CN1807639A - L-lactate dehydrogenase gene and its coded amino acid sequence and the primer designed in preparation process - Google Patents

Abstract

The invention discloses an amino acid sequence and designed primer preparing process of dehydrogenase gene and encode, which is characterized by the following: the DNA of effective producing hydrogen bacterium B49 is applied in mold; the L-lactate dehydrogenase gene is gained by PCR expanding; the whole long of sequence is 1139bp (T=227bp, C=336bp, G=337bp, A=239bp); the initiator codon ATG is on 109bp; the terminator codon TAA is on1057bp; the sequence possesses no introne, which possesses the whole open-reading-frame of 951bp, coding 316 amino acids and P1-P10 ten primers.

Description

The primer that designs in a kind of L-lactate dehydrogenase gene and amino acid sequence coded and the preparation process

Technical field

The present invention relates to the primer that designs in a kind of dehydrogenase gene and amino acid sequence coded thereof and the preparation process.

Background technology

Highly effective hydrogen yield bacterium B49 (Chinese microorganism strain preservation center preserving number is CGMCC1153) is that an isolated plant height produces ethanolic hydrogen type fermentation strain from the ethanol-type fermentation active sludge of biological hydrogen production reactor.Its high specific hydrogen-producing speed is 25.0mmolH2/gdrycellh, and the unit volume hydrogen-producing speed is 1813.8mL/L-culture, and hydrogen production potential occupy international prostatitis.Its strain characteristics is the regular bacillus of unit cell growth; Peritrichous; G+; No pod membrane; No gemma; Obligate anaerobic; The circular bacterium colony of oyster white; Dai Shiwei 7.2h; At 28～43 ℃, grow under pH3.3～8.5 conditions.The main tunning of B49 glycolysis glucose is ethanol, acetate, H ₂, CO ₂And lactic acid, the pathways metabolism of supposition B49 glycolysis glucose is as shown in Figure 1.Serum lactic dehydrogenase (LDH) is the metabolic key enzyme of highly effective hydrogen yield bacterium B49, and in the metabolism of highly effective hydrogen yield bacterium B49, the generation of lactic acid can consume pyruvic acid, to producing the hydrogen fermentation had strong inhibitory effects is arranged; And the generation of hydrogen can consume pyruvic acid equally, reduces the output of lactic acid.Therefore the gene studies of serum lactic dehydrogenase (LDH) all has great significance to lactic acid producing amount and the hydrogen output that industry improves highly effective hydrogen yield bacterium B49 in the highly effective hydrogen yield bacterium B49 pathways metabolism.

Summary of the invention

In view of the research of lactate dehydrogenase gene all has great significance to lactic acid producing amount and the hydrogen output that industry improves highly effective hydrogen yield bacterium B49, the present invention is intended to separating lactic acid dehydrogenase gene from Ethanologenbacterium hit B49 genome.Ethanologenbacterium hit B49 lactate dehydrogenase gene Bldh of the present invention is that the DNA with highly effective hydrogen yield bacterium Ethanologenbacterium hit B49 is a template, obtains by pcr amplification.L-lactate dehydrogenase gene sequence total length 1139bp of the present invention, wherein T, C, G, A are respectively 227bp (20%), 336bp (29%), 337bp (30%), 239bp (21%).At the 109bp place initiator codon ATG is arranged, terminator codon TAA is arranged at the 1057bp place.This sequence intronless has the complete opening code-reading frame of 951bp, 316 amino acid of encoding.The coded product molecular weight is 34.233kD, and iso-electric point pI is 6.34.The gene order compare of analysis, with registered L-serum lactic dehydrogenase homology be 49～55%, wherein the homology with Bacillus cereus ATCC 14579 lactate dehydrogenase genes is up to 55%, proves a new bacterium lactate dehydrogenase gene.Isolating L-lactate dehydrogenase gene is connected with prokaryotic expression carrier pet-22b, is built into the pet-22b-LDH recombinant expression vector, after IPTG induces, give expression to the target protein of 36～38Kd, confirm that this gene has expressive function.The present invention has designed P for preparation L-lactate dehydrogenase gene ₁～P ₁₀Ten primers.

The present invention separates the L-lactate dehydrogenase gene from Ethanologenbacterium hit B49 genome, enlarge L-lactate dehydrogenase gene resource, provide basic substance thereby study and make up engineering strain for the metabolic engineering of Ethanologenbacterium hit B49.

Description of drawings

Fig. 1 is the pathways metabolism figure that infers B49 glycolysis glucose; Fig. 2 is a pMD18-T carrier structure collection of illustrative plates; Fig. 3 is the restriction enzyme site structure iron of pMD18-T carrier; Fig. 4 is TaKaRa LA PCR ^TMThe pcr amplification schematic diagram of invitro cloning Kit test kit; Fig. 5 is Auele Specific Primer design attitude figure, and white portion is that darker regions is a known region among zone of ignorance, the figure among the figure; Fig. 6 is a pet-22b carrier structure collection of illustrative plates, and Fig. 7 is the restriction enzyme site structure iron of pet-22b carrier.

Embodiment

Embodiment one: the Ethanologenbacterium hit B49L-lactate dehydrogenase gene Bldh described in the present embodiment is that the DNA of the highly effective hydrogen yield bacterium Ethanologenbacterium hit B49 that is separated to this laboratory is a template, obtains by pcr amplification.Its concrete grammar is as follows:

1, the clone of lactate dehydrogenase gene

(1) PCR primer design:

According to the bacterium serum lactic dehydrogenase protein sequence of including among the GenBank (concrete bacterial classification sees Table 1), adopt software Genefisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/) design one couple of PCR amplification degenerated primer P ₁And P ₂, primer P ₁And P ₂Sequence see Table 2:

The proteinic bacterial classification of the table 1 design used serum lactic dehydrogenase of lactate dehydrogenase gene degenerated primer

The lactic dehydrogenase zymoprotein	Bacterial classification
		The L-serum lactic dehydrogenase	Clostridium acetobutylicum CAC0267
The L-serum lactic dehydrogenase	Clostridium acetobutylicum CAC3552
		The L-serum lactic dehydrogenase	Clostridium perfringens CPE0103
The L-serum lactic dehydrogenase	Clostridium tetani E88 CTC01998

The L-serum lactic dehydrogenase	Clostridium thermocellum
		The L-serum lactic dehydrogenase	Thermoanaerobacter saccharolyticum

The degenerated primer of the amplification serum lactic dehydrogenase of table 2.Genefisher software design

The primer title	Primer sequence	Degeneracy
			P 1: LDHJ1-forward (5 ' end primer)	5’-CNRANGGNGARGCNHTGGA-3’	3072
P 2: LDHJ1-reverse (3 ' end primer)	5’-RBANACRTCNTTDATNCCRTA-3’	4608

N (A, C, T or G) R (A or G) H (non-G) B (non-A) D (non-C)

(2) extraction of the genomic DNA of Ethanologenbacterium hit B49:

Get Ethanologenbacterium hit B49 bacterium liquid 50mL; magnificent Shun's a small amount of bacterial genomes DNA extraction agent box (W6511) of producing with Shanghai China Shun biotechnology company limited extracts the genomic DNA of Ethanologenbacterium hit B49, and extraction step uses operational manual referring to a small amount of bacterial genomes DNA extraction agent box (W6511).

(3) the segmental pcr amplification of lactate dehydrogenase gene part:

DNA with Ethanologenbacterium hit B49 is that template is carried out pcr amplification.Reaction system: 5 μ L1 * Buffer, 0.6mM dNTP, primer P ₁And P ₂Each 1.0 μ M, ExTaqDNA polysaccharase 2.5U, template DNA 0.2～1 μ g adds redistilled water to 50 μ L.The pcr amplification program: pre-95 ℃ of 5min of sex change, 94 ℃ of 30s fall for 1 ℃ since 62 ℃ of every 40s reductions and to put 50 ℃, and 72 ℃ of 2min circulate 12 times; And then by 94 ℃ of 30s of sex change, the 50 ℃ of 40s that anneal extend 72 ℃ of 2min, circulate 23 times; Extend 72 ℃ of 10min, last 4 ℃ of preservations.

(4) clone of PCR product:

Pillar China Shun a small amount of glue that the PCR product is produced with Shanghai China Shun biotechnology company limited reclaims test kit, and (W5211 W5212) reclaims, and recycling step is referring to the test kit operational manual.Reclaiming product is connected with the pMD18-T cloning vector, because pMD18-T Vector is a kind of dedicated carrier of high-efficient cloning PCR product commonly used, regulating and controlling sequence and 146 amino acid whose coded messages of N-end of having one section intestinal bacteria lacZ, if no foreign gene inserts, the C-terminal sequence of carrier and intestinal bacteria lacZ has complementary functions, be the α complementation, producing has complete active beta-galactosidase enzymes; If there is foreign gene to insert, then destroyed reading frame, produce the peptide section of the complementary ability of no α, so white colony is the bacterium that has recombinant plasmid on the screening culture medium of additional X-gal and IPTG, blue colonies is the bacterium that has the recirculation carrier.The pMD18-T carrier is available from Dalian Bao Bio-Engineering Company in the present embodiment, and pMD18-T plasmid map and restriction enzyme site thereof are as shown in Figures 2 and 3.Reclaiming product is connected with the pMD18-T cloning vector: pMD18-T carrier 1 μ L (50ng), (100～200ng), Ligation Solution 5 μ L add redistilled water to 10 μ L to PCR product 2 μ L, and 16 ℃ connect 0.5～3h.Connect then product with heat shock method Transformed E .ColiDH5 α competent cell: a, get 200 μ L competent cells, place on ice, add 4 μ L and connect product, rotate the mixing content gently; B, ice bath 30min; Heat shock 90s in c, the 42 ℃ of water-baths does not shake; D, ice bath 2-3min; The LB substratum of e, adding 800 μ L antibiotic-frees, mixing is at the shaking table shaking culture 45-60min of 37 ℃ of 200～250r/min; F, the centrifugal 5min of room temperature, 4000r/min discards 900 μ L supernatant liquors, and the residue thalline suspends; G, the suspension thalline is coated on the LB solid medium of additional 50mg/L Amp, 4 μ L IPTG and 40 μ L X-gal; H, flat board are placed to liquid in 37 ℃ of forwards and are absorbed, and are inverted then and cultivate 8～12h.Screen dull and stereotyped enterprising row filter at the LB that contains penbritin (Amp), X-gal and IPTG at last, white colony is tentatively regarded as positive recombinant, and extracts hickie bacterium colony plasmid and carry out bacterium colony PCR, to identify positive recombinant.

Wherein, adopt CaCl ₂Legal system is equipped with E.coliDH5 α competent cell: a, E.coliDH5 α streak culture 12-16h on the LB flat board, and picking list bacterium colony inserts and do not contain in the antibiotic LB liquid nutrient medium, 37 ℃ of vibration activation 8～12h; B, get activatory E.coliDH5 α bacterium liquid 1mL and place the fresh LB liquid nutrient medium of 100mL, 37 ℃ of shaking culture are to OD ₆₀₀Value is 0.3 ± 0.05; C, bacterium liquid is sub-packed in the 50mL sterilization centrifuge tube of two precoolings ice bath 30min; D, under 4 ℃ of conditions centrifugal 10min, 4000r/min, and abandon supernatant liquor; E, the ice-cold 0.1MCaCl of adding 10mL ₂, resuspended thalline, ice bath 30min; F, centrifugal 10min under 4 ℃ of conditions again, 4000r/min, and abandon supernatant liquor; G, the ice-cold 0.1MCaCl of adding 2mL ₂, resuspended thalline promptly obtains E.coliDH5 α competent cell.The bacterium colony PCR of positive recombinant identifies and is undertaken by following steps: picking hickie bacterium colony at first, utilize universal primer RV-M and M13-47 to carry out bacterium colony PCR: pre-95 ℃ of 10min of sex change, 94 ℃ of 30s of sex change, 50 ℃ of 30s of sex change extend 72 ℃ of 90s, totally 35 circulations; Extend 72 ℃ of 10min, 4 ℃ of preservations; And then carry out 0.8% agarose gel electrophoresis, and if electrophoresis showed goes out the target DNA band, show that then the plasmid reorganization is correct, be positive recombinant.

(5) determined dna sequence and analysis:

Positive recombinant selects for use the handsome Bioisystech Co., Ltd in Invitrogen Shanghai automatic sequence analyser to carry out sequencing, and the sequence homology comparison is carried out with blast program on http://www.ncbi.nlm.gov website.

(6) design of primers of clone L-lactate dehydrogenase gene part fragment both sides sequence C assette PCR:

Adopt TaKaRa LA PCR ^TMIn vitro cloning Kit test kit clone L-lactate dehydrogenase gene fragment both sides sequence.Based on the L-lactate dehydrogenase gene fragment sequence of having cloned, the upstream primer P that Cassette primer C1, Cassette primer C2 primer mate respectively in design and the test kit ₃, P ₄With downstream primer P ₅, P ₆Cassette primer C1, Cassette primer C2, P ₃, P ₄, P ₅, P ₆Sequence see Table 3.

The Cassette PCR primer of table 3. amplification lactate dehydrogenase gene part fragment both sides sequence

The primer title	Primer sequence
		Cassette primer C1	5’-GTACATATTGTCGTTAGAACGCGTAATACGACTCA-3’
Cassette primer C2	5’-CGTTAGAACGCGTAATACGACTCACTATAGGGAGA-3’
		P 3：LDH-S11-lower	5’-CACATACAGGTTGTCCGGCTTTGC-3’
P 4：LDH-S12-lower	5’-GCGACTATTTCAAGGTGGACCCGCGCAACGTG-3’
		P 5：LDH-S21-upper	5’-TTGCAAAGCCGGACAACCTGTATGTGACGTAG-3’
P 6：LDH-S22-upper	5’-CCCGCGTAGATTTTCATGTTGGTGC-3’

Wherein, the principle of Cassette PCR and design of primers require as follows:

Cassette PCR principle: principle is seen Fig. 4.Because in design, 5 ' end of Cassette does not have phosphate, so the 3 ' 5 ' terminal connecting portion terminal and Cassette of Target DNA forms breach.At first circulation time of the PCR reaction first time, the extension that begins from Primer C1 stops at connecting portion, has limited the amplification between Primer C1 and the same primer of Primer C1, thereby has controlled non-specific pcr amplification.Have only from Primer S1 to begin to extend synthetic DNA chain, just can become the template of PrimerC1, carry out the specificity extension self-increasing reaction of DNA.(Primer C2 PrimerS2) further carries out the PCR reaction second time, and target DNA specifically can efficiently increase to use inboard Primer again.

When proteinic aminoacid sequence is known, can design Mixed primer according to Given information, the proteinic cDNA of amplification coding.

As follows according to this test kit principle of work general operation step:

A, with suitable restriction enzyme will be to be cloned Target DNA decompose fully;

B, carry out ligation with Cassette with corresponding restriction enzyme restriction enzyme site;

C, with Cassette Primer (Primer C1) with according to the Primer (Primer S1) of the dna sequence dna of known region design, carry out the 1st PCR (1st PCR) reaction;

D, a part of getting 1st PCR reaction solution are made template, use inboard Primer (Primer C2 and Primer S2) to carry out the 2nd PCR (2nd PCR) reaction, and target DNA fragment specifically increases.

Specific Primer (S1, standard S2):

According to known region design Primer (see figure 5).Design direction is the direction that needs the zone of ignorance of amplification.The inboard at S1 should be designed in the position of S2, and the distance between two primers does not have strict regulation.

Design also should be noted that during primer following some:

1. primer length is that 20～35mer (is preferably 30～35mer) during amplification long-chain DNA.

2. GC content avoids local GC or AT to concentrate about 50%.Particularly AT is unconcentrated for 3 of primer ' end.

3. primer self does not form tangible secondary structures such as hair clip.

4. two Specific Primer (S1, S2) will be used in combination with Cassette Primer (C1, C2), so design the time also will be considered to form primer dimer with the paired primer, particularly 3,4 bases of 3 ' end not with the complementation of paired primer sequence.

(7) the Cassette pcr amplification of clone's lactate dehydrogenase gene part fragment both sides sequence:

According to the L-lactate dehydrogenase gene fragment sequence of having cloned, analyze the restriction endonuclease sites situation of this sequence, find out the restriction enzyme that this sequence does not have, and TaKaRa LA PCR ^TMThe restriction enzyme that this enzyme joint is arranged in the in vitrocloning Kit test kit, selected at last HindIII enzyme is cut genomic dna, and the genomic dna after enzyme is cut is connected 3h with HindIII in 16 ℃.Cassette PCR reaction system and reaction conditions are as follows:

The restriction enzyme endonuclease reaction of a, DNA: reaction system sees Table 4

The restriction enzyme of table 4DNA is cut reaction system

DNA	5μg
		The HindIII restriction enzyme	50U*
10 * restriction enzyme Buffer	5μL
		Sterile purified water	up to 50μL

* expression necessary enzyme amount that DNA is decomposed fully decide according to the DNA purity of preparation, and generally 10U decomposes 1 μ g DNA.

B, ligation

1. press component preparation ligation liquid in the table 5.By following component preparation ligation liquid.

Table 5

The DNA fragment	5μL
		HindIII Cassette joint	2.5μL
Ligation Solution I	15μL
		Ligation Solution II	7.5μL

2. 16 ℃ are reacted 30min

3. after reaction finishes, carry out ethanol sedimentation and reclaim DNA.

4. be dissolved in the sterile purified water of 5 μ L.

C, pcr amplification

1. with b-4. dna solution 1 μ L join in the 33.5 μ L sterile purified waters, 94 ℃ the heating 10min.

2. press component preparation PCR (1st PCR) the reaction solution first time in the table 6.

Table 6

C-dna solution 1.	34.5μL
		10×LA PCR Buffer II(Mg 2+plus)	5μL
TaKaRa LA Taq	0.5μL
		dNTP Mixture	8μL
Primer C1	1μL
		Primer CS-1	1μL

3. carry out 1st PCR reaction: 94 ℃ of 30s of sex change, the 55 ℃ of 2min that anneal extend 72 ℃ of 1min, circulate 30 times.

4. with aqua sterilisa b-PCR reaction solution is 3. diluted (1～10000 times of dilution), get 1 μ L again and carry out 2nd PCR reaction, 2nd PCR reaction solution component such as table 7.

Table 7 2nd PCR reaction solution component

B-1st PCR reaction solution (or diluent) 4.	1μL
		10×LA PCR Buffer II(Mg 2+plus)	5μL
TaKaRa LA Taq	0.5μL
		dNTP Mixture	8μL
Primer C2	1μL
		Primer CS-2	1μL
Sterile purified water	up to 50μL

5. carry out 2nd PCR reaction: 94 ℃ of 30s of sex change, the 55 ℃ of 2min that anneal extend 72 ℃ of 1min, circulate 30 times.

6. after reaction finishes, get 2nd PCR reaction solution (5～10 μ L) and carry out agarose gel electrophoresis, purpose PCR fragment obtains increasing.

(8) pcr amplification of serum lactic dehydrogenase full-length gene, clone and order-checking:

According to the sequences Design of having spliced total length checking primer P ₇And P ₈(P ₇And P ₈Sequence see Table 8), be template amplification total length L-lactate dehydrogenase gene with the genomic DNA of Ethanologenbacterium hit B49.The PCR reaction system is 94 ℃ of 5min of pre-sex change; 94 ℃ of 30s of sex change, the 58 ℃ of 30s that anneal extend 72 ℃ of 80s, circulate 35 times; Last 72 ℃ are extended 10min.

Table 8 lactate dehydrogenase gene total length checking primer P ₇And P ₈

The primer title	Primer sequence
		P 7：LDH-upper	5’-GGATAATCTCCCCTGCCCGTGCGGATACTA-3’
P 8：LDH-lower	5’-CATCAACACCTCACAGACAAAGATCGGCCATT-3’

(9) lactate dehydrogenase gene is expressed in e. coli bl21 (DE3) plys and is detected

Lactate dehydrogenase gene Bldh and prokaryotic expression carrier pet-22b reorganization, be built into recombinant expression plasmid pet-22b-Bldh, the heat shock method is transformed in prokaryotic expression host bacterium E.coliBL21 (DE3) competent cell, 1.0mM after IPTG induced 3.5h, the SDS-PAGE gel electrophoresis through 12%, coomassie brilliant blue staining detected the expression of gene situation.The pet-22b carrier is purchased the company in Novagen, and its plasmid map and restriction enzyme site are seen Fig. 6 and Fig. 7.According to the multiple clone site sequence of pet-22b expression vector, locate to introduce Nde I restriction enzyme site at the 109bp of lactate dehydrogenase gene (initiator codon ATG), locate to introduce Xho I restriction enzyme site, primer P at 1057bp (terminator codon TAA) ₉, P ₁₀Sequence see Table 9.PCR reaction conditions: pre-95 ℃ of 5min of sex change; 94 ℃ of 30s of sex change, the 58 ℃ of 30s that anneal extend 72 ℃ of 80s, circulate 35 times; Extend 72 ℃ of 10min at last.Glue reclaims the PCR product, cuts through Nde I and Xho I enzyme, reclaims at glue, is connected 3h with the pet-22b prokaryotic expression carrier that Nde I cuts with Xho I enzyme and glue reclaims in 16 ℃ with same.Should connect product Transformed E .ColiDH5 α competent cell.Carry out blue hickie screening on the LB screening flat board of penbritin, X-gal and IPTG containing, and extract hickie bacterium colony plasmid and carry out bacterium colony PCR to identify positive recombinant.Extract the positive colony plasmid, this plasmid is transformed BL21 (DE3) plys competent cell.Carry out blue hickie screening on the LB screening flat board of penbritin, X-gal and IPTG containing, and extract hickie bacterium colony plasmid and carry out bacterium colony PCR to identify positive recombinant.

Table 9 lactate dehydrogenase gene is expressed and is used primer P ₉, P ₁₀

The primer title	Primer sequence	Introduce restriction enzyme site
			P 9：LDH-22b-forward	5’-AAAAGGAGCGATCCATATGTGCACCGACAACCGC-3’	Nde I
P 10：LDH-22b-reverse	5’-GTTAATCTAGAAAATGTCAACCCGGAGACGGCCTGCTCCAG-3’	Xho I

2, Ethanologenbacterium hit B49 lactic dehydrogenase enzyme activity determination

A, reagent

1. dissociating buffer: 0.05mol/L pH7.4 phosphate buffered saline buffer;

2. reaction buffer: 0.1mol/L pH7.4 phosphate buffered saline buffer; 12mmol/L NADH, Sigma company product; 0.16mol/L Sodium.alpha.-ketopropionate, homemade analytical pure.

B, measuring method

Under 25 ℃, the condition of ultraviolet wavelength 340nm, in measuring cuvette, add reaction buffer 1.06mL successively, dilution enzyme liquid 0.015mL, NADH0.03mL; Other gets a cuvette is control tube, wherein adds reaction buffer and enzyme liquid, lashes mixing.The absorbance that initial NADH in the pipe measured in record is A ₁, in measuring pipe, accurately adding Sodium.alpha.-ketopropionate 0.03mL then and start reaction, the setting-up time scanning sequence is 1 A value of every 0.5min record, METHOD FOR CONTINUOUS DETERMINATION 3min and note are A ₂OD with A ₃₄₀Value was mapped to the time, calculated Δ A minimizing value (A ₁-A ₂), and the vigor of calculating enzyme.

C, protein content determination

Adopt Shanghai China Shun biotechnology BCA of company limited protein content determination test kit, step is referring to BCA protein content determination test kit operational manual.

The live definition (U) of unit of d, enzyme: under 25 ℃, pH7.0 condition, the enzyme amount of 1min oxidation 1 μ mol NADH is 1U.

It is 7.8 than work that present embodiment is measured the L-serum lactic dehydrogenase.

Ethanologenbacterium hit B49 lactate dehydrogenase gene Bldh in the present embodiment is a L type serum lactic dehydrogenase, registered sequence exists than big-difference among this gene of Blast homology comparison result shows of sequence and the GenBank, is a new gene.This full length gene 1139bp, wherein T, C, G, A are respectively 227bp (20%), 336bp (29%), 337bp (30%), 239bp (21%).At the 109bp place initiator codon ATG is arranged, terminator codon TAA is arranged at the 1057bp place.This sequence intronless has the complete opening code-reading frame of 951bp, 316 amino acid of encoding.The coded product molecular weight is 34.233kD, and iso-electric point pI is 6.34.

Sequence table

＜110〉Harbin Institute of Technology

＜120〉primer that designs in a kind of L-lactate dehydrogenase gene and amino acid sequence coded and the preparation process

<160>12

<210>1

<211>1139

<212>DNA

＜213〉producing and ethanol Bacillaceae (Ethanologenbacterium ssp.)

<220>

<221>CDS

<222>(109)...(1059)

<400>1

ggataatctc ccctgcccgt gcggatacta aggcgtgtgc acagccgggc gggaggcaca 60

cgcgattcgt attgatttga caacaaccaa acaaaaggag cgatcttt atg tgc acc gac 120

Met Cys Thr Asp

1

aac cgc aaa gtc gtg ctg gta ggc acc gga ctg gtg ggc atg agt ttt 168

Asn Arg Lys Val Val Leu Val Gly Thr Gly Leu Val Gly Met Ser Phe

5 10 15 20

gcc tac gcc ctg ctc aac cag cac gca tgt gac gaa ctg gtc ctc att 216

Ala Tyr Ala Leu Leu Asn Gln His Ala Cys Asp Glu Leu Val Leu Ile

25 30 35

gat atc aac aaa cag cgt gct gag ggt gag gcg atg gac ctc aac cat 264

Asp Ile Asn Lys Gln Arg Ala Glu Gly Glu Ala Met Asp Leu Asn His

40 45 50

ggt ctg gcg ttt tcc ggc acc aac atg aaa atc tac gcg ggc gat tac 312

Gly Leu Ala Phe Ser Gly Thr Asn Met Lys Ile Tyr Ala Gly Asp Tyr

55 60 65

aag gac tgc gcc gac gcc gac atc gtg gcc atc tgc gcg ggc gtg gcg 360

Lys Asp Cys Ala Asp Ala Asp Ile Val Ala Ile Cys Ala Gly Val Ala

70 75 80

cag aaa ccg ggc gag agc cgg atg gat ctg ctg cag cgc aac acc gcc 408

Gln Lys Pro Gly Glu Ser Arg Met Asp Leu Leu Gln Arg Asn Thr Ala

85 90 95 100

gtg ttc aaa tcc atc gtg gag ccg gtg gtg gct tcg gga ttt tcc ggc 456

Val Phe Lys Ser Ile Val Glu Pro Val Val Ala Ser Gly Phe Ser Gly

105 110 115

gtg ttt ctt gtg gcc acc aat ccg gtg gac atc atg tcc tac gtc aca 504

Val Phe Leu Val Ala Thr Asn Pro Val Asp Ile Met Ser Tyr Val Thr

120 125 130

tac agg ttg tcc ggc ttt gca aaa ggc cgc atc gtg ggc acc ggc acc 552

Tyr Arg Leu Ser Gly Phe Ala Lys Gly Ary Ile Val Gly Thr Gly Thr

135 140 145

acg ctg gac acc gcc cgc ctg cgc tac ctg ctg ggc gac tat ttc aag 600

Thr Leu Asp Thr Ala Arg Leu Arg Tyr Leu Leu Gly Asp Tyr Phe Lys

150 155 160

gtg gac ccg cgc aac gtg cat gct tat gtg atg ggc gag cac ggc gac 648

Val Asp Pro Arg Asn Val His Ala Tyr Val Met Gly Glu His Gly Asp

165 170 175 180

agt gag ttt gtg ccg tgg tcg cag gcg ctt ata gcc acc cgc ccg gtg 696

Ser Glu Phe Val Pro Trp Ser Gln Ala Leu Ile Ala Thr Arg Pro Val

185 190 195

atg ggg ctt tgc gtg gaa aac cac ggc ccg gac tat aaa gcc ggc atg 744

Met Gly Leu Cys Val Glu Asn His Gly Pro Asp Tyr Lys Ala Gly Met

200 205 210

ctc cac atc ggt gag gaa gtc cgc acc gct gcc tac cgc atc atc gaa 792

Leu His Ile Gly Glu Glu Val Arg Thr Ala Ala Tyr Arg Ile Ile Glu

215 220 225

gcc aaa aaa gcc acc tat tac ggg atc ggc atg gcc atg gtg cgc gtg 840

Ala Lys Lys Ala Thr Tyr Tyr Gly Ile Gly Met Ala Met Val Arg Val

230 235 240

gcc cgc gcc att ctc ggc ggc gaa aac agc gtg ctc acc gtt tcc tcg 888

Ala Arg Ala Ile Leu Gly Gly Glu Asn Ser Val Leu Thr Val Ser Ser

245 250 255 260

ctg ctc gac gac gac tac ggc acc ccc aag gtc tat gcc ggc gtg ccg 936

Leu Leu Asp Asp Asp Tyr Gly Thr Pro Lys Val Tyr Ala Gly Val Pro

265 270 275

tcc atc gtc agc cgg cgg ggc gtc agc cgt atc att cgg ctt tcg ctc 984

Ser Ile Val Ser Arg Arg Gly Val Ser Arg Ile Ile Arg Leu Ser Leu

280 285 290

aca ccg gaa gaa aat cag ctg atg caa gat tcc tgt gcc aaa ctg gag 1032

Thr Pro Glu Glu Asn Gln Leu Met Gln Asp Ser Cys Ala Lys Leu Glu

295 300 305

cag gcc gtc tcc ggg ttg aca ttt taa caatggccga tctttgtctg 1079

Gln Ala Val Ser Gly Leu Thr Phe

310 315

tgaggtgttg atgatgaaac tgttcgaacc gttcaacatc cgggagctca cggagctcac 1139

<210>2

<211>316

<212>PRT

＜213〉producing and ethanol Bacillaceae (Ethanologenbacterium ssp.)

<400>2

Met Cys Thr Asp Asn Arg Lys Val Val Leu Val Gly Thr Gly Leu Val

1 5 10 15

Gly Met Ser Phe Ala Tyr Ala Leu Leu Asn Gln His Ala Cys Asp Glu

20 25 30

Leu Val Leu Ile Asp Ile Asn Lys Gln Arg Ala Glu Gly Glu Ala Met

35 40 45

Asp Leu Asn His Gly Leu Ala Phe Ser Gly Thr Asn Met Lys lle Tyr

50 55 60

Ala Gly Asp Tyr Lys Asp Cys Ala Asp Ala Asp Ile Val Ala lle Cys

65 70 75 80

Ala Gly Val Ala Gln Lys Pro Gly Glu Ser Arg Met Asp Leu Leu Gln

85 90 95

Arg Asn Thr Ala Val Phe Lys Ser Ile Val Glu Pro Val Val Ala Ser

100 105 110

Gly Phe Ser Gly Val Phe Leu Val Ala Thr Asn Pro Val Asp Ile Met

115 120 125

Ser Tyr Val Thr Tyr Arg Leu Ser Gly Phe Ala Lys Gly Arg lle Val

130 135 140

Gly Thr Gly Thr Thr Leu Asp Thr Ala Arg Leu Arg Tyr Leu Leu Gly

145 150 155 160

Asp Tyr Phe Lys Val Asp Pro Arg Asn Val His Ala Tyr Val Met Gly

165 170 175

Glu His Gly Asp Ser Glu Phe Val Pro Trp Ser Gln Ala Leu Ile Ala

180 185 190

Thr Arg Pro Val Met Gly Leu Cys Val Glu Asn His Gly Pro Asp Tyr

195 200 205

Lys Ala Gly Met Leu His Ile Gly Glu Glu Val Arg Thr Ala Ala Tyr

210 215 220

Arg Ile Ile Glu Ala Lys Lys Ala Thr Tyr Tyr Gly lle Gly Met Ala

225 230 235 240

Met Val Arg Val Ala Arg Ala Ile Leu Gly Gly Glu Asn Ser Val Leu

245 250 255

Thr Val Ser Ser Leu Leu Asp Asp Asp Tyr Gly Thr Pro Lys Val Tyr

260 265 270

Ala Gly Val Pro Ser Ile Val Ser Arg Arg Gly Val Ser Arg Ile Ile

275 280 285

Arg Leu Ser Leu Thr Pro Glu Glu Asn Gln Leu Met Gln Asp Ser Cys

290 295 300

Ala Lys Leu Glu Gln Ala Val Ser Gly Leu Thr Phe

305 310 315

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(3，4，6，9，12，15，16)

＜223〉n=a or g or c or t; R=a or g; H=a or c or t

<400>3

gcnranggng argcnhtgga 20

<210>4

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1，2，4，7，10，13，16，19)

＜223〉n=a or g or c or t; R=a or g; B=g or c or t; D=a or g or t

<400>4

rbanacrtcn ttdatnccrt a 21

<210>5

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to Cassette primer C1 primer, to be used as the upstream primer that mates with Cassette primer C1 primer

<400>5

cacatacagg ttgtccggct ttgc 24

<210>6

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to Cassette primer C1 primer, to be used as the upstream primer that mates with Cassette primer C1 primer

<400>6

gcgactattt caaggtggac ccgcgcaacg tg 32

<210>7

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to Cassette primer C2 primer, to be used as the downstream primer that mates with Cassette primer C2 primer

<400>7

ttgcaaagcc ggacaacctg tatgtgacgt ag 32

<210>8

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to Cassette primer C2 primer, to be used as the downstream primer that mates with Cassette primer C2 primer

<400>8

cccgcgtaga ttttcatgtt ggtgc 25

<210>9

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to the sequence of having spliced, to verify primer as total length

<400>9

ggataatctc ccctgcccgt gcggatacta 30

<210>10

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉design according to the sequence of having spliced, to verify primer as total length

<400>10

catcaacacc tcacagacaa agatcggcca tt 32

<210>11

<211>34

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the multiple clone site sequence according to the pet-22b expression vector designs, to be used as the genetic expression primer

<400>11

aaaaggagcg atccatatgt gcaccgacaa ccgc 34

<210>12

<211>41

<212>DNA

＜213〉artificial sequence

<220>

＜223〉the multiple clone site sequence according to the pet-22b expression vector designs, to be used as the genetic expression primer

<400>12

gttaatctag aaaatgtcaa cccggagacg gcctgctcca g 41

Claims (3)

1, a kind of L-lactate dehydrogenase gene is characterized in that the gene order of L-serum lactic dehydrogenase is as follows:

GGATAATCTCCCCTGCCCGTGCGGATACTAAGGCGTGTGCACAGCCGGGCGGGAGGCACACGCGAT

TCGTATTGATTTGACAACAACCAAACAAAAGGAGCGATCTTTATGTGCACCGACAACCGCAAAGTC

GTGCTGGTAGGCACCGGACTGGTGGGCATGAGTTTTGCCTACGCCCTGCTCAACCAGCACGCATGT

GACGAACTGGTCCTCATTGATATCAACAAACAGCGTGCTGAGGGTGAGGCGATGGACCTCAACCAT

GGTCTGGCGTTTTCCGGCACCAACATGAAAATCTACGCGGGCGATTACAAGGACTGCGCCGACGCC

GACATCGTGGCCATCTGCGCGGGCGTGGCGCAGAAACCGGGCGAGAGCCGGATGGATCTGCTGCAG

CGCAACACCGCCGTGTTCAAATCCATCGTGGAGCCGGTGGTGGCTTCGGGATTTTCCGGCGTGTTT

CTTGTGGCCACCAATCCGGTGGACATCATGTCCTACGTCACATACAGGTTGTCCGGCTTTGCAAAA

GGCCGCATCGTGGGCACCGGCACCACGCTGGACACCGCCCGCCTGCGCTACCTGCTGGGCGACTAT

TTCAAGGTGGACCCGCGCAACGTGCATGCTTATGTGATGGGCGAGCACGGCGACAGTGAGTTTGTG

CCGTGGTCGCAGGCGCTTATAGCCACCCGCCCGGTGATGGGGCTTTGCGTGGAAAACCACGGCCCG

GACTATAAAGCCGGCATGCTCCACATCGGTGAGGAAGTCCGCACCGCTGCCTACCGCATCATCGAA

GCCAAAAAAGCCACCTATTACGGGATCGGCATGGCCATGGTGCGCGTGGCCCGCGCCATTCTCGGC

GGCGAAAACAGCGTGCTCACCGTTTCCTCGCTGCTCGACGACGACTACGGCACCCCCAAGGTCTAT

GCCGGCGTGCCGTCCATCGTCAGCCGGCGGGGCGTCAGCCGTATCATTCGGCTTTCGCTCACACCG

GAAGAAAATCAGCTGATGCAAGATTCCTGTGCCAAACTGGAGCAGGCCGTCTCCGGGTTGACATTT

TAACAATGGCCGATCTTTGTCTGTGAGGTGTTGATGATGAAACTGTTCGAACCGTTCAACATCCGG

GAGCTCACGGAGCTCAC。

2, a kind of L-lactate dehydrogenase gene amino acid sequence coded is characterized in that the coded aminoacid sequence of L-lactate dehydrogenase gene is as follows:

MetCysThrAspAsnArgLysValValLeuValGlyThrGlyLeuValGlyMetSerPheAlaTyr

AlaLeuLeuAsnGlnHisAlaCysAspGluLeuValLeuIleAspIleAsnLysGlnArgAlaGlu

GlyGluAlaMetAspLeuAsnHisGlyLeuAlaPheSerGlyThrAsnMetLysIleTyrAlaGly

AspTyrLysAspCysAlaAspAlaAspIleValAlaIleCysAlaGlyValAlaGlnLysProGly

GluSerArgMetAspLeuLeuGlnArgAsnThrAlaValPheLysSerIleValGluProValVal

AlaSerGlyPheSerGlyValPheLeuValAlaThrAsnProValAspIleMetSerTyrValThr

TyrArgLeuSerGlyPheAlaLysGlyArgIleValGlyThrGlyThrThrLeuAspThrAlaArg

LeuArgTyrLeuLeuGlyAspTyrPheLysValAspProArgAsnValHisAlaTyrValMetGly

GluHisGlyAspSerGluPheValProTrpSerGlnAlaLeuIleAlaThrArgProValMetGly

LeuCysValGluAsnHisGlyProAspTyrLysAlaGlyMetLeuHisIleGlyGluGluValArg

ThrAlaAlaTyrArgIleIleGluAlaLysLysAlaThrTyrTyrGlyIleGlyMetAlaMetVal

ArgValAlaArgAlaIleLeuGlyGlyGluAsnSerValLeuThrValSerSerLeuLeuAspAsp

AspTyrGlyThrProLysValTyrAlaGlyValProSerIleValSerArgArgGlyValSerArg

IleIleArgLeuSerLeuThrProGluGluAsnGlnLeuMetGlnAspSerCysAlaLysLeuGlu

GlnAlaValSerGlyLeuThrPhe。

3, the primer that designs in a kind of L-lactate dehydrogenase gene preparation process is characterized in that the gene order of primer is:

P ₁Pcr amplification degenerated primer gene LDHJ1-forward:5 '-GCNRANGGNGARGCNHTGGA-3 ';

P ₂Pcr amplification degenerated primer gene LDHJ1-reverse:5 '-RBANACRTCNTTDATNCCRTA-3 ';

P ₃Upstream primer LDH-S11-lowe:5 '-CACATACAGGTTGTCCGGCTTTGC-3 ' with Cassette primer C1 primer coupling;

P ₄Upstream primer LDH-S12-lowe:5 '-GCGACTATTTCAAGGTGGACCCGCGCAACGTG-3 ' with Cassette primer C1 primer coupling:

P ₅Downstream primer LDH-S21-upper:5 '-TTGCAAAGCCGGACAACCTGTATGTGACGTAG-3 ' with Cassette primer C2 primer coupling;

P ₆Downstream primer LDH-S22-upper:5 '-CCCGCGTAGATTTTCATGTTGGTGC-3 ' with Cassette primer C2 primer coupling;

P ₇Total length checking primer LDH-upper:5 '-GGATAATCTCCCCTGCCCGTGCGGATACTA-3 ';

P ₈Total length checking primer LDH-lower:5 '-CATCAACACCTCACAGACAAAGATCGGCCATT-3 ';

P ₉Genetic expression primer LDH-22b-forward:5 '-AAAAGGAGCGATCCATATGTGCACCGACAACCGC-3 ';

P ₁₀Genetic expression primer LDH-22b-reverse:5 '-GTTAATCTAGAAAATGTCAACCCGGAGACGGCCTGCTCCAG-3 '.

Images