CN1757739A

CN1757739A - Method of expressing heparinase and its special expression carrier

Info

Publication number: CN1757739A
Application number: CN 200510090872
Authority: CN
Inventors: 邢新会; 陈银; 况莹; 叶逢春; 罗明芳
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2005-08-18
Filing date: 2005-08-18
Publication date: 2006-04-12
Anticipated expiration: 2025-08-18
Also published as: CN100355893C

Abstract

A method for expressing heparinase and its dedicated expression carrier are disclosed. Said heparinase expression carrier is a proerythroblast expression carrier for the coding gene of the fusion protein composed of heparinase and green fluorescin, and can be used for soluble expression and be correctly folded to prevent the generation of inclusion body. It can also be used to fast and quantitatively test the bacterial density and heparinase activity. Said method can realize the efficient soluble expression of said fusion protein (GFP-hepA).

Description

A kind of method and dedicated expression vector therefor thereof of expressing heparinase

Technical field

The present invention relates to a kind of method and dedicated expression vector therefor thereof of expressing heparinase.

Background technology

Heparinase (heparinase) is the polysaceharide lyase that a class acts on heparin, in many kinds of microorganisms, find, comprise excellent bacillus Corynebacterium sp. (high Ningguo etc., heparinase produces screening and the fermentation condition of bacterium, microorganism journal 1999 Vol.39:64-67), Sphingobacterium sp. Sphingobacterium sp. (high Ningguo etc., the generation of Sphingobacterium sp. heparinase, microorganism journal 2003 Vol.43:813-816), Bacillus subtillis Bacillus subtilis (Wang Zhongyan etc., heparinase produces the screening of bacterium and the research of thick enzymatic property thereof, Sichuan University's journal (natural science edition) 2002 Vol.39:777-779), Bacillus circulans Bacillus circulans (Yasutaka Tahara et al., Purification andcharacterization of heparinase that degrades both heparin and heparinsulfate from Bacillus circulans BioSci.Biotechnol.Biochem.2002Vol.66:1181-1184), Bacteroides heparinolyticus Prevotella heparinolytica (KazuyukiSugahara et al., Characterization of heparinase from an oral bacteriumPrevotella heparinolytica J.Biochem.1998 Vol.123:283-288), Bacteroides stercoris Bacteroides stercoris HJ-15 (Dong Hyuu Kim et al., Purification andcharacterization of a novel heparinase from Bacteroides stercoris HJ-15J.Biochem.2000 Vol.128:323-328) and heparin Flavobacterium Flavabacterium heparinum (Sasiekharan, R.1991 Ph.D.Thesis, Havard University).But the heparinase from the heparin Flavobacterium is business-like unique source.Heparinase from the heparin Flavobacterium mainly contains three kinds, difference called after Heparinase I (EC 4.2.2.7), II (NO EC code) and III (EC 4.2.2.8) (RobertJ.Linhardt et al., Purification and characterization of heparin lyasesfrom Flavobacterium heparinum JBC 1992 Vol.267:24347-24355).

Wherein the Heparinase I of heparin Flavobacterium (hepA) is one of heparinase of studying so far fullest, and the existing report of the application in the removal of its heparin in the production of Low molecular heparin and extracorporeal circulation of blood has the huge market development and is worth.Because the expression amount of heparin Flavobacterium product Heparinase I is low and purification process is loaded down with trivial details and expense is higher, thereby reorganization bacterium production Heparinase I receives great concern.

In the production technology optimization of Heparinase I, the rapid detection that the Heparinase I enzyme is lived is very important for the optimization of process.At present, the detection method that the Heparinase I enzyme is lived mainly contains two kinds, be respectively reddish black A method (Victor CY, Robert J L, et al.Purification and characterization of heparinase fromFlavobacterium heparinum.J.Biol.Chem.1985,260:1849-1857) and optical absorption method (the Ram S of 232nm, Bulmer M, et al.Cloning and expression of heparinase Igene from Flavobacterium heparinum.Proc.Natl.Acad.Sci.USA.1993,90:3660-3664).The measuring method of reddish black A is fit to crude enzyme liquid in these two kinds of methods, and is subjected to the influence of the polysaceharide lyase of other heparin of can degrading, and makes measuring result bigger than normal.And the 232nm optical absorption method is suitable for the measurement of the enzyme liquid of purifying.Because the kind of the unsaturated uronic acid that produces is many, ε=3800M ^-1Be mean value, so the measurement that enzyme is lived is very inaccurate yet.Detect enzymes from above-described two kinds and live the problems that exist as can be seen, in order to research and develop Heparinase I production technique efficiently, foundation can be quick and precisely quantitatively enzyme live efficiently express system and method is significant.

GFP, since (Chalfie M such as Chalfie in 1994, Tu Y, Euskirchen G, Ward WW, Prasher DC Green fluorescent protein as a marker for gene expression.Science 1994,263:802-805) in Bacillus coli cells, express first after, because this fluorescin is stable, pair cell nontoxicity, fluoroscopic examination are simple, and produce fluorescence and do not need characteristics such as substrate, become one of most widely used reporter protein in the research and development of physiology and biotechnology.But GFP mainly lays particular emphasis on various qualitative parsings at biology and Application in Biotechnology so far, and the Quantitative Monitoring and the process optimization that are applied to protein biological production process are new fields.(Poppenborg L such as Poppenborg, Friehs K, Flaschel E The green fluorescent protein is aversatile reporter for bioprocess monitoring.J.Biotechnol.1997 58:79-88) has proved first GFP has been fused to the fast monitored that can realize on the affine target thing such as processes such as cultivation, chromatographic separation.Therefore, GFP is the instrument with very big potentiality that is used for quantitative fast monitored cell cultures, optimizing fermentation and follows the trail of immobilized enzyme use characteristic.

Summary of the invention

The purpose of this invention is to provide a kind of heparanase expression carrier.

Heparanase expression carrier provided by the present invention is the procaryotic cell expression carrier that is inserted with the encoding gene of the fusion rotein that is made of heparinase and green fluorescent protein in multiple clone site.

The described procaryotic cell expression carrier that is inserted with the encoding gene of the fusion rotein that is made of heparinase and green fluorescent protein in multiple clone site can be at the expression in escherichia coli foreign gene.

Described intestinal bacteria can be bacillus coli DH 5 alpha, e. coli bl21 (DE3), e. coli jm109 or intestinal bacteria TB1 etc.

The described fusion rotein that is made of heparinase and green fluorescent protein is the gfp fragment that closely is connected with the 1-238 amino acids residue sequence that has sequence 1 in the sequence table at least at the aminoterminal of the amino acid residue sequence of heparinase or carboxyl terminal.

Described heparinase is a Heparinase I, and its amino acid residue sequence is numbered A47479 in the retrieval of GenBank.

The described fusion rotein that is made of heparinase and green fluorescent protein is the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

2) with SEQ ID № in the sequence table: 2 amino acid residue sequence is through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have green fluorescent protein and the protein of heparanase activity.

Sequence 2 in the sequence table is made up of 626 amino-acid residues, is green fluorescent protein from the 1st of aminoterminal to the 238th amino acids residue, is Heparinase I from the 264th of aminoterminal to the 626th amino acids residue.

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation are meant replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.

The encoding gene of the described fusion rotein that is made of heparinase and green fluorescent protein can have one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 dna sequence dna;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 2 protein sequences;

3) under the rigorous condition of height can with SEQ ID № in the sequence table: the nucleotide sequence of the 3 dna sequence dnas hybridization that limit;

4) with sequence table in SEQ ID №: 3 dna sequence dnas that limit have 90% above homology, and the identical function protein DNA sequence of encoding.

The rigorous condition of described height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.

Sequence 3 in the sequence table is by 1881 based compositions, and its encoding sequence is from the 1st to 1881 deoxynucleotide of 5 ' end.

Described heparanase expression carrier is preferably pGFP-hepA, and pGFP-hepA is that the encoding gene of the fusion rotein that will be made of heparinase and green fluorescent protein inserts the recombinant expression vector that obtains between NdeI in the multiple clone site of pMAL-c2x and HindIII recognition site.

Second purpose of the present invention provides a kind of method of expressing heparinase.

The method of expression heparinase provided by the present invention is that above-mentioned heparanase expression carrier is imported in the intestinal bacteria, and the bacterial strain that screening is obtained expressing heparinase is cultivated described engineering bacteria, the abduction delivering heparinase as engineering bacteria.

In this method, described intestinal bacteria are bacillus coli DH 5 alpha, e. coli bl21 (DE3), e. coli jm109 or intestinal bacteria TB1; Described heparanase expression carrier is preferably pGFP-hepA; Described abduction delivering condition in the substratum that contains 0.3-1mM IPTG 5-25 ℃ inducing culture 5-15 hour.

The present invention utilizes genetic engineering technique successfully to make up the efficient soluble-expression plasmid pGFP-hepA of GFP-Heparinase I fusion rotein, and the recombination bacillus coli that contains this plasmid can give expression to the GFP and the Heparinase I fusion rotein of solubility.Set up the method for utilizing GFP rapid detection e. coli concentration and Heparinase I enzyme to live by the mensuration that fluorescence intensity, cell concn and enzyme are lived, for the large-scale production optimization of Heparinase I provides new means.

The invention provides a kind of can folding with correct by soluble-expression, prevent that inclusion body from forming, and can fast quantification cell concentration and heparinase enzyme fusion expression vector (pGFP-hepA) alive.The method that the present invention expresses heparinase has realized the fusion rotein (GFP-hepA) that efficient soluble-expression is made of heparinase and green fluorescent protein, the expression amount of Heparinase I is up to the 350IU/L substratum, this expression method also can utilize fluorescence measurement that engineering bacteria concentration and the work of Heparinase I enzyme are carried out the fast quantification tracking, help the optimization and the control of Heparinase I production process, help the preservation of heparinase and the quick evaluation of application process, help resolving the structure and the mechanism of degradation of macromole heparin.Heparanase expression carrier of the present invention and expression method have wide prospect in industrial application and actual application value.

Description of drawings

Fig. 1 is the building process synoptic diagram of expression vector pMal-hepA

Fig. 2 is the Heparinase I gene electrophoretogram that pcr amplification obtains from the heparin Flavobacterium

Fig. 3 is the building process synoptic diagram of expression vector pGFP-hepA

Fig. 4 is the GFP-hepA fluorescent microscope photo of BL21 (DE3)/pGFP-hepA abduction delivering

Fig. 5 is the protein electrophorese collection of illustrative plates of BL21 (DE3)/pGFP-hepA different condition abduction delivering

Fig. 6 lives and OD for the fluorescence intensity of supernatant liquor after the cytoclasis, total enzyme ₆₀₀Curve over time

Fig. 7 is relative intensity of fluorescence and OD ₆₀₀Relation

Fig. 8 is the relation that relative intensity of fluorescence and Heparinase I enzyme are lived

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

The structure of embodiment 1, expression vector pGFP-hepA

1, the structure that contains the expression vector pMal-hepA of Heparinase I encoding gene

The building process of expression vector pMal-hepA as shown in Figure 1, detailed process is as follows: amplification Heparinase I gene from the genome DNA of heparin Flavobacterium Flavabacterium heparinum (buy from IAM), used upstream and downstream primer is respectively 5 ' GCCT GGATCCCAGCAAAAAAAATCCGGTAAC 3 ' (base of band underscore is the restriction enzyme site of BamHI), 5 ' GCTT CTGCAGTCTGGCAGTTTCGCTGTAC 3 ' (base of band underscore is the PstI restriction enzyme site), introduce BamHI and PstI restriction enzyme site respectively, 50 μ L amplification reaction systems are: the 50ng template DNA, every kind of primer of 100pmol, 1 * amplification buffer (sky, Beijing is a Bioisystech Co., Ltd), every kind of dNTP of 200 μ mol/L, the high Pfu enzyme of protecting of 1 unit; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 50-60 degree centigrade of primer annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 5 minutes.This PCR result shows that amplification obtains the Heparinase I gene fragment of 1.1kb as shown in Figure 2.Among Fig. 2, it is 50,51,53,55,58 or 59 ℃ of amplifications that 1-6 is respectively the primer annealing temperature, and 7 is molecular weight marker 15kb, and arrow indication place is a 1.1kb target segment.

With pMal-p2x and pMal-c2x carrier (available from NEB company)) and the PCR product use BamHI and PstI double digestion respectively, use T ₄Dna ligase connects, transform JM109, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC 3 ' and 5 ' GCTTCTGCAGTCTGGCAGTTTCGCTGTAC 3 ' is primer, by bacterium colony PCR screening transformant, extraction can obtain plasmid in the transformant of 1.1kb PCR product by BamHI and the checking of PstI double digestion.To obtain the segmental plasmid of 1.1kb by BamHI and PstI double digestion and check order, will contain the plasmid called after pMal-hepA of nucleotide sequence with sequence 4 in the sequence table.

2, the structure of the expression vector pGFP-hepA of the encoding gene of the fusion rotein that constitutes by heparinase and green fluorescent protein

The building process of expression vector pGFP-hepA as shown in Figure 3, concrete grammar is as follows:

With plasmid pSG1729 (Bacillus Genetic Stock Center) is template, uses P _Up: 5 ' AAAGGAGATTCGA CATATGGGTACCCTGCATATGAGTAAAGGA (NdeI) 3 ' (line part base is the recognition site of NdeI) and Pdo:5 ' CATCG GAGCTCGAGGTACCTTTGTATAGTTCATCCATGCCATGTG (SacI) 3 ' (line part base is the recognition site of SacI) is primer PCR amplification GFP gene (gfp), and be inserted between the enzyme recognition site NdeI and SacI of pMAL-c2x (available from NEB company), make up and obtained recombinant vectors pGFP-c2x.Utilize EcoRI and HindIII enzyme to cut pMal-hepA then, reclaim the hepA fragment of about 1100bp, and cut the big fragment of carrier that pGFP-c2x obtains through EcoRI and HindIII enzyme and be connected, will connect product transformed into escherichia coli DH5 α, blue hickie screening positive clone.Recombinant plasmid is cut through enzyme and is identified and confirm (worker is given birth in Shanghai) by sequencing, will contain the recombinant vectors called after pGFP-hepA of the encoding gene of the fusion rotein that is made of heparinase and green fluorescent protein with sequence 3 in the sequence table.

Embodiment 2, expression Heparinase I

1, abduction delivering

Extract the plasmid in the bacillus coli DH 5 alpha that contains pGFP-hepA among the embodiment 1,, screen and utilize primer P through penbritin according to ordinary method transformed into escherichia coli BL21 (DE3) _UpAnd P _DoCarry out bacterium colony PCR and identify, obtain containing the e. coli bl21 (DE3) of pGFP-hepA, promptly BL21 (DE3)/pGFP-hepA is as the engineering bacteria of expressing GFP-hepA.

BL21 (DE3)/pGFP-hepA was cultivated 2 hours for 37 ℃ at LB substratum (containing 100 μ g/ml penbritins), add 1mM IPTG and carry out inducing culture at 32 ℃, 20 ℃ and 15 ℃ respectively.Engineering bacteria BL21 (DE3)/pGFP-hepA inducing culture 8 hours, thalline is expressed the GFP-hepA fusion rotein, as shown in Figure 4.Get respectively and induce bacterium liquid 40ml behind the 12h, the centrifugal 10min of 10000rpm, with 20mmol/L Tris-HCl (pH 7.4) washed twice, be resuspended in and carry out ultrasonication among the 4ml 20mmol/L Tris-HCl (pH 7.4) (output rating is 300W, each ultrasonic 3 seconds and intermittently 3 seconds processing 99 times), get supernatant liquor 50 μ l and cytoclasis precipitation respectively and do full cell SDS-PAGE electrophoresis.The result shows that different inducing temperatures to the active obvious effect of GFP-hepA, induce at 32 ℃ as shown in Figure 5, and GFP-hepA exists more with the form of non-activity inclusion body, and 15 ℃ induced, and the amount of soluble g FP-hepA then obviously increases.Among Fig. 5, arrow shows GFP-hepA band, 70kDa; It is 32 ℃ of cytoclasis postprecipitations under the inducing temperature that 32 degree are induced insoluble; It is supernatant liquor after 32 ℃ of cytoclasises under the inducing temperature that 32 degree are induced solvable; It is 20 ℃ of cytoclasis postprecipitations under the inducing temperature that 20 degree are induced insoluble; It is supernatant liquor after 20 ℃ of cytoclasises under the inducing temperature that 20 degree are induced solvable; It is 15 ℃ of cytoclasis postprecipitations under the inducing temperature that 15 degree are induced insoluble; It is supernatant liquor after 15 ℃ of cytoclasises under the inducing temperature that 15 degree are induced solvable.

2, enzyme biopsy cls analysis

Measuring the enzyme of Heparinase I in accordance with the following methods lives: with cell centrifugation separate, with after Tris-HCl (pH7.0) washed twice, be resuspended among the 5ml Tris-HCl (pH7.0), carry out cytoclasis with the ultrasound condition of step 1.With broken liquid centrifugal after, the heparinase of surveying in the supernatant liquor is lived.The 232nm optical absorption method is adopted in the analysis that enzyme is lived, and the enzyme of an international unit (1IU) is lived and is defined as 30 ℃, and under pH 7.4 conditions, per minute produces the required protein content of 1 μ mol, 4,5 unsaturated uronic acids.

The result shows that BL21 (DE3)/pGFP-hepA cultivated 2 hours for 37 ℃ at LB substratum (containing 100 μ g/ml Amp), add 1mM IPTG and be respectively 0.0425IU, 0.105IU, 0.175IU 32 ℃, 20 ℃ and the 15 ℃ enzyme work of carrying out 12 hours cytoclasis supernatant liquor Heparinase I of inducing culture respectively, the expression amount of the Heparinase I that conversion obtains is respectively 85IU/L, 210IU/L, 350IU/L substratum.

Embodiment 3, fluorescent quantitation follow the trail of cell concentration and enzyme is lived

With the LB that contains 100 μ g/ml penbritins (NaCl 10g/L, tryptone 10g/L, yeast extract 5g/L, pH7.0) substratum is cultivated BL21 (DE3)/pGFP-hepA, 37 ℃ of cultivations about two hours (to OD ₆₀₀Be 0.25) after, add 0.3mM IPTG, and change culture temperature into 15 ℃ and carry out inducing culture.Every 1 hour, get 1ml bacterium liquid and survey its cell concn (OD respectively ₆₀₀), the enzyme of Heparinase I lives and fluorescence intensity (spectrophotofluorometer HITACHI F-2500), measure to inducing culture 14 hours always.

Measure the enzyme of Heparinase I according to the method for step 2 among the embodiment 2 and live, the result shows the prolongation of the enzyme work of Heparinase I along with induction time, and expression amount increases gradually.The mensuration of fluorescence intensity be according to the method for step 2 among the embodiment 2 with the cell centrifugation in this 1ml bacterium liquid separate, with after Tris damping fluid (pH7.0) washed twice, be resuspended in the 5ml Tris damping fluid (pH7.0), carry out cytoclasis with the ultrasound condition of step 1 among the embodiment 2.With broken liquid centrifugal after, survey the fluorescence intensity in the supernatant liquor, with inducing 0 hour fluorescence intensity to be decided to be 0, draw the relative intensity of fluorescence of other induction time.Cell concn (the OD of culturing process ₆₀₀), the enzyme of Heparinase I is lived (IU/L substratum) and the variation of fluorescence intensity (RFU) as shown in Figure 6.Presentation of results, GFP albumen can improve the solubility of Heparinase I in intestinal bacteria, and along with the increase of induction time, fluorescence volume increases, but, need dilution or smudge cells with accurate measurement fluorescence volume (as Fig. 7, shown in Figure 8) owing to there is the scattering of cell.

Realize the quick online detection that cell concentration and enzyme are lived for further research and utilization GFP albumen, studied OD ₆₀₀Relation with fluorescence intensity and enzyme work and fluorescence intensity.14 hours OD of above-mentioned 15 ℃ of inducing culture ₆₀₀With the relation of fluorescence intensity as shown in Figure 7, show between bacterial concentration and the fluorescence to have good linear relationship, at lower OD ₆₀₀In the scope, dilution or the result that do not dilute match influence not quite, but dependency and slope after the dilution obviously increase, and influence under high cell concentration condition the necessary consideration of cell to fluorescence scattering be described.Experimental result shows the fast quantification that can utilize fluorescence intensity to realize bacterial concentration in the culturing process.

Studied the relation between the work of fluorescence volume and enzyme simultaneously, the enzyme work of 14 hours Heparinase I of above-mentioned 15 ℃ of inducing culture and the relation of fluorescence intensity show that also there are good linear relationship in fluorescence volume and enzyme between living as shown in Figure 8.

The variation that The above results explanation can be lived with the enzyme of quick acquisition cell concentration and Heparinase I by fluorescence intensity in the fermentation culture process, thus realize the culturing process optimization and the control of High-efficient Production Heparinase I.

Sequence table

<160>4

<210>1

<211>238

<212>PRT

＜213〉artificial sequence

<400>1

Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val

1 5 10 15

Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Val

20 25 30

Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser

35 40 45

Val Ser Gly Glu Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu

50 55 60

Thr Tyr Gly Val Gln Cys Phe Ser Leu Pro Val Pro Trp Pro Thr Leu

65 70 75 80

Val Thr Thr Phe Ala Tyr Gly Leu Gln Cys Phe Glu Leu Pro Val Pro

85 90 95

Trp Pro Thr Leu Val Thr Thr Phe Ala Tyr Gly Leu Gln Cys Phe Glu

100 105 110

Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe Ala Tyr Gly Leu

115 120 125

Gln Cys Phe Glu Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe

130 135 140

Ala Tyr Gly Leu Gln Cys Phe Val Met Ala Asp Lys Pro Lys Asn Gly

145 150 155 160

Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Ile Met Ala Asp Lys

165 170 175

Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Ile

180 185 190

Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg

195 200 205

His Asn Ile Asn Glu Lys Arg Asp His Met Ile Leu Leu Glu Phe Val

210 215 220

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys

225 230 235

<210>2

<211>626

<212>PRT

＜213〉artificial sequence

<220>

<223>

<400>2

Met Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val

1 5 10 15

Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser Val Ser Gly Val

20 25 30

Pro Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly Gln Lys Phe Ser

35 40 45

Val Ser Gly Glu Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu

50 55 60

Thr Tyr Gly Val Gln Cys Phe Ser Leu Pro Val Pro Trp Pro Thr Leu

65 70 75 80

Val Thr Thr Phe Ala Tyr Gly Leu Gln Cys Phe Glu Leu Pro Val Pro

85 90 95

Trp Pro Thr Leu Val Thr Thr Phe Ala Tyr Gly Leu Gln Cys Phe Glu

100 105 110

Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe Ala Tyr Gly Leu

115 120 125

Gln Cys Phe Glu Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Phe

130 135 140

Ala Tyr Gly Leu Gln Cys Phe Val Met Ala Asp Lys Pro Lys Asn Gly

145 150 155 160

Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Ile Met Ala Asp Lys

165 170 175

Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Ile

180 185 190

Met Ala Asp Lys Pro Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg

195 200 205

His Asn Ile Asn Glu Lys Arg Asp His Met Ile Leu Leu Glu Phe Val

210 215 220

Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys Gly Thr

225 230 235 240

Ser Ser Ser Asn Asn Asn Asn Asn Asn Asn Asn Asn Asn Leu Gly Ile

245 250 255

Glu Gly Arg Ile Ser Glu Phe Gln Gln Lys Lys Ser Gly Asn Ile Pro

260 265 270

Tyr Arg Val Asn Val Gln Ala Asp Ser Ala Lys Gln Lys Ala Ile Ile

275 280 285

Asp Asn Lys Trp Val Ala Val Gly Ile Asn Lys Pro Tyr Ala Leu Gln

290 295 300

Tyr Asp Asp Lys Leu Arg Phe Asn Gly Lys Pro Ser Tyr Arg Phe Glu

305 310 315 320

Leu Lys Ala Glu Asp Asn Ser Leu Glu Gly Tyr Ala Ala Gly Glu Thr

325 330 335

Lys Gly Arg Thr Glu Leu Ser Tyr Ser Tyr Ala Thr Thr Asn Asp Phe

340 345 350

Lys Lys Phe Pro Pro Ser Val Tyr Gln Asn Ala Gln Lys Leu Lys Thr

355 360 365

Val Tyr His Tyr Gly Lys Gly Ile Cys Glu Gln Gly Ser Ser Arg Ser

370 375 380

Tyr Thr Phe Ser Val Tyr Ile Pro Ser Ser Phe Pro Asp Asn Ala Thr

385 390 395 400

Thr Ile Phe Ala Gln Trp His Gly Ala Pro Ser Arg Thr Leu Val Ala

405 4l0 4l5

Thr Pro Glu Gly Glu Ile Lys Thr Leu Ser Ile Glu Glu Phe Leu Ala

420 425 430

Leu Tyr Asp Arg Met Ile Phe Lys Lys Asn Ile Ala His Asp Lys Val

435 440 445

Glu Lys Lys Asp Lys Asp Gly Lys Ile Thr Tyr Val Ala Gly Lys Pro

450 455 460

Asn Gly Trp Lys Val Glu Gln Gly Gly Tyr Pro Thr Leu Ala Phe Gly

465 470 475 480

Phe Ser Lys Gly Tyr Phe Tyr Ile Lys Ala Asn Ser Asp Arg Gln Trp

485 490 495

Leu Thr Asp Lys Ala Asp Arg Asn Asn Ala Asn Pro Glu Asn Ser Glu

500 505 510

Val Met Lys Pro Tyr Ser Ser Glu Tyr Lys Thr Ser Thr Ile Ala Tyr

5l5 520 525

Lys Met Pro Phe Ala Gln Phe Pro Lys Asp Cys Trp Ile Thr Phe Asp

530 535 540

Val Ala Ile Asp Trp Thr Lys Tyr Gly Lys Glu Ala Asn Thr Ile Leu

545 550 555 560

Lys Pro Gly Lys Leu Asp Val Met Met Thr Tyr Thr Lys Asn Lys Lys

565 570 575

Pro Gln Lys Ala His Ile Val Asn Gln Gln Glu Ile Leu Ile Gly Arg

580 585 590

Asn Asp Asp Asp Gly Tyr Tyr Phe Lys Phe Gly Ile Tyr Arg Val Gly

595 600 605

Asn Ser Thr Val Pro Val Thr Tyr Asn Leu Ser Gly Tyr Ser Glu Thr

610 615 620

Ala Arg

625

<210>3

<211>1881

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>3

atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggc 60

gatgttaatg ggcaaaaatt ctctgtcagt ggagtcccaa ttcttgttga attagatggc 120

gatgttaatg ggcaaaaatt ctctgtcagt ggagagctac ctgttccatg gccaacactt 180

gtcactactc tgacttatgg tgttcaatgc ttttcactac ctgttccatg gccaacactt 240

gtcactactt tcgcgtatgg tcttcaatgc tttgagctac ctgttccatg gccaacactt 300

gtcactactt tcgcgtatgg tcttcaatgc tttgagctac ctgttccatg gccaacactt 360

gtcactactt tcgcgtatgg tcttcaatgc tttgagctac ctgttccatg gccaacactt 420

gtcactactt tcgcgtatgg tcttcaatgc tttgtcatgg cagacaaacc aaagaatgga 480

atcaaagtta acttcaaaat tagacacaac attatcatgg cagacaaacc aaagaatgga 540

atcaaagtta acttcaaaat tagacacaac attatcatgg cagacaaacc aaagaatgga 600

atcaaagtta acttcaaaat tagacacaac attaacgaaa agagagatca catgatcctt 660

cttgagtttg taacagctgc tgggattaca catggcatgg atgaactata caaaggtacc 720

tcgagctcga acaacaacaa caataacaat aacaacaacc tcgggatcga gggaaggatt 780

tcagaattcc agcaaaaaaa atccggtaac atcccttacc gggtaaatgt gcaggccgac 840

agtgctaagc agaaggcgat tattgacaac aaatgggtgg cagtaggcat caataaacct 900

tatgcattac aatatgacga taaactgcgc tttaatggaa aaccatccta tcgctttgag 960

cttaaagccg aagacaattc gcttgaaggt tatgctgcag gagaaacaaa gggccgtaca 1020

gaattgtcgt acagctatgc aaccaccaat gattttaaga aatttccccc aagcgtatac 1080

caaaatgcgc aaaagctaaa aaccgtttat cattacggca aagggatttg tgaacagggg 1140

agctcccgca gctatacctt ttcagtgtac ataccctcct ccttccccga caatgcgact 1200

actatttttg cccaatggca tggtgcaccc agcagaacgc ttgtagctac accagaggga 1260

gaaattaaaa cactgagcat agaagagttt ttggccttat acgaccgcat gatcttcaaa 1320

aaaaatatcg cccatgataa agttgaaaaa aaagataagg acggaaaaat tacttatgta 1380

gccggaaagc caaatggctg gaaggtagaa caaggtggtt atcccacgct ggcctttggt 1440

ttttctaaag ggtattttta catcaaggca aactccgacc ggcagtggct taccgacaaa 1500

gccgaccgta acaatgccaa tcccgagaat agtgaagtaa tgaagcccta ttcctcggaa 1560

tacaaaactt caaccattgc ctataaaatg ccctttgccc agttccctaa agattgctgg 1620

attacttttg atgtcgccat agactggacg aaatatggaa aagaggccaa tacaattttg 1680

aaacccggta agctggatgt gatgatgact tataccaaga ataagaaacc acaaaaagcg 1740

catatcgtaa accagcagga aatcctgatc ggacgtaacg atgacgatgg ctattacttc 1800

aaatttggaa tttacagggt cggtaacagc acggtcccgg ttacttataa cctgagcggg 1860

tacagcgaaa ctgccagata g 1881

<210>4

<211>2271

<212>DNA

＜213〉artificial sequence

<220>

<223>

<400>4

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcagaa ttcggatccc agcaaaaaaa atccggtaac 1200

atcccttacc gggtaaatgt gcaggccgac agtgctaagc agaaggcgat tattgacaac 1260

aaatgggtgg cagtaggcat caataaacct tatgcattac aatatgacga taaactgcgc 1320

tttaatggaa aaccatccta tcgctttgag cttaaagccg aagacaattc gcttgaaggt 1380

tatgctgcag gagaaacaaa gggccgtaca gaattgtcgt acagctatgc aaccaccaat 1440

gattttaaga aatttccccc aagcgtatac caaaatgcgc aaaagctaaa aaccgtttat 1500

cattacggca aagggatttg tgaacagggg agctcccgca gctatacctt ttcagtgtac 1560

ataccctcct ccttccccga caatgcgact actatttttg cccaatggca tggtgcaccc 1620

agcagaacgc ttgtagctac accagaggga gaaattaaaa cactgagcat agaagagttt 1680

ttggccttat acgaccgcat gatcttcaaa aaaaatatcg cccatgataa agttgaaaaa 1740

aaagataagg acggaaaaat tacttatgta gccggaaagc caaatggctg gaaggtagaa 1800

caaggtggtt atcccacgct ggcctttggt ttttctaaag ggtattttta catcaaggca 1860

aactccgacc ggcagtggct taccgacaaa gccgaccgta acaatgccaa tcccgagaat 1920

agtgaagtaa tgaagcccta ttcctcggaa tacaaaactt caaccattgc ctataaaatg 1980

ccctttgccc agttccctaa agattgctgg attacttttg atgtcgccat agactggacg 2040

aaatatggaa aagaggccaa tacaattttg aaacccggta agctggatgt gatgatgact 2100

tataccaaga ataagaaacc acaaaaagcg catatcgtaa accagcagga aatcctgatc 2160

ggacgtaacg atgacgatgg ctattacttc aaatttggaa tttacagggt cggtaacagc 2220

acggtcccgg ttacttataa cctgagcggg tacagcgaaa ctgccagatg a 2271

Claims

1, heparanase expression carrier is the procaryotic cell expression carrier that is inserted with the encoding gene of the fusion rotein that is made of heparinase and green fluorescent protein in multiple clone site.

2, heparanase expression carrier according to claim 1 is characterized in that: the described procaryotic cell expression carrier that is inserted with the encoding gene of the fusion rotein that is made of heparinase and green fluorescent protein in multiple clone site can be at the expression in escherichia coli foreign gene.

3, heparanase expression carrier according to claim 1 is characterized in that: described intestinal bacteria are bacillus coli DH 5 alpha, e. coli bl21 (DE3), e. coli jm109 or intestinal bacteria TB1.

4, according to claim 1,2 or 3 described heparanase expression carriers, it is characterized in that: the described fusion rotein that is made of heparinase and green fluorescent protein is the gfp fragment that closely is connected with the 1-238 amino acids residue sequence that has sequence 1 in the sequence table at least at the aminoterminal of the amino acid residue sequence of heparinase or carboxyl terminal.

5, heparanase expression carrier according to claim 4 is characterized in that: described heparinase is a Heparinase I, and its amino acid residue sequence is numbered A47479 in the retrieval of GenBank.

6, heparanase expression carrier according to claim 5 is characterized in that: the described fusion rotein that is made of heparinase and green fluorescent protein is the protein with one of following amino acid residue sequences:

1) the SEQ ID № in the sequence table: 2;

7, heparanase expression carrier according to claim 6 is characterized in that: the encoding gene of the described fusion rotein that is made of heparinase and green fluorescent protein has one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 dna sequence dna;

4) with SEQ ID №: 3 dna sequence dnas that limit have 90% above homology, and coding identical function protein DNA sequence.

8, heparanase expression carrier according to claim 7 is characterized in that: described heparanase expression carrier is pGFP-hepA; Described pGFP-hepA is that the encoding gene of the fusion rotein that will be made of heparinase and green fluorescent protein inserts the recombinant expression vector that obtains between NdeI in the multiple clone site of pMAL-c2x and HindIII recognition site.

9, a kind of method of expressing heparinase is that arbitrary described heparanase expression carrier in the claim 2 to 8 is imported in the intestinal bacteria, and the bacterial strain that screening is obtained expressing heparinase is cultivated described engineering bacteria, the abduction delivering heparinase as engineering bacteria.

10, method according to claim 9 is characterized in that: described intestinal bacteria are bacillus coli DH 5 alpha, e. coli bl21 (DE3), e. coli jm109 or intestinal bacteria TB1; Described heparanase expression carrier is pGFP-hepA; Described abduction delivering condition in the substratum that contains 0.3-1mM IPTG 10-30 ℃ inducing culture 5-15 hour.