly?Leu?Gly?Ile?Asp?Glu 688
673 679 685
Glu?Asp?Ala?Pro?Met?Glu?Glu?Ala?Glu?Thr?Leu?Glu?Glu?Asp?Met?Pro 704
689 695 701
Pro?Leu?Glu?Gly?Asp?Asp?Glu?Asp?Ala?Ser?Arg?Met?Glu?Glu?Val?Asp 720
705 711 717
Claims (1)
1, a kind of tigar prawn heat shock protein(HSP) pane gene is characterized in that having following RNA Nucleotide and amino acid sequence corresponding:
caacacattccaaagccaacaactttttgttcctttgtcggtcaaagcttcacacattcc 60
aaaatg?cct?gag?gag?gtc?acc?acc?ggg?gag?gag?gag?gtc?ttc?gcg?ttc?cag?111
Met?Phe?Glu?Glu?Val?Thr?Thr?Gly?Glu?Glu?Glu?Val?Phe?Ala?Phe?Gln?16
1 7 13
gcg?gag?atc?gcg?cag?ctg?atg?tcc?ctg?atc?atc?aac?acc?ttc?tac?agc 159
Ala?Glu?Ile?Ala?Gln?Leu?Met?Ser?Leu?Ile?Ile?Asn?Thr?Phe?Tyr?Ser 32
17 23 29
aac?aag?gag?atc?ttc?ctg?cga?gag?ctg?atc?tcg?aac?tcg?tcc?gac?gcc 207
Asn?Lys?Glu?Ile?Phe?Leu?Arg?Glu?Leu?Ile?Ser?Asn?Ser?Ser?Asp?Ala 48
33 39 45
ctc?gac?aag?atc?cgc?tac?gag?tcg?ctg?acg?gac?ccg?tcc?aag?ctg?gag 255
Leu?Asp?Lys?Ile?Arg?Tyr?Glu?Ser?Leu?Thr?Asp?Pro?Ser?Lys?Leu?Glu 64
49 55 61
agc?ggc?aag?gac?ctg?ttc?atc?aag?ctg?gtg?ccc?aac?aag?gac?gac?cgc 303
Ser?Gly?Lys?Asp?Leu?Phe?Ile?Lys?Leu?Val?Pro?Asn?Lys?Asp?Asp?Arg 80
65 71 77
acg?ctc?acc?atc?atc?gac?agt?ggc?atc?ggc?atg?acc?aag?gcc?gac?ctg 351
Thr?Leu?Thr?Ile?Ile?Asp?Ser?Gly?Ile?Gly?Met?Thr?Lys?Ala?Asp?Leu 96
81 87 93
gtg?aac?aac?ctg?ggc?acc?atc?gcc?aag?tcg?ggc?aca?aag?gcc?ttc?atg 399
Val?Asn?Asn?Leu?Gly?Thr?Ile?Ala?Lys?Ser?Gly?Thr?Lys?Ala?Phe?Met 112
97 103 109
gag?gcg?ctg?cag?gcg?ggc?gcc?gac?atc?tcg?atg?atc?ggc?cag?ttc?ggc 447
Glu?Ala?Leu?Gln?Ala?Gly?Ala?Asp?Ile?Ser?Met?Ile?Gly?Gln?Phe?Gly 128
113 119 125
gtg?ggc?ttc?tac?tcc?gcg?tac?ctg?gtg?gcc?gac?aag?gtg?acc?gta?gtg 495
Val?Gly?Phe?Tyr?Ser?Ala?Tyr?Leu?Val?Ala?Asp?Lys?Val?Thr?Val?Val 144
129 135 141
tcg?agg?aac?aac?gac?gac?gaa?cag?tac?atc?tgg?gag?tcg?tcg?gcg?ggc 543
Ser?Arg?Asn?Asn?Asp?Asp?Glu?Gln?Tyr?Ile?Trp?Glu?Ser?Ser?Ala?Gly 160
145 151 157
ggg?tcg?ttc?acg?gtg?cgc?cac?gac?acc?ggt?gaa?ccc?atc?ggc?cgt?ggt 591
Gly?Ser?Phe?Thr?Val?Arg?His?Asp?Thr?Gly?Glu?Pro?Ile?Gly?Arg?Gly 176
161 167 173
aca?aag?atc?acc?ctc?cac?ctg?aag?gag?gac?cag?aca?gag?tac?ctc?gag 639
Thr?Lys?Ile?Thr?Leu?His?Leu?Lys?Glu?Asp?Gln?Thr?Glu?Tyr?Leu?Glu 192
177 183 189
gag?cgt?cgc?gtg?aag?gag?atc?gtg?aag?aag?cac?tcg?caa?ttc?att?ggc 687
Glu?Arg?Arg?Val?Lys?Glu?Ile?Val?Lys?Lys?His?Ser?Gln?Phe?Ile?Gly 208
193 199 205
tat?ccc?atc?aag?ctc?ctc?gtc?gag?aag?gag?agg?gac?aag?gaa?gtg?tct 735
Tyr?Pro?Ile?Lys?Leu?Leu?Val?Glu?Lys?Glu?Arg?Asp?Lys?Glu?Val?Ser 224
209 215 221
gac?gat?gag?gaa?gag?gag?aaa?gaa?gag?aag?gaa?gag?gaa?gca?gag?gag 783
Asp?Asp?Glu?Glu?Glu?Glu?Lys?Glu?Glu?Lys?Glu?Glu?Glu?Ala?Glu?Glu 240
225 231 237
gac?aag?ccc?aaa?atc?gaa?gat?gta?ggc?gag?gac?gaa?gaa?gcc?gac?aaa 831
Asp?Lys?Pro?Lys?Ile?Glu?Asp?Val?Gly?Glu?Asp?Glu?Glu?Ala?Asp?Lys 256
241 247 253
gag?aag?ggc?gaa?gac?aag?aag?aaa?aag?aag?acg?gtg?aag?gag?aag?tac 879
Glu?Lys?Gly?Glu?Asp?Lys?Lys?Lys?Lys?Lys?Thr?Val?Lys?Glu?Lys?Tyr 272
257 263 269
acg?gag?gac?gaa?gag?ctg?aac?aag?acg?aag?ccc?ctg?tgg?acg?cgc?aac 927
Thr?Glu?Asp?Glu?Glu?Leu?Asn?Lys?Thr?Lys?Pro?Leu?Trp?Thr?Arg?Asn 288
273 279 285
ccc?gac?gac?atc?tcg?aag?gag?gag?tac?ggc?gag?ttc?tac?aag?tcg?ctg 975
Pro?Asp?Asp?Ile?Ser?Lys?Glu?Glu?Tyr?Gly?Glu?Phe?Tyr?Lys?Ser?Leu 304
289 295 301
acc?aac?gac?tgg?gag?gac?cac?ctg?gcc?gtg?aag?cac?ttc?agc?gtg?gag 1023
Thr?Asn?Asp?Trp?Glu?Asp?His?Leu?Ala?Val?Lys?His?Phe?Ser?Val?Glu 320
305 311 317
ggc?cag?ctt?gag?ttc?cgc?gcc?ctc?ctg?ttc?ctg?ccg?cgc?cgc?gcc?ccc 1071
Gly?Gln?Leu?Glu?Phe?Arg?Ala?Leu?Leu?Phe?Leu?Pro?Arg?Arg?Ala?Pro 336
321 327 333
ttc?gac?ctg?ttc?gag?aac?cgc?aag?cag?aag?aac?aag?atc?aag?ctg?tac 1119
Phe?Asp?Leu?Phe?Glu?Asn?Arg?Lys?Gln?Lys?Asn?Lys?Ile?Lys?Leu?Tyr 352
337 343 349
gtg?cgt?cgc?gtg?ttc?atc?atg?gag?aac?tgc?gag?gaa?ctg?atc?ccc?gag 1167
Val?Arg?Arg?Val?Phe?Ile?Met?Glu?Asn?Cys?Glu?Glu?Leu?Ile?Pro?Glu 368
353 359 365
tac?ctg?aac?ttc?atc?aac?ggt?gtc?gtc?gac?tcc?gag?gat?ctg?cct?ctc 1215
Tyr?Leu?Asn?Phe?Ile?Asn?Gly?Val?Val?Asp?Ser?Glu?Asp?Leu?Pro?Leu 384
369 375 381
aac?atc?tct?cgt?gag?atg?ctg?caa?cag?aac?aag?atc?ctg?aaa?gtt?atc 1263
Asn?Ile?Ser?Arg?Glu?Met?Leu?Gln?Gln?Asn?Lys?Ile?Leu?Lys?Val?Ile 400
385 391 397
agg?aag?aat?ctc?gtc?aag?aag?acc?ctc?gaa?ctt?ttt?gaa?gaa?att?gtt 1311
Arg?Lys?Asn?Leu?Val?Lys?Lys?Thr?Leu?Glu?Leu?Phe?Glu?Glu?Ile?Val 416
401 407 413
gac?gac?aag?gaa?agc?tac?aag?aag?ttc?tac?gaa?aac?ttc?tcc?aag?aac 1359
Asp?Asp?Lys?Glu?Ser?Tyr?Lys?Lys?Phe?Tyr?Glu?Asn?Phe?Ser?Lys?Asn 432
417 423 429
ctc?aaa?ctc?gga?atc?cac?gag?gat?tcc?acc?aac?cgc?aag?aag?ctt?gcc 1407
Leu?Lys?Leu?Gly?Ile?His?Glu?Asp?Ser?Thr?Asn?Arg?Lys?Lys?Leu?Ala 448
433 439 445
gaa?ttc?ctg?agg?tac?cac?act?tct?gcc?tct?ggc?gac?gaa?atg?tcc?tcc 1455
Glu?Phe?Leu?Arg?Tyr?His?Thr?Ser?Ala?Ser?Gly?Asp?Glu?Met?Ser?Ser 464
449 455 461
ctc?aag?gag?tac?gtg?tcc?cgc?atg?aag?gag?aac?cag?aag?cac?atc?tac 1503
Leu?Lys?Glu?Tyr?Val?Ser?Arg?Met?Lys?Glu?Asn?Gln?Lys?His?Ile?Tyr 480
465 471 477
ttc?atc?act?ggc?gag?act?cgc?gaa?cag?gtg?cag?aac?tct?gcc?ttc?gtg 1551
Phe?Ile?Thr?Gly?Glu?Thr?Arg?Glu?Gln?Val?Gln?Asn?Ser?Ala?Phe?Val 496
481 487 493
gag?agg?gtg?aag?aag?cgc?ggc?ttc?gag?gtc?atc?tac?atg?acc?gaa?ccc 1599
Glu?Arg?Val?Lys?Lys?Arg?Gly?Phe?Glu?Val?Ile?Tyr?Met?Thr?Glu?Pro 512
497 503 509
atc?gac?gaa?tac?tgc?gtt?cag?cag?ctg?aag?gaa?tac?gac?ggg?aag?cag 1647
Ile?Asp?Glu?Tyr?Cys?Val?Gln?Gln?Leu?Lys?Glu?Tyr?Asp?Gly?Lys?Gln 528
513 519 525
ctt?gtc?tcg?gtg?acg?aag?gaa?ggc?ctt?gaa?ctc?ccc?gag?gac?gag?gag 1696
Leu?Val?Ser?Val?Thr?Lys?Glu?Gly?Leu?Glu?Leu?Pro?Glu?Asp?Glu?Glu 544
529 535 541
gag?aaa?aag?aag?ttc?gag?gaa?cag?aag?acc?aag?ttc?gag?aac?ctg?tgc 1743
Glu?Lys?Lys?Lys?Phe?Glu?Glu?Gln?Lys?Thr?Lys?Phe?Glu?Asn?Leu?Cys 560
545 551 557
aag?gta?atg?aag?gac?att?ttg?gac?aag?cgc?gtt?gag?aag?gtg?gtg?gtg 1791
Lys?Val?Met?Lys?Asp?Ile?Leu?Asp?Lys?Arg?Val?Glu?Lys?Val?Val?Val 576
561 567 573
agc?aac?cgg?ctg?gtg?acc?tct?ccg?tgc?tgc?atc?gtg?acc?tcc?cag?tac 1839
Ser?Asn?Arg?Leu?Val?Thr?Ser?Pro?Cys?Cys?Ile?Val?Thr?Ser?Gln?Tyr 592
577 583 589
ggc?tgg?acc?gcc?aac?atg?gag?cgc?atc?atg?aag?gct?cag?gcg?ctg?agg 1887
Gly?Trp?Thr?Ala?Asn?Met?Glu?Arg?Ile?Met?Lys?Ala?Gln?Ala?Leu?Arg 608
593 599 605
gac?acc?tcg?acc?atg?ggc?tac?atg?gcc?gcc?aag?aag?cac?ctt?gag?atc 1935
Asp?Thr?Ser?Thr?Met?Gly?Tyr?Met?Ala?Ala?Lys?Lys?His?Leu?Glu?Ile 624
609 615 621
aac?ccc?gac?cac?agc?atc?atc?gaa?acc?ctg?aga?caa?aag?gcg?gat?gcc 1983
Asn?Pro?Asp?His?Ser?Ile?Ile?Glu?Thr?Leu?Arg?Gln?Lys?Ala?Asp?Ala 640
625 631 637
gac?aag?aac?gac?aag?tct?gtg?aag?gat?ctg?gtg?atg?ctg?ctg?ttc?gag 2031
Asp?Lys?Asn?Asp?Lys?Ser?Val?Lys?Asp?Leu?Val?Met?Leu?Leu?Phe?Glu 656
641 647 653
agc?tcc?ctt?ctg?tcg?tct?ggc?ttc?agc?ctg?gag?gac?cca?ggt?gtc?cac 2079
Ser?Ser?Leu?Leu?Ser?Ser?Gly?Phe?Ser?Leu?Glu?Asp?Pro?Gly?Val?His 672
657 663 669
gcc?agc?cgc?atc?tac?aga?atg?atc?aag?ctt?ggc?ctg?ggt?att?gac?gag 2127
Ala?Ser?Arg?Ile?Tyr?Arg?Met?Ile?Lys?Leu?Gly?Leu?Gly?Ile?Asp?Glu 688
673 679 685
gag?gac?gcc?ccg?atg?gag?gag?gcc?gag?acc?ttg?gag?gag?gat?atg?ccc 2175
Glu?Asp?Ala?Pro?Met?Glu?Glu?Ala?Glu?Thr?Leu?Glu?Glu?Asp?Met?Pro 704
689 695 701
ccc?ctc?gaa?ggt?gat?gac?gag?gac?gcc?tct?cgc?atg?gaa?gaa?gtc?gat 2223
Pro?Leu?Glu?Gly?Asp?Asp?Glu?Asp?Ala?Ser?Arg?Met?Glu?Glu?Val?Asp 720
705 711 717
taa 2226
atattcgtcacaacttaaaatattcacccattatataccaaagctaatcattgtcattca 2286
ttcgggaaccaaaatacttctctaatcttggtatattttggcttctctggctttcatcat 2346
tccgatcacgcccaacattccataagatttaaacaagcattagttttagttatagacaaa 2406
gatatattctgttataaggatttattctttcgtttatgtaaataatttgtaacaactttg 2466
ttacaataaaactcgagaccatttaaaaaaaaaaaaaaaaaaaaaaaa 2514
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610037558 CN1928084A (en) | 2006-09-07 | 2006-09-07 | Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 |
| CN 200710089975 CN101092623A (en) | 2006-09-07 | 2007-03-26 | Gene order of heat shock protein 90 of sugpo prawn |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610037558 CN1928084A (en) | 2006-09-07 | 2006-09-07 | Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1928084A true CN1928084A (en) | 2007-03-14 |
Family
ID=37858217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610037558 Pending CN1928084A (en) | 2006-09-07 | 2006-09-07 | Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1928084A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611341A (en) * | 2015-02-13 | 2015-05-13 | 中国水产科学研究院南海水产研究所 | Penaeus monodon heat shock protein 10 gene and encoded protein thereof |
-
2006
- 2006-09-07 CN CN 200610037558 patent/CN1928084A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104611341A (en) * | 2015-02-13 | 2015-05-13 | 中国水产科学研究院南海水产研究所 | Penaeus monodon heat shock protein 10 gene and encoded protein thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1861799A (en) | Improved overlap extension PCR process and mutation gene obtained thereby | |
| CN1854154A (en) | Rice blast resistant related protein, its coding gene and use | |
| CN1730491A (en) | Cat omega interferon and encoding gene thereof and application | |
| CN1239713C (en) | Application of ion channel inhibitor for curing arhythmia | |
| CN1928084A (en) | Nucleotide and amino acid sequence of gene of penaeus monodon heat shock protein 90 | |
| CN1693473A (en) | Method of prepairing peltoglucose syrup and high temperature resistant glucose isomerase mutant | |
| CN1827640A (en) | Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof | |
| CN100339479C (en) | Gene participating in the synthesis of brassinosteroid | |
| CN100344759C (en) | cDNA sequence of dehydrolysis responding transcription factor DREB gene of wheal | |
| CN1295334C (en) | Wheat antidisense related gene TaEDR1 and its application | |
| CN1163604C (en) | Attenuated virus oka strain gene 62 and method for identifying virus strain for attenuated live vaccine by using same | |
| CN1256431C (en) | Recombined human parathyroid hormone gene, its expression carrier and preparing method of recombined human parathyroid protein | |
| CN1242061C (en) | Short finger gene | |
| CN1798837A (en) | Thioredoxin modification | |
| CN101054412A (en) | Pathogenic gene for far end arthrosis bend, detection method and application thereof | |
| CN1280415C (en) | Wheat disease-resistant gene Lr-L1 and its use | |
| CN1249083C (en) | Polypeptide drug for inhibiting SARS coronavirus from infecting host cell | |
| CN101054583A (en) | Gene sequence of penaeus monodon cell periodic protein B | |
| CN1182245C (en) | Brachydactyly and body height associated gene | |
| CN1119418C (en) | D-amino acid oxidase of red teliosporeae | |
| CN1304580C (en) | Surface glucoprotein gp160 of recombination expression human acquired immunity defact virus 1 | |
| CN1214113C (en) | Gene sequence of Japanese shistosome China mainland strain gynecophoric canal protein | |
| CN1495195A (en) | Transgenic animal for expressing androgen receptor compound relatea protein | |
| CN1786030A (en) | Pig production and immunity related protein, its coding gene and application | |
| CN1807639A (en) | L-lactate dehydrogenase gene and its coded amino acid sequence and the primer designed in preparation process |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |