CN1861799A - Improved overlap extension PCR process and mutation gene obtained thereby - Google Patents

Improved overlap extension PCR process and mutation gene obtained thereby Download PDF

Info

Publication number
CN1861799A
CN1861799A CN 200510046414 CN200510046414A CN1861799A CN 1861799 A CN1861799 A CN 1861799A CN 200510046414 CN200510046414 CN 200510046414 CN 200510046414 A CN200510046414 A CN 200510046414A CN 1861799 A CN1861799 A CN 1861799A
Authority
CN
China
Prior art keywords
ala
asp
gly
leu
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 200510046414
Other languages
Chinese (zh)
Other versions
CN100460515C (en
Inventor
吴文芳
安迎锋
吕安国
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Applied Ecology of CAS
Original Assignee
Institute of Applied Ecology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Applied Ecology of CAS filed Critical Institute of Applied Ecology of CAS
Priority to CNB2005100464149A priority Critical patent/CN100460515C/en
Publication of CN1861799A publication Critical patent/CN1861799A/en
Application granted granted Critical
Publication of CN100460515C publication Critical patent/CN100460515C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the method of gene fixed-point mutation which is a modified overlap extension PCR method and the mutated gene. The process includes the fragment composition, the double mixing, the prepared extension, the whole DNA composition and after extension. The method is detected by the synzyme gene sam1 from the SAM of the Saccharomyces cerevisiae and gets the mutated gene modified by the rare coden. The SAM synzyme encoding by the gene can express in the yeast and improves the yield of the intracellular SAM. The invention can reach the many fixed-point mutations in a same reaction process.

Description

A kind of improved overlapping extension PCR method and the mutator gene that is obtained thereof
Technical field
The present invention relates to the method for site-directed point mutation, a kind of specifically improved overlapping extension PCR method and the mutator gene that is obtained thereof are a kind of genetic modification methods that can realize the multipoint positioning sudden change in a reaction process.
Background technology
(site-directed mutagenesis SDM) just is meant that the specific site introducing at gene suddenlys change, and promptly inserts, lacks or replace the nucleotide sequence of certain-length in known dna sequence dna to rite-directed mutagenesis.This method has been widely used in the research of aspects such as gene expression regulation, gene structure and function and protein properties.
The method of generation SDM is the most common to be to adopt Overlap extension PCR (OE-PCR) mediation rite-directed mutagenesis, the folded extension PCR of weighing again.This technology be with two or more gene fragments by the method for terminal complementation, overlapping extension carry out outer-gene splicing simply, gene recombination technology (Russell fast, Higuchi.protocols:A guide to methods and applications[A] .Recombinant PCR[M] .Academic Press, 1990.177-183.).This method requires universal primer and two reverse partly overlapping mutant primers of two flanks.At first primer matches in twos and carries out the PCR reaction respectively, produces two partly overlapping PCR fragments, and both overlaps are all passed through the mispairing of primer and introduced identical sudden change.Two fragments of the overlapping permission of sequence are being extended the dna fragmentation that produces total length under the archaeal dna polymerase effect after mixing, sex change, the renaturation; This fragment can be used as the template of extending for the second time, carries out the full length DNA amplification with two flank primers.1987, after this technology was come out 1 year, people such as Mullis KB just at first use the mispairing guiding (mis-priming) of primer, by gene is carried out external rite-directed mutagenesis, successfully mutant nucleotide sequence is introduced product end (Mullis KB, Faloona FA.Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction.Methods Enzymol.1987; 155:335-50.); 1988, Higuchi R etc. on this basis, use overlapping extension method that mutant nucleotide sequence is introduced middle part (Higuchi R in the product, Krummel B, Saiki RK.A general method of in vitro preparation and specific mutagenesis ofDNA fragments:study of protein and DNA interactions.Nucleic Acids Res.1988Aug 11; 16 (15): 7351-67.); After this Ho and Horton attempt carrying out the structure of gene recombination and mosaic gene and (the Ho SN that succeeds with overlapping extension method, Hunt HD, Horton RM, Pullen JK, Pease LR.Site-directed mutagenesis by overlap extension using thepolymerase chain reaction.Gene.1989 Apr 15; 77 (1): 51-9.; Horton RM, HuntHD, Ho SN, Pullen JK, Pease LR.Engineering hybrid genes without the use ofrestriction enzymes:gene splicing by overlap extension.Gene.1989 Apr15; 77 (1): 61-8.).Utilize site-directed mutagenesis technique that the proteic catalytic property of natural enzyme, substrate specificity and thermostability etc. are transformed a lot of successful examples are arranged (Ma YF, Evans DE, Logue SJ, Langridge P.Mutations of barley beta-amylase that improve substrate-bindingaffinity and thermostability.Mol Genet Genomics.2001 Nov; 266 (3): 345-52.; Huang CY, Chang AK, Nixon PF, Duggleby RG.Site-directed mutagenesis ofthe ionizable groups in the active site of Zymomonas mobilis pyruvatedecarboxylase:effect on activity and pH dependence.Eur J Biochem.2001Jun; 268 (12): 3558-65.; Wang SX, Dunphy WG.Activation of Xenopus Chk1by mutagenesis of threonine-377.FEBS Lett.2000 Dec 29; 487 (2): 277-81.).
Although OE-PCR is widely used as a kind of common method, but generally speaking, can only introduce place sudden change at every turn, and when a plurality of sites need suddenly change, testing sequence that needs are loaded down with trivial details and very big workload have also increased the possibility of introducing some unnecessary point mutation simultaneously.
Summary of the invention
The object of the present invention is to provide a kind of realization gene multipoint mutation rapidly and efficiently-improved overlapping extension PCR method (modified overlap extension by PCR, MOE-PCR); The present invention is a kind of quick, simple, error-free multipoint mutation method, using the present invention both can be implemented in one and takes turns in the reaction process rite-directed mutagenesis is carried out in a plurality of sites, do not introduce other mutational site again, thereby provide new selection for DNA carries out multipoint mutation; Use the present invention, only through simultaneously 8 rare codons of sam1 being carried out rite-directed mutagenesis once having taken turns the successful realization of reaction.
For achieving the above object, the technical solution used in the present invention is:
A kind of improved overlapping extension PCR method, reaction process is divided into following step:
(1) fragment is synthetic: the full-length gene with required sudden change is a template, and the number design series of parallel primer according to the mutational site comprises base to be suddenlyd change in the primer, overlap section of tip designs of every adjacent a pair of primer, and length is 20-30bp; Adopt above-mentioned every adjacent a pair of primer to carry out parallel PCR respectively, realize the amplification of each DNA small segment;
(2) two mixing: the above-mentioned fragment of purifying respectively, be divided into different components, the dna fragmentation of each component that equivalent is adjacent mixes respectively in twos, and template each other between the fragment increases into long segment in overlapping extension PCR mode, reacts to be no primer PCR process;
(3) the pre-extension: above-mentioned many group reactions after product is mixed, and template each other between the long segment of new formation increases into the total length new template in overlapping extension PCR mode, and this step also is no primer PCR process;
(4) full length DNA is synthetic: add the pair of outside primer of full-length gene in above-mentioned reaction system, the recombinant full-lenght DNA that produces with previous step is a template, carries out PCR, the amplification full-length gene;
(5) extend the back: above-mentioned reaction system again through 94 ℃ of sex change 30s of 10 round-robin, is annealed and extension 1min for 72 ℃;
(6) mutator gene is connected into carrier and change host strain over to, carries out sequential analysis.
With the total DNA of yeast saccharomyces cerevisiae is template, and amplification has the sam1 gene of EcoRI and NotI, and this gene has the nucleotide sequence among the sequence table SEQ ID No:1.This gene as initial gene, is carried out the reaction (as Fig. 1) of following steps:
(1) fragment is synthetic: as template, design 6 pairs of parallel primers with Saccharomyces Cerevisiae in S AM synthase gene sam1 (as Fig. 2), comprise base to be suddenlyd change in the primer, and overlap section of tip designs of every adjacent a pair of primer, length is 20-30bp; Adopt above-mentioned every adjacent a pair of primer to carry out parallel PCR respectively, realize the amplification of 6 DNA small segments;
(2) two mixing: the above-mentioned fragment behind the purifying is divided into 5 components, and in each component, the adjacent dna fragmentation of equivalent mixes (the about 10ng of each fragment) in twos.Fragment 1 and 2 is mixed back called after components 1, next coming in order called after component 2-5, and template each other between the fragment increases into long segment in overlapping extension PCR mode, reacts to be no primer PCR process;
(3) the pre-extension: subsequently, 5 components are mixed, template each other between the new long segment that forms increases into the total length new template in overlapping extension PCR mode, and this step also is no primer PCR process;
(4) full length DNA is synthetic: add the pair of outside primer of full-length gene in reaction system, the recombinant full-lenght DNA that produces with previous step is a template, carries out the pcr amplification full-length gene;
(5) extend the back: through 94 ℃ of sex change 30s of 10 round-robin, anneal and extension 1min for 72 ℃;
(6) mutator gene is connected into expression vector and change yeast saccharomyces cerevisiae over to, carries out sequential analysis; And carry out abduction delivering, detect the intracellular accumulation amount of protein expression amount and SAM.The mutator gene that is obtained has the nucleotide sequence among the sequence table SEQ ID No:3; This nucleotide sequence derives from initial gene, compares with initial gene to have 8 point mutation: G126T, G138T, G462T, G483T, G603T, G621T, G936T and G975T.
The present invention has the following advantages:
1. the present invention provides a new site-directed point mutation method by the reaction process of uniqueness, and this method is implemented in one and takes turns in the circulation the simultaneous mutation of a plurality of sites by simple experimental procedure; And entire reaction course has good fidelity, does not introduce other point mutation.
2. in the present invention, it is the transformation that initial gene has carried out 8 rare codons to ademetionine (SAM) the synthase gene sam1 from yeast saccharomyces cerevisiae (Saccharomycescerevisiae) that the applicant uses this method, verified the validity of this method, and obtained a kind of mutator gene, nucleotide sequence is compared with original gene order has 8 point mutation: G126T, G138T, G462T, G483T, G603T, G621T, G936T and G975T are transformed into common password with original rare codon; The SAM synthetic enzyme of this genes encoding can efficiently express in yeast saccharomyces cerevisiae, and can improve the accumulation volume of SAM in the born of the same parents; Quote the present invention, can further provide to be directly used in the engineering strain of producing high expression level SAM synthetic enzyme.
In a word, the present invention combines the principle of DNA shuffling technology first with rite-directed mutagenesis, proposes and put into practice a kind of new rite-directed mutagenesis method.
Description of drawings
Fig. 1 carries out the synoptic diagram of multipoint mutation to sam1 with MOE-PCR, reactions steps comprises: (1) fragment is synthetic: with synthetic 6 dna fragmentations of the Pfu archaeal dna polymerase of high-fidelity, has an overlap between every adjacent two bar segment, length is 20-30bp, comprise the base that remains to be suddenlyd change in the primer, 6 bar segment can be formed the DNA of total length by overlapping linking together, representative site to be suddenlyd change, white spaces position; (2) two mixing: adjacent dna fragmentation is mixed in twos, form 5 parallel components, do not have the overlapping extension PCR (OE-PCR) of primer respectively; (3) the pre-extension: above-mentioned 5 parallel components are blended in the reaction system, obtain the reunion dna profiling of total length again by the overlapping extension PCR of no primer; (4) full length DNA is synthetic: add a pair of primer with respect to the full length DNA end in reaction system, the DNA that above single step reaction produces is the goal gene through sudden change that template amplification goes out total length; (5) extend the back: through 94 ℃ of sex change of 10 round-robin, anneal and extend for 72 ℃.
Fig. 2 is the agarose gel electrophoresis analysis of SAM synthase gene sam1 pcr amplification product, wherein, and LaneM:DNA Marker DL2000; Lane1:PCR purpose band;
Fig. 3 carries out the agarose gel electrophoresis figure (gum concentration 1%) of rite-directed mutagenesis with the MOE-PCR method to 8 rare codons of sam1, wherein, and Lane M:DNA size marker DL2000; Lane1-6: with PCR method synthetic fragment 1-6; The net result of Lane7:MOE-PCR.
Fig. 4 recombinant plasmid pYES-sam1 " enzyme is cut and PCR verifies collection of illustrative plates, wherein, LaneM1:Marker DL2000; Lane1:PCR verifies the result; Lane2: blank plasmid pYES2 is through BamHI and EcoRI double digestion; Lane3: recombinant plasmid pYES-sam1 " through BamHI and EcoRI double digestion; LaneM2:Marker λ DNA HindIII.
The SDS-PAGE electrophoretic analysis of Fig. 5 expression product, wherein, M is middle molecular weight protein matter Marker; Lane1-3 represents the abduction delivering albumen of the yeast saccharomyces cerevisiae that includes different plasmids respectively: Lane1 includes pYES2; Lane2 includes pYES-sam1; Lane3 includes pYES-sam1 ".
Fig. 6 HPLC detects the intracellular accumulation amount of ademetionine, and wherein, a, b, c represent the product of yeast saccharomyces cerevisiae after abduction delivering and extracting that includes different plasmids respectively: a includes pYES2, and b includes pYES2+sam1, and c includes pYES2+sam1 "; D is the ademetionine standard.
Embodiment
Embodiment 1
A kind of gene sam1 that derives from the coding SAM synthetic enzyme (2.5.1.6) of yeast saccharomyces cerevisiae INVScI bacterial strain has the base sequence among the sequence table SEQ ID No:1.
SEQ?ID?No：1：
ATGGCCGGTACATTTTTATTCACTTCTGAATCCGTTGGTGAAGGTCACCCAGA
TAAGATCTGTGACCAAGTTTCCGACGCCATCTTGGACGCTTGTTTAGCCGAGG
ACCCTCACTCCAAAGTTGCGTGTGAAACCGCGGCAAAGACTGGTATGATTATG
GTCTTTGGTGAAATTACTACCAAGGCACAGTTGGATTACCAAAAAATCGTCAG
AGACACCATCAAGAAGATTGGTTACGATGATTCCGCCAAGGGTTTCGACTATA
AGACCTGTAACGTCCTTGTCGCCATTGAGCAACAATCTCCAGATATCGCCCAA
GGTGTCCACGAGGAGAAGGATTTGGAAGACATCGGTGCCGGTGACCAAGGTAT
CATGTTTGGTTACGCCACAGATGAAACTCCAGAGGGTTTGCCTTTGACTATTC
TTTTGGCTCATAAACTAAACATGGCCATGGCTGACGCGAGAAGAGATGGCTCT
TTAGCGTGGTTGAGACCAGACACCAAGACTCAAGTCACCGTCGAATACAAGGA
TGACCACGGTAGATGGGTTCCACAAAGAATCGACACCGTCGTCGTCTCCGCTC
AACATGCTGACGAAATCACGACCGAGGACTTAAGAGCGCAACTAAAGTCCGAG
ATCATTGAAAAAGTCATCCCAAGAGACATGTTGGACGAAAACACCAAATACTT
TATCCAACCTTCCGGTAGATTCGTCATCGGTGGTCCTCAAGGTGACGCTGGTT
TGACCGGTAGAAAGATCATCGTCGACGCTTACGGTGGTGCCTCATCCGTCGGT
GGTGGTGCCTTCTCCGGTAAGGACTACTCTAAGGTTGATCGTTCTGCCGCTTA
TGCCGCTAGATGGGTTGCCAAGTCCCTAGTTGCCGCTGGTTTATGTAAGAGAG
TTCAAGTTCAATTTTCTTATGCCATCGGTATTGCGGAACCATTGTCCTTGCAC
GTTGACACCTATGGTACTGCGACCAAGTCTGACGAAGAAATTATCGACATTAT
CAGCAAGAACTTTGACTTGAGACCTGGTGTATTGGTCAAGGAGTTGGACTTAG
CTAGACCAATCTACTTGCCAACCGCTTCTTATGGCCATTTCACAAACCAAGAA
TACCCATGGGAAAAGCCTAAGACTTTGAAGTTCTAA
(1) information of SEQ ID No:1 (referring to sequence table)
(a) sequence signature
* length: 1149 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: DNA
(c) suppose: not
(d) antisense: not
(e) initial source: the gene sam1 of the coding SAM synthetic enzyme (2.5.1.6) of yeast saccharomyces cerevisiae INVScI bacterial strain
(2) derive from the preparation of gene sam1 of the coding SAM synthetic enzyme (2.5.1.6) of yeast saccharomyces cerevisiae INVScI bacterial strain:
Upstream primer 1:5-ATT GGATCCCAACGATGGCACTAGACATA-3;
Downstream primer 2:5-GCA GAATTCGAGGTTGAAGGCAGAAAA-3;
The underscore sequence is respectively BamHI and EcoRI restriction enzyme site.
Amplification condition: total DNA is a template with yeast saccharomyces cerevisiae INVScI bacterial strain, increases with the pfu archaeal dna polymerase.Reaction system is: the pfu archaeal dna polymerase of 2.5U, 1 * pfu buffer, 200 μ molL -1DNTP, 1mmol L -1The dna profiling of each primer, 100ng, total reaction volume 100 μ l; Reaction conditions: 94 ℃ of sex change 2min; 94 ℃ of 30s of 30 round-robin, 53 ℃ of 30s, 72 ℃ of 3min; 72 ℃ are extended 10min.The PCR product reclaims: by Shanghai China Shun test kit working instructions.The purpose product is seen agarose gel electrophoresis (as Fig. 2).Goal gene is cut the corresponding restriction enzyme site that rear clone is gone into the pYES2 carrier through BamHI and EcoRI enzyme, make up the pYES2-sam1 recombinant plasmid.
Embodiment 2
Adopt new comprehensive gene reorganization method that sam1 is reorganized, obtain the gene sam1 of the active recombinase that improves of codase, have the base sequence of sequence table SEQ ID No:3.
ATGGCCGGTACATTTTTATTCACTTCTGAATCCGTTGGTGAAGGTCACCCAGA
TAAGCTCTGTGACCAAGTTTCCGACGCCATCTTGGACGCTTGTTTAGCCGAGG
ACCCTCACTCCAAAGTTGCTTGTGAAACCGCTGCAAAGACTGGTATGATTATG
GTCTTTGGTGAAATTACTACCAAGGCACAGTTGGATTACCAAAAAATCGTCAG
AGACACCATCAAGAAGATTGGTTACGATGATTCCGCCAAGGGATTCGACTATA
AGACCTGTAACGTCCTTGTCGCCATTGAGCAACAATCTCCAGACATCGCCCAA
GGTGTCCACGAGGAGAAGGATTTGGAAGACATCGGTGCCAGTGACCAAGGTAT
CATGTTTGGTTACGCCACAGATGAAACTCCAGAGGGTTTGCCTTTAACTATTC
TTTTGGCTCATAAACTAAACATGGCCATGGCTGACGCTAGAAGAGATGGCTCT
TTAGCTTGGTTGAGACCAGACACCAAGACTCAAGTCACCGTCGAATACAAGGA
TGACCACGGTAGATGGGTTCCGCAAAGAATCGACACCGTCGTCGTCTCCGCTC
AACATGCTGACGAAATCACTACCGAGGACTTAAGAGCTCAACTAAAGTCCGAG
TTCATTGAAAAAGTCATCCCAAGAGACATGTTGGACGAAAACACCAAATACTT
TATCCAACCTTCCGGTAGATTCGTCATCGGTGGTCCTCAAGGTGACGCTGGTT
TGACCGGTAGAAAGATCATCGTCGACGCTTACGGTGGTGCCTCATCCGTCGGT
GGTGGTGCCTTCTCCGGTAAGGACTACTCTAAGGTTGATCGTTCTGCCGCTTA
TGCCGCTAGATGGGTTGCCAAGTCCCTAGTTGCCGCTGGTTTATGTAAGAGAG
TTCAAGTTCAATTTTCTTATGCCATCGGTATTGCTGAACCATTGTCCTTGCAC
GTTGACACCTATGGTACTGCTACCAAGTCTGACGAAGAAATTATCGACATTAT
CAGCAAGAACTTTGACTTGAGACCTGGTGTATTGGTCAAGGAGTTGGACTTAT
CTAGACCAATCTACTTGCCAACCGCTTCTTATGGCCATTTCACAAACCAAGAA
TACCCATGGGAAAAGCCTAAGACTTTGAAGTTCTAA
(1) information of SEQ ID No:3 (referring to sequence table)
(A) sequence signature
* length: 1149 base pairs
* type: nucleic acid
* chain: two strands
* topological framework: linearity
(b) molecule type: DNA
(c) suppose: not
(d) antisense: not
(2) adopt MOE-PCR that sam1 is carried out multipoint mutation.
(1) fragment is synthetic: adopt the amplification (as Fig. 3) of 6 parallel PCR reaction realizations to 6 adjacent dna fragmentations, have an overlap, the general 20-30bp of length between every adjacent two PCR.The DNA reaction system is as follows: dNTP 0.2mM, 10 * pfu buffer (with MgCl 2) 10 μ l, pfuDNA polysaccharase 5U, template (total DNA) 100ng, each 1mM of primer (seeing Table 1) adds ddH 2O is 100 μ l to reacting cumulative volume.Increase for fragment 1, its response procedures is: 94 ℃ of sex change 2min; 94 ℃ of 30s of 30 round-robin, 59.6 ℃ of 30s, 72 ℃ of 55s; 72 ℃ are extended 10min.
Figure A20051004641400081
Table 1: carry out each mutant primer that sam1 rare codon house of correction is used with MOE-PCR
The base of having suddenlyd change indicates with shade; Be depicted as the restricted recognition sequence of BamHI and EcoRI in the square frame
Other each segmental reaction conditions is similar to fragment 1, except annealing temperature and extension asynchronism(-nization).The annealing temperature of fragment 2-6 is respectively 62.5 ℃, and 58.8 ℃, 59.5 ℃, 55.1 ℃ and 53.3 ℃; And the extension time of fragment 2-6 is respectively 1min 25s, 55s, 1min 20s, 50s and 55s.Product after the amplification carries out 1% agarose gel electrophoresis respectively, reclaims test kit with glue then and reclaims purifying.
(2) two mixing: the above-mentioned fragment behind the purifying is divided into 5 components, and in each component, the adjacent dna fragmentation of equivalent mixes (the about 10ng of each fragment) in twos.Fragment 1 and 2 is mixed back called after components 1, next coming in order called after component 2-5, and template each other between the fragment increases into long segment in overlapping extension PCR mode, reacts to be no primer PCR process.Reaction system is as follows in every group: dNTP 0.2mM, 10 * pfu buffer (with MgCl 2) 2 μ l, pfu archaeal dna polymerase 1U, adjacent each 10ng of two bar segment adds ddH 2O is 20 μ l to reacting cumulative volume.For component 1 (is fragment 1﹠amp; 2 mix) there is not primer PCR, its response procedures is as follows: 94 ℃ of sex change 2min; 94 ℃ of 20s of 30 round-robin, 59.6 ℃ of 30s, 72 ℃ of 1min 25s; 72 ℃ are extended 10min.The reaction conditions of other component is similar to component 1, except annealing temperature and extension asynchronism(-nization).The annealing temperature of component 2-5 is respectively 58.8 ℃, 58.8 ℃, 55.1 ℃ and 53.3 ℃; The extension time of component 2-5 is respectively 1min 25s, 1min 20s, 1min 20s, 55s;
(3) the pre-extension: subsequently, 5 components are mixed, between the new long segment that forms (between the new long segment that forms template) each other through 94 ℃ of 20s sex change of 20 round-robin and 72 ℃ of 30s annealing, extend, form part total length new template, this step also is no primer PCR process;
(4) full length DNA is synthetic: survey primers F outside two kinds of adding 40pmol in reaction system 0And R 0, the recombinant full-lenght DNA that produces with previous step is a template, carries out the pcr amplification full-length gene.The PCR response procedures is as follows: 94 ℃ of sex change 20s; 94 ℃ of 20s of 30 round-robin, 53.3 ℃ of 30s, 72 ℃ of 2min; 72 ℃ are extended 10min;
(5) extend the back: through 94 ℃ of sex change 30s of 10 round-robin, anneal and extension 1min for 72 ℃.Reaction product is carried out agarose gel electrophoresis, downcuts the band of purpose size, reclaims test kit with glue and carries out purifying;
(6) mutator gene is cut rear clone through BamHI and EcoRI enzyme and goes into equally on the pYES2 of double digestion carrier, make up pYES2+sam1 " recombinant plasmid (as Fig. 4), and transformed saccharomyces cerevisiae INVScI bacterial strain.SC-U substratum (the 6.7g yeast nitrogen that picking genetic engineering bacterium list colony inoculation is revised to 15ml; The 5g methionine(Met); 0.1g VITAMIN B4, arginine, halfcystine, leucine, Methionin, network propylhomoserin, Threonine; 0.05g aspartic acid, Histidine, Isoleucine, phenylalanine, proline(Pro), Serine, tryptophane and Xie Ansuan; Final volume 1L), comprise 2% raffinose.30 ℃ are cultured to OD 600=0.4,4 ℃ of following centrifugal 5min of 1500 * g are resuspended in cell 2ml inducing culture (the SC-U substratum of modification comprises 2% semi-lactosi) then then, inoculate in the inducing culture of 50ml 150r min under 30 ℃ of conditions -1Cultivate 6h in the shaking table.4 ℃ of following centrifugal 5min of 1500 * g outwell supernatant then, precipitation are resuspended in the pure water of 500 μ l.The centrifugal 5min of 1500 * g under 4 ℃ outwells supernatant, and cell is used to detect the SAM accumulation.Add 5ml 1.5molL in every 1g thalline -1Perchloric acid with 120r min -1Shake 1h and carry out extracting, (Perseptive Biosystem Inc.U.S.A.) detects the SAM level of generation with BioCAD700E type HPLC.Weak cation exchange column Poros20CM is selected in this test for use, and (4.6mm * 100mm), moving phase is 0.5mol L -1HCOONH 4, pH is adjusted into 4.0, and flow velocity is 5ml min -1, under the 260nm wavelength, detect product, 22 ℃ of room temperatures.In contrast, the yeast saccharomyces cerevisiae that contains pYES2 plasmid and pYES2+sam1 plasmid also is used to detect the intracellular accumulation amount of SAM.The retention time that the standard substance SAM of 10 μ mol/L is used to demarcate SAM.
It is centrifugal to get the 1ml fermented liquid, and bacterial sediment 1ml distilled water wash is resuspended in after centrifugal in 1 times the sample-loading buffer, and boiling water bath boils 10min, the centrifugal 2min of 12000 * g.Get 10 μ l and carry out the SDS-PAGE electrophoresis, 0.1% coomassie brilliant blue staining detects proteic expression then.
The result:
1. sequencing result shows, the mutator gene sequence, i.e. and 8 point mutation conform to predicting the outcome, and do not have other mutational site to introduce;
2. use site-directed point mutation method of the present invention, take turns the mutant DNA (as Fig. 3) that reaction promptly obtains the purpose size through one;
3. in the cell whole protein electrophoresis of engineering bacteria an obvious expression band is arranged, inducible protein as shown in Figure 5.Molecular weight is about 4.2K dalton;
4. detect by HPLC, obtain the Wine brewing yeast strain that a strain ademetionine intracellular accumulation amount improves, the SAM accumulation volume contrasts and has improved 25.6% (as Fig. 6) in the born of the same parents.
SEQUENCE?LISTING
＜110〉Shenyang Inst. of Applied Ecology, Chinese Academy of Sciences
＜120〉a kind of improved overlapping extension PCR method and the mutator gene that obtained thereof
<130>
<160>4
<170>PatentIn?version?3.1
<210>1
<211>1149
<212>DNA
＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)
<220>
<221>CDS
<222>(1)..(1149)
<223>
<400>1
atg?gcc?ggt?aca?ttt?tta?ttc?act?tct?gaa?tcc?gtt?ggt?gaa?ggt?cac 48
Met?Ala?Gly?Thr?Phe?Leu?Phe?Thr?Ser?Glu?Ser?Val?Gly?Glu?Gly?His
1 5 10 15
cca?gat?aag?atc?tgt?gac?caa?gtt?tcc?gac?gcc?atc?ttg?gac?gct?tgt 96
Pro?Asp?Lys?Ile?Cys?Asp?Gln?Val?Ser?Asp?Ala?Ile?Leu?Asp?Ala?Cys
20 25 30
tta?gcc?gag?gac?cct?cac?tcc?aaa?gtt?gcg?tgt?gaa?acc?gcg?gca?aag 144
Leu?Ala?Glu?Asp?Pro?His?Ser?Lys?Val?Ala?Cys?Glu?Thr?Ala?Ala?Lys
35 40 45
act?ggt?atg?att?atg?gtc?ttt?ggt?gaa?att?act?acc?aag?gca?cag?ttg 192
Thr?Gly?Met?Ile?Met?Val?Phe?Gly?Glu?Ile?Thr?Thr?Lys?Ala?Gln?Leu
50 55 60
gat?tac?caa?aaa?atc?gtc?aga?gac?acc?atc?aag?aag?att?ggt?tac?gat 240
Asp?Tyr?Gln?Lys?Ile?Val?Arg?Asp?Thr?Ile?Lys?Lys?Ile?Gly?Tyr?Asp
65 70 75 80
gat?tcc?gcc?aag?ggt?ttc?gac?tat?aag?acc?tgt?aac?gtc?ctt?gtc?gcc 288
Asp?Ser?Ala?Lys?Gly?Phe?Asp?Tyr?Lys?Thr?Cys?Asn?Val?Leu?Val?Ala
85 90 95
att?gag?caa?caa?tct?cca?gat?atc?gcc?caa?ggt?gtc?cac?gag?gag?aag 336
Ile?Glu?Gln?Gln?Ser?Pro?Asp?Ile?Ala?Gln?Gly?Val?His?Glu?Glu?Lys
100 105 110
gat?ttg?gaa?gac?atc?ggt?gcc?ggt?gac?caa?ggt?atc?atg?ttt?ggt?tac 384
Asp?Leu?Glu?Asp?Ile?Gly?Ala?Gly?Asp?Gln?Gly?Ile?Met?Phe?Gly?Tyr
115 120 125
gcc?aca?gat?gaa?act?cca?gag?ggt?ttg?cct?ttg?act?att?ctt?ttg?gct 432
Ala?Thr?Asp?Glu?Thr?Pro?Glu?Gly?Leu?Pro?Leu?Thr?Ile?Leu?Leu?Ala
130 135 140
cat?aaa?cta?aac?atg?gcc?atg?gct?gac?gcg?aga?aga?gat?ggc?tct?tta 480
His?Lys?Leu?Asn?Met?Ala?Met?Ala?Asp?Ala?Arg?Arg?Asp?Gly?Ser?Leu
145 150 155 160
gcg?tgg?ttg?aga?cca?gac?acc?aag?act?caa?gtc?acc?gtc?gaa?tac?aag 528
Ala?Trp?Leu?Arg?Pro?Asp?Thr?Lys?Thr?Gln?Val?Thr?Val?Glu?Tyr?Lys
165 170 175
gat?gac?cac?ggt?aga?tgg?gtt?cca?caa?aga?atc?gac?acc?gtc?gtc?gtc 576
Asp?Asp?His?Gly?Arg?Trp?Val?Pro?Gln?Arg?Ile?Asp?Thr?Val?Val?Val
180 185 190
tcc?gct?caa?cat?gct?gac?gaa?atc?acg?acc?gag?gac?tta?aga?gcg?caa 624
Ser?Ala?Gln?His?Ala?Asp?Glu?Ile?Thr?Thr?Glu?Asp?Leu?Arg?Ala?Gln
195 200 205
cta?aag?tcc?gag?atc?att?gaa?aaa?gtc?atc?cca?aga?gac?atg?ttg?gac 672
Leu?Lys?Ser?Glu?Ile?Ile?Glu?Lys?Val?Ile?Pro?Arg?Asp?Met?Leu?Asp
210 215 220
gaa?aac?acc?aaa?tac?ttt?atc?caa?cct?tcc?ggt?aga?ttc?gtc?atc?ggt 720
Glu?Asn?Thr?Lys?Tyr?Phe?Ile?Gln?Pro?Ser?Gly?Arg?Phe?Val?Ile?Gly
225 230 235 240
ggt?cct?caa?ggt?gac?gct?ggt?ttg?acc?ggt?aga?aag?atc?atc?gtc?gac 768
Gly?Pro?Gln?Gly?Asp?Ala?Gly?Leu?Thr?Gly?Arg?Lys?Ile?Ile?Val?Asp
245 250 255
gct?tac?ggt?ggt?gcc?tca?tcc?gtc?ggt?ggt?ggt?gcc?ttc?tcc?ggt?aag 816
Ala?Tyr?Gly?Gly?Ala?Ser?Ser?Val?Gly?Gly?Gly?Ala?Phe?Ser?Gly?Lys
260 265 270
gac?tac?tct?aag?gtt?gat?cgt?tct?gcc?gct?tat?gcc?gct?aga?tgg?gtt 864
Asp?Tyr?Ser?Lys?Val?Asp?Arg?Ser?Ala?Ala?Tyr?Ala?Ala?Arg?Trp?Val
275 280 285
gcc?aag?tcc?cta?gtt?gcc?gct?ggt?tta?tgt?aag?aga?gtt?caa?gtt?caa 912
Ala?Lys?Ser?Leu?Val?Ala?Ala?Gly?Leu?Cys?Lys?Arg?Val?Gln?Val?Gln
290 295 300
ttt?tct?tat?gcc?atc?ggt?att?gcg?gaa?cca?ttg?tcc?ttg?cac?gtt?gac 960
Phe?Ser?Tyr?Ala?Ile?Gly?Ile?Ala?Glu?Pro?Leu?Ser?Leu?His?Val?Asp
305 310 315 320
acc?tat?ggt?act?gcg?acc?aag?tct?gac?gaa?gaa?att?atc?gac?att?atc 1008
Thr?Tyr?Gly?Thr?Ala?Thr?Lys?Ser?Asp?Glu?Glu?Ile?Ile?Asp?Ile?Ile
325 330 335
agc?aag?aac?ttt?gac?ttg?aga?cct?ggt?gta?ttg?gtc?aag?gag?ttg?gac 1056
Ser?Lys?Asn?Phe?Asp?Leu?Arg?Pro?Gly?Val?Leu?Val?Lys?Glu?Leu?Asp
340 345 350
tta?gct?aga?cca?atc?tac?ttg?cca?acc?gct?tct?tat?ggc?cat?ttc?aca 1104
Leu?Ala?Arg?Pro?Ile?Tyr?Leu?Pro?Thr?Ala?Ser?Tyr?Gly?His?Phe?Thr
355 360 365
aac?caa?gaa?tac?cca?tgg?gaa?aag?cct?aag?act?ttg?aag?ttc?taa 1149
Asn?Gln?Glu?Tyr?Pro?Trp?Glu?Lys?Pro?Lys?Thr?Leu?Lys?Phe
370 375 380
<210>2
<211>382
<212>PRT
＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)
<400>2
Met?Ala?Gly?Thr?Phe?Leu?Phe?Thr?Ser?Glu?Ser?Val?Gly?Glu?Gly?His
1 5 10 15
Pro?Asp?Lys?Ile?Cys?Asp?Gln?Val?Ser?Asp?Ala?Ile?Leu?Asp?Ala?Cys
20 25 30
Leu?Ala?Glu?Asp?Pro?His?Ser?Lys?Val?Ala?Cys?Glu?Thr?Ala?Ala?Lys
35 40 45
Thr?Gly?Met?Ile?Met?Val?Phe?Gly?Glu?Ile?Thr?Thr?Lys?Ala?Gln?Leu
50 55 60
Asp?Tyr?Gln?Lys?Ile?Val?Arg?Asp?Thr?Ile?Lys?Lys?Ile?Gly?Tyr?Asp
65 70 75 80
Asp?Ser?Ala?Lys?Gly?Phe?Asp?Tyr?Lys?Thr?Cys?Asn?Val?Leu?Val?Ala
85 90 95
Ile?Glu?Gln?Gln?Ser?Pro?Asp?Ile?Ala?Gln?Gly?Val?His?Glu?Glu?Lys
100 105 110
Asp?Leu?Glu?Asp?Ile?Gly?Ala?Gly?Asp?Gln?Gly?Ile?Met?Phe?Gly?Tyr
115 120 125
Ala?Thr?Asp?Glu?Thr?Pro?Glu?Gly?Leu?Pro?Leu?Thr?Ile?Leu?Leu?Ala
130 135 140
His?Lys?Leu?Asn?Met?Ala?Met?Ala?Asp?Ala?Arg?Arg?Asp?Gly?Ser?Leu
145 150 155 160
Ala?Trp?Leu?Arg?Pro?Asp?Thr?Lys?Thr?Gln?Val?Thr?Val?Glu?Tyr?Lys
165 170 175
Asp?Asp?His?Gly?Arg?Trp?Val?Pro?Gln?Arg?Ile?Asp?Thr?Val?Val?Val
180 185 190
Ser?Ala?Gln?His?Ala?Asp?Glu?Ile?Thr?Thr?Glu?Asp?Leu?Arg?Ala?Gln
195 200 205
Leu?Lys?Ser?Glu?Ile?Ile?Glu?Lys?Val?Ile?Pro?Arg?Asp?Met?Leu?Asp
210 215 220
Glu?Asn?Thr?Lys?Tyr?Phe?Ile?Gln?Pro?Ser?Gly?Arg?Phe?Val?Ile?Gly
225 230 235 240
Gly?Pro?Gln?Gly?Asp?Ala?Gly?Leu?Thr?Gly?Arg?Lys?Ile?Ile?Val?Asp
245 250 255
Ala?Tyr?Gly?Gly?Ala?Ser?Ser?Val?Gly?Gly?Gly?Ala?Phe?Ser?Gly?Lys
260 265 270
Asp?Tyr?Ser?Lys?Val?Asp?Arg?Ser?Ala?Ala?Tyr?Ala?Ala?Arg?Trp?Val
275 280 285
Ala?Lys?Ser?Leu?Val?Ala?Ala?Gly?Leu?Cys?Lys?Arg?Val?Gln?Val?Gln
290 295 300
Phe?Ser?Tyr?Ala?Ile?Gly?Tle?Ala?Glu?Pro?Leu?Ser?Leu?His?Val?Asp
305 310 315 320
Thr?Tyr?Gly?Thr?Ala?Thr?Lys?Ser?Asp?Glu?Glu?Ile?Ile?Asp?Ile?Ile
325 330 335
Ser?Lys?Asn?Phe?Asp?Leu?Arg?Pro?Gly?Val?Leu?Val?Lys?Glu?Leu?Asp
340 345 350
Leu?Ala?Arg?Pro?Ile?Tyr?Leu?Pro?Thr?Ala?Ser?Tyr?Gly?His?Phe?Thr
355 360 365
Asn?Gln?Glu?Tyr?Pro?Trp?Glu?Lys?Pro?Lys?Thr?Leu?Lys?Phe
370 375 380
<210>3
<211>1149
<212>DNA
＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)
<220>
<221>CDS
<222>(1)..(1149)
<223>
<400>3
atg?gcc?ggt?aca?ttt?tta?ttc?act?tct?gaa?tcc?gtt?ggt?gaa?ggt?cac 48
Met?Ala?Gly?Thr?Phe?Leu?Phe?Thr?Ser?Glu?Ser?Val?Gly?Glu?Gly?His
1 5 10 15
cca?gat?aag?ctc?tgt?gac?caa?gtt?tcc?gac?gcc?atc?ttg?gac?gct?tgt 96
Pro?Asp?Lys?Leu?Cys?Asp?Gln?Val?Ser?Asp?Ala?Ile?Leu?Asp?Ala?Cys
20 25 30
tta?gcc?gag?gac?cct?cac?tcc?aaa?gtt?gct?tgt?gaa?acc?gct?gca?aag 144
Leu?Ala?Glu?Asp?Pro?His?Ser?Lys?Val?Ala?Cys?Glu?Thr?Ala?Ala?Lys
35 40 45
act?ggt?atg?att?atg?gtc?ttt?ggt?gaa?att?act?acc?aag?gca?cag?ttg 192
Thr?Gly?Met?Ile?Met?Val?Phe?Gly?Glu?Ile?Thr?Thr?Lys?Ala?Gln?Leu
50 55 60
gat?tac?caa?aaa?atc?gtc?aga?gac?acc?atc?aag?aag?att?ggt?tac?gat 240
Asp?Tyr?Gln?Lys?Ile?Val?Arg?Asp?Thr?Ile?Lys?Lys?Ile?Gly?Tyr?Asp
65 70 75 80
gat?tcc?gcc?aag?gga?ttc?gac?tat?aag?acc?tgt?aac?gtc?ctt?gtc?gcc 288
Asp?Ser?Ala?Lys?Gly?Phe?Asp?Tyr?Lys?Thr?Cys?Asn?Val?Leu?Val?Ala
85 90 95
att?gag?caa?caa?tct?cca?gac?atc?gcc?caa?ggt?gtc?cac?gag?gag?aag 336
Ile?Glu?Gln?Gln?Ser?Pro?Asp?Ile?Ala?Gln?Gly?Val?His?Glu?Glu?Lys
100 105 110
gat?ttg?gaa?gac?atc?ggt?gcc?agt?gac?caa?ggt?atc?atg?ttt?ggt?tac 384
Asp?Leu?Glu?Asp?Ile?Gly?Ala?Ser?Asp?Gln?Gly?Ile?Met?Phe?Gly?Tyr
115 120 125
gcc?aca?gat?gaa?act?cca?gag?ggt?ttg?cct?tta?act?att?ctt?ttg?gct 432
Ala?Thr?Asp?Glu?Thr?Pro?Glu?Gly?Leu?Pro?Leu?Thr?Ile?Leu?Leu?Ala
130 135 140
cat?aaa?cta?aac?atg?gcc?atg?gct?gac?gct?aga?aga?gat?ggc?tct?tta 480
His?Lys?Leu?Asn?Met?Ala?Met?Ala?Asp?Ala?Arg?Arg?Asp?Gly?Ser?Leu
145 150 155 160
gct?tgg?ttg?aga?cca?gac?acc?aag?act?caa?gtc?acc?gtc?gaa?tac?aag 528
Ala?Trp?Leu?Arg?Pro?Asp?Thr?Lys?Thr?Gln?Val?Thr?Val?Glu?Tyr?Lys
165 170 175
gat?gac?cac?ggt?aga?tgg?gtt?ccg?caa?aga?atc?gac?acc?gtc?gtc?gtc 576
Asp?Asp?His?Gly?Arg?Trp?Val?Pro?Gln?Arg?Ile?Asp?Thr?Val?Val?Val
180 185 190
tcc?gct?caa?cat?gct?gac?gaa?atc?act?acc?gag?gac?tta?aga?gct?caa 624
Ser?Ala?Gln?His?Ala?Asp?Glu?Ile?Thr?Thr?Glu?Asp?Leu?Arg?Ala?Gln
195 200 205
cta?aag?tcc?gag?ttc?att?gaa?aaa?gtc?atc?cca?aga?gac?atg?ttg?gac 672
Leu?Lys?Ser?Glu?Phe?Ile?Glu?Lys?Val?Ile?Pro?Arg?Asp?Met?Leu?Asp
210 215 220
gaa?aac?acc?aaa?tac?ttt?atc?caa?cct?tcc?ggt?aga?ttc?gtc?atc?ggt 720
Glu?Asn?Thr?Lys?Tyr?Phe?Ile?Gln?Pro?Ser?Gly?Arg?Phe?Val?Ile?Gly
225 230 235 240
ggt?cct?caa?ggt?gac?gct?ggt?ttg?acc?ggt?aga?aag?atc?atc?gtc?gac 768
Gly?Pro?Gln?Gly?Asp?Ala?Gly?Leu?Thr?Gly?Arg?Lys?Ile?Ile?Val?Asp
245 250 255
gct?tac?ggt?ggt?gcc?tca?tcc?gtc?ggt?ggt?ggt?gcc?ttc?tcc?ggt?aag 816
Ala?Tyr?Gly?Gly?Ala?Ser?Ser?Val?Gly?Gly?Gly?Ala?Phe?Ser?Gly?Lys
260 265 270
gac?tac?tct?aag?gtt?gat?cgt?tct?gcc?gct?tat?gcc?gct?aga?tgg?gtt 864
Asp?Tyr?Ser?Lys?Val?Asp?Arg?Ser?Ala?Ala?Tyr?Ala?Ala?Arg?Trp?Val
275 280 285
gcc?aag?tcc?cta?gtt?gcc?gct?ggt?tta?tgt?aag?aga?gtt?caa?gtt?caa 912
Ala?Lys?Ser?Leu?Val?Ala?Ala?Gly?Leu?Cys?Lys?Arg?Val?Gln?Val?Gln
290 295 300
ttt?tct?tat?gcc?atc?ggt?att?gct?gaa?cca?ttg?tcc?ttg?cac?gtt?gac 960
Phe?Ser?Tyr?Ala?Ile?Gly?Ile?Ala?Glu?Pro?Leu?Ser?Leu?His?Val?Asp
305 310 315 320
acc?tat?ggt?act?gct?acc?aag?tct?gac?gaa?gaa?att?atc?gac?att?atc 1008
Thr?Tyr?Gly?Thr?Ala?Thr?Lys?Ser?Asp?Glu?Glu?Ile?Ile?Asp?Ile?Ile
325 330 335
agc?aag?aac?ttt?gac?ttg?aga?cct?ggt?gta?ttg?gtc?aag?gag?ttg?gac 1056
Ser?Lys?Asn?Phe?Asp?Leu?Arg?Pro?Gly?Val?Leu?Val?Lys?Glu?Leu?Asp
340 345 350
tta?tct?aga?cca?atc?tac?ttg?cca?acc?gct?tct?tat?ggc?cat?ttc?aca 1104
Leu?Ser?Arg?Pro?Ile?Tyr?Leu?Pro?Thr?Ala?Ser?Tyr?Gly?His?Phe?Thr
355 360 365
aac?caa?gaa?tac?cca?tgg?gaa?aag?cct?aag?act?ttg?aag?ttc?taa 1149
Asn?Gln?Glu?Tyr?Pro?Trp?Glu?Lys?Pro?Lys?Thr?Leu?Lys?Phe
370 375 380
<210>4
<211>382
<212>PRT
＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)
<400>4
Met?Ala?Gly?Thr?Phe?Leu?Phe?Thr?Ser?Glu?Ser?Val?Gly?Glu?Gly?His
1 5 10 15
Pro?Asp?Lys?Leu?Cys?Asp?Gln?Val?Ser?Asp?Ala?Ile?Leu?Asp?Ala?Cys
20 25 30
Leu?Ala?Glu?Asp?Pro?His?Ser?Lys?Val?Ala?Cys?Glu?Thr?Ala?Ala?Lys
35 40 45
Thr?Gly?Met?Ile?Met?Val?Phe?Gly?Glu?Ile?Thr?Thr?Lys?Ala?Gln?Leu
50 55 60
Asp?Tyr?Gln?Lys?Ile?Val?Arg?Asp?Thr?Ile?Lys?Lys?Ile?Gly?Tyr?Asp
65 70 75 80
Asp?Ser?Ala?Lys?Gly?Phe?Asp?Tyr?Lys?Thr?Cys?Asn?Val?Leu?Val?Ala
85 90 95
Ile?Glu?Gln?Gln?Ser?Pro?Asp?Ile?Ala?Gln?Gly?Val?His?Glu?Glu?Lys
100 105 110
Asp?Leu?Glu?Asp?Ile?Gly?Ala?Ser?Asp?Gln?Gly?Ile?Met?Phe?Gly?Tyr
115 120 125
Ala?Thr?Asp?Glu?Thr?Pro?Glu?Gly?Leu?Pro?Leu?Thr?Ile?Leu?Leu?Ala
130 135 140
His?Lys?Leu?Asn?Met?Ala?Met?Ala?Asp?Ala?Arg?Arg?Asp?Gly?Ser?Leu
145 150 155 160
Ala?Trp?Leu?Arg?Pro?Asp?Thr?Lys?Thr?Gln?Val?Thr?Val?Glu?Tyr?Lys
165 170 175
Asp?Asp?His?Gly?Arg?Trp?Val?Pro?Gln?Arg?Ile?Asp?Thr?Val?Val?Val
180 185 190
Ser?Ala?Gln?His?Ala?Asp?Glu?Ile?Thr?Thr?Glu?Asp?Leu?Arg?Ala?Gln
195 200 205
Leu?Lys?Ser?Glu?Phe?Ile?Glu?Lys?Val?Ile?Pro?Arg?Asp?Met?Leu?Asp
210 215 220
Glu?Asn?Thr?Lys?Tyr?Phe?Ile?Gln?Pro?Ser?Gly?Arg?Phe?Val?Ile?Gly
225 230 235 240
Gly?Pro?Gln?Gly?Asp?Ala?Gly?Leu?Thr?Gly?Arg?Lys?Ile?Ile?Val?Asp
245 250 255
Ala?Tyr?Gly?Gly?Ala?Ser?Ser?Val?Gly?Gly?Gly?Ala?Phe?Ser?Gly?Lys
260 265 270
Asp?Tyr?Ser?Lys?Val?Asp?Arg?Ser?Ala?Ala?Tyr?Ala?Ala?Arg?Trp?Val
275 280 285
Ala?Lys?Ser?Leu?Val?Ala?Ala?Gly?Leu?Cys?Lys?Arg?Val?Gln?Val?Gln
290 295 300
Phe?Ser?Tyr?Ala?Ile?Gly?Ile?Ala?Glu?Pro?Leu?Ser?Leu?His?Val?Asp
305 310 315 320
Thr?Tyr?Gly?Thr?Ala?Thr?Lys?Ser?Asp?Glu?Glu?Ile?Ile?Asp?Ile?Ile
325 330 335
Ser?Lys?Asn?Phe?Asp?Leu?Arg?Pro?Gly?Val?Leu?Val?Lys?Glu?Leu?Asp
340 345 350
Leu?Ser?Arg?Pro?Ile?Tyr?Leu?Pro?Thr?Ala?Ser?Tyr?Gly?His?Phe?Thr
355 360 365
Asn?Gln?Glu?Tyr?Pro?Trp?Glu?Lys?Pro?Lys?Thr?Leu?Lys?Phe
370 375 380

Claims (2)

1. improved overlapping extension PCR method is characterized in that:
Reaction process is divided into following step:
(1) fragment is synthetic: the full-length gene with required sudden change is a template, and the number design series of parallel primer according to the mutational site comprises base to be suddenlyd change in the primer, overlap section of tip designs of every adjacent a pair of primer, and length is 20-30bp; Adopt above-mentioned every adjacent a pair of primer to carry out parallel PCR respectively, realize the amplification of each DNA small segment;
(2) two mixing: the above-mentioned fragment of purifying respectively, be divided into different components, the dna fragmentation that equivalent is adjacent mixes respectively in twos, and template each other between the fragment increases into long segment in overlapping extension PCR mode, reacts to be no primer PCR process;
(3) the pre-extension: above-mentioned many group reactions after product is mixed, and template each other between the long segment of new formation increases into the total length new template in overlapping extension PCR mode, and this step also is no primer PCR process;
(4) full length DNA is synthetic: add the pair of outside primer of full-length gene in above-mentioned reaction system, the recombinant full-lenght DNA that produces with previous step is a template, and pcr amplification goes out full-length gene;
(5) extend the back: above-mentioned reaction system again through 94 ℃ of sex change 30s of 10 round-robin, is annealed and extension 1min for 72 ℃.
2. the mutator gene that is obtained by the described method of claim 1 is characterized in that: have the nucleotide sequence among the sequence table SEQ ID No:3.
CNB2005100464149A 2005-05-13 2005-05-13 Improved overlap extension PCR process and mutation gene obtained thereby Expired - Fee Related CN100460515C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100464149A CN100460515C (en) 2005-05-13 2005-05-13 Improved overlap extension PCR process and mutation gene obtained thereby

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100464149A CN100460515C (en) 2005-05-13 2005-05-13 Improved overlap extension PCR process and mutation gene obtained thereby

Publications (2)

Publication Number Publication Date
CN1861799A true CN1861799A (en) 2006-11-15
CN100460515C CN100460515C (en) 2009-02-11

Family

ID=37389329

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100464149A Expired - Fee Related CN100460515C (en) 2005-05-13 2005-05-13 Improved overlap extension PCR process and mutation gene obtained thereby

Country Status (1)

Country Link
CN (1) CN100460515C (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101899434A (en) * 2010-06-18 2010-12-01 南方医科大学 Overlap extension PCR method capable of connecting multiple fragments
CN102031250A (en) * 2010-09-19 2011-04-27 生工生物工程(上海)有限公司 Synthesis method of gene containing repetitive sequences
CN102051396A (en) * 2009-11-04 2011-05-11 无锡天演生物技术有限公司 Goose-array type localized random mutation method and application thereof in monoclonal antibody molecular evolution technology
CN102899345A (en) * 2012-09-18 2013-01-30 江南大学 Method for quickly and efficiently building recombinant plasmid with two mutation points
CN103289989A (en) * 2013-04-01 2013-09-11 哈尔滨体育学院 A method for rapid cloning of physical quality regulation genes of elite winter sports athletes
CN105400772A (en) * 2015-12-10 2016-03-16 华侨大学 A site-directed multi-site gene mutagenesis method
CN105441422A (en) * 2014-09-18 2016-03-30 深圳华大基因研究院 Multisite mutation method for DNA molecule
CN105907746A (en) * 2015-12-18 2016-08-31 戚智青 IHF protein-based gene mutation method
CN110894499A (en) * 2019-11-29 2020-03-20 湖北文理学院 Gene site-directed mutagenesis method

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102051396A (en) * 2009-11-04 2011-05-11 无锡天演生物技术有限公司 Goose-array type localized random mutation method and application thereof in monoclonal antibody molecular evolution technology
WO2011054150A1 (en) * 2009-11-04 2011-05-12 无锡天演生物技术有限公司 Method of site-directed mutagenesis by overlapping pcr and use thereof in screening monoclonal antibody
CN102051396B (en) * 2009-11-04 2014-07-16 无锡天演生物技术有限公司 Goose-array type localized random mutation method and application thereof in monoclonal antibody molecular evolution technology
CN101899434A (en) * 2010-06-18 2010-12-01 南方医科大学 Overlap extension PCR method capable of connecting multiple fragments
CN102031250A (en) * 2010-09-19 2011-04-27 生工生物工程(上海)有限公司 Synthesis method of gene containing repetitive sequences
CN102031250B (en) * 2010-09-19 2012-06-27 生工生物工程(上海)有限公司 Synthesis method of gene containing repetitive sequences
CN102899345A (en) * 2012-09-18 2013-01-30 江南大学 Method for quickly and efficiently building recombinant plasmid with two mutation points
CN103289989A (en) * 2013-04-01 2013-09-11 哈尔滨体育学院 A method for rapid cloning of physical quality regulation genes of elite winter sports athletes
CN105441422A (en) * 2014-09-18 2016-03-30 深圳华大基因研究院 Multisite mutation method for DNA molecule
CN105400772A (en) * 2015-12-10 2016-03-16 华侨大学 A site-directed multi-site gene mutagenesis method
CN105907746A (en) * 2015-12-18 2016-08-31 戚智青 IHF protein-based gene mutation method
CN110894499A (en) * 2019-11-29 2020-03-20 湖北文理学院 Gene site-directed mutagenesis method

Also Published As

Publication number Publication date
CN100460515C (en) 2009-02-11

Similar Documents

Publication Publication Date Title
CN1861799A (en) Improved overlap extension PCR process and mutation gene obtained thereby
CN1513057A (en) Host microorganisms
CN1132529A (en) DNA sequencing enzymes
CN1283780C (en) Method for constructing genetic engineering fungus of monascus with no citrinin
CN1308457C (en) Method for fermentatively producing s-adenosylmethionine
CN1262644C (en) Nitrile hydratase and its coding gene and use
CN1966678A (en) Mutant xylose isomerase and gene and application thereof
CN101035895A (en) Yeast promoter
CN1814761A (en) Pyrroloquinoline quinone synthesis related gene and its coding protein
CN1693473A (en) Method of prepairing peltoglucose syrup and high temperature resistant glucose isomerase mutant
CN1827640A (en) Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof
CN1902218A (en) Yeast strains with improved fructose fermentation capacity
CN1190492C (en) Cotton Na+/H+ reverse transport protein gene and its cloning method and use
CN1966702A (en) Use of glucose isomerase mutant
CN1772903A (en) New-type froctosan saccharase gene and its use
CN101041830A (en) Bacillus subtilis exocytosis expression carrier
CN1891718A (en) Fusion immunotoxin ML-L-SEC2 and gene and its preparation
CN1206356C (en) Breeding of hepatitis A virus Chinese strain and attenuated strain and its complementary DNA sequence
CN1861789A (en) Integrated gene recombined process, recombined gene and coding protein obtained thereby
CN1930291A (en) Modified promoter
CN1250737C (en) PCR process for preparing CpG DNA containing livestock and bird vaccine adjuvant
CN1904071A (en) Method of discriminating good and bad production of spirurina strain
CN101056978A (en) Process for producing cohesive alcohol fermentation yeast and cohesive alcohol fermentation yeast
CN1834248A (en) Method of modifying gene and obtained recombinant gene and encoded protin
CN1242061C (en) Short finger gene

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20090211

Termination date: 20110513