CN1831142A - Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus - Google Patents
Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus Download PDFInfo
- Publication number
- CN1831142A CN1831142A CNA2005101208953A CN200510120895A CN1831142A CN 1831142 A CN1831142 A CN 1831142A CN A2005101208953 A CNA2005101208953 A CN A2005101208953A CN 200510120895 A CN200510120895 A CN 200510120895A CN 1831142 A CN1831142 A CN 1831142A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- probe
- group
- probe sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR expanding primer and probe sequence of 01 group vibrio cholerae nucleotide section. The primer sequence includes headwaters primer F605 and the sequence is CACGCCATTGAAGGTTATGTCTC, and down stream primer R703 and the sequence is the primer pair of AAATTGATGTCGATAGCGGTAGATTA, and 10 basic group expanding towards 5'end direction, 10 basic group expanding towards 3'end direction from headwaters primer, and 10 basic group expanding towards 3'end direction, and 10 basic group area range primer sequence toward 5'end expanding direction. The probe sequence includes: 6 basic groups toward 3'end direction of CCGCCTGCTCAGCAAAAGTATTCATCA of Pb645, and probe sequence gained toward 5'directon expanding 10 basic group area ranges.
Description
Technical field
The present invention relates to a kind of primer and probe sequence that is used to detect O1 group cholera vibrio nucleotide fragments.
Background technology
Vibrio cholerae is a common pathogenic bacteria in food, is to cause poisoning by food and the The main pathogenic fungi of food origin disease.Cholera is the acute infectious disease that is caused by vibrio cholerae (Vibrio cholerae), and it falls ill anxious, propagates soon, involves widely, and harm is serious.It is defined as one of transmissible disease that must international quarantine by the World Health Organization, China classifies it as should implement " mandatory administration " category A infectious disease in the law on the prevention and control of infectious diseases center, also is to plant in international quarantine transmissible disease the most serious a kind of when first three.Cholera is the infectious intestinal disease of peroral infection, Chang Jingshui, food, life contact and fly etc. and propagate.Water-borne transmission is topmost route of transmission, and is all previous more popular or break out how contaminated relevant with water body.The characteristics of water-borne transmission are often to present to break out, and patient is many to distribute along contaminated water body.Severe cholera patient's main clinical manifestation is violent diarrhoea, vomiting, dehydration, circulatory failure and metabolic acidosis etc.As rescue untimely or improper, can be dead in many hours a few hours to ten in morbidity back.Under natural situation, the mankind are unique susceptible persons of vibrio cholerae.In the popular district of region, except that patient, the symptomless infection person also is important contagium.The route of transmission mainly is to take in by water source that pollutes or food per os, and interpersonal direct propagation is uncommon.Vibrio cholerae has heat-stable O antigen and heat labile H antigen.According to O antigen difference, now existing 155 serogroupss, wherein O1 group, O139 group cause cholera, the O1 group cholera vibrio infects can be from asymptomatic or light-duty lethality diarrhoea of suffering from diarrhoea serious.In 2002 the 25th of State Administration for Quality Supervision and Inspection and Quarantine and 26 commands clearly the regulation vibrio cholerae be essential items for inspection.Present detection to this bacterium, GB and the rower traditional flat board cultivation or the methods of integrated enzyme reaction (ELISA) of adopting more, these method stepss are loaded down with trivial details, waste time and energy, generally take 4-6 consuming time days at least, and because the influence of multiple interfering factors, the accuracy of detected result reduces easily, has brought very adverse influence for the import and export of food.Therefore, it is imperative to set up a kind of pathogenic bacterium detection method quicker, accurate, easy and simple to handle.
Domestic and international application mainly is divided three classes: regular-PCR technology, fluorescent PCR technology and biochip technology in the Protocols in Molecular Biology that foodborne bacterial pathogens detects at present.Method for gene chip detection efficiency height, but technology that is that all right is ripe, false positive rate and false negative rate all are difficult to control, and cost is higher, also is in conceptual phase at present.Regular-PCR method and technology maturation also is used for the detection of foodborne bacterial pathogens the earliest, but need carry out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged.Fluorescent PCR is on the basis of regular-PCR, adds a specific fluorescent probe again in a pair of Auele Specific Primer of adding in amplification reaction system, uses the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages:
(1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve sensitivity again.(2) totally-enclosed reaction, online real-time monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability.(3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the multifactor interferential end point analysis method that is subjected to of regular-PCR method, makes quantitatively more accurately and reliably.(4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb.(5) do not contact toxic reagent, operational safety.(6) help mass-producing, automatization and network management.(7) scope of application is wider, can detect the nucleic acid of any bacterium in theory.
Summary of the invention
The purpose of this invention is to provide a kind of primer and probe sequence that is used to detect O1 group cholera vibrio nucleotide fragments.
Based on above-mentioned purpose, the present invention by the following technical solutions:
The primer and the probe sequence that are used to detect O1 group cholera vibrio nucleotide fragments comprise:
By upstream primer F605 sequence is that CACGCCATTGAAGGTTATGTCTC and downstream primer R703 sequence are that the primer formed of AAATTGATGTCGATAGCGGTAGATTA is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer F605 position of this primer, extend 10 bases to 3 ' extreme direction, 6 bases are extended to 3 ' extreme direction in downstream primer R703 position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.
Probe sequence comprises: by probe Pb645 sequence is the probe sequence that CCGCCTGCTCAGCAAAAGTATTCATCA extends 6 bases and obtains in 5 ' extreme direction extends 10 base zone scopes to 3 ' extreme direction.Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
Description of drawings
Fig. 1 utilizes primer F605/R703 and probe Pb645 to be detected the fluorescent PCR amplification figure of O1 group cholera vibrio positive.
Embodiment
1. primer and probe design: by respectively all known O1 group cholera vibrio genome sequences being compared analysis, select section (the O1 group cholera vibrio rfbM gene of no secondary structure and high conservative, its sequence is seen appendix), design many to primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Optimum primer, probe sequence make up as follows:
Upstream primer F605:CACGCCATTGAAGGTTATGTCTC
Downstream primer R703:AAATTGATGTCGATAGCGGTAGATTA
Probe Pb645:CCGCCTGCTCAGCAAAAGTATTCATCA
2. the foundation of reaction system and optimization: the target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: get O1 group cholera vibrio reference culture recovery back and cultivated 48 hours, get nutrient solution 1ml and carry out 10 times of gradient dilutions, choose 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6Totally 6 extent of dilution are as serial positive template, extract genomic nucleic acids respectively, carry out pcr amplification with the primer and the probe of the longest amplified fragments in the above-mentioned detection sequence area respectively again, and the template when getting wherein person between the Ct value 24-27 as reaction system optimization later on.
2.1 the optimization of primer concentration is in reaction system, the primer concentration of O1 group cholera vibrio is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.8 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.2 μ mol/L.
2.2 under the constant prerequisite of the optimization of magnesium ion concentration other condition in reaction system, with MgCl
2Concentration increase progressively with 0.5mmo l/L from 1mmol/L to 2.5mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 2.5mmol/L of repeated experiments repeatedly.
2.3 the optimization of Taq archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 2U is as the consumption of Taq enzyme in the test kit reaction system.
2.4 the optimization of dNTPs concentration detects by the dNTPs that uses different concns, selects the usage quantity of 0.2mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.
2.5 the optimization of concentration and probe concentration is in reaction system, the concentration and probe concentration of O1 group cholera vibrio is done to detect after the multiple proportions serial dilution from 0.05 μ mol/L to 0.2 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.1 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the fluorescent PCR reaction system that adopts is 40 μ l systems, required each component and respective concentration see Table 1.
PCR reaction system after table 1 is optimized
| Component | |
| 10 * | 1× |
| Mg 2+Concentration | 2.5mmol/L |
| DNTPs (containing dUTP) | 0.2mmol/L |
| The Taq enzyme | 2U |
| Primer (upstream) | 0.2μmol/L |
| Primer (downstream) | 0.2μmol/L |
| Probe | 0.1μmol/L |
| Template | 2μl |
| Moisturizing extremely | 40μl |
Annotate: a. at the fluorescent PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.
B. the instrument difference of Shi Yonging should be done reaction parameter suitably to adjust.
3. the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
4.PCR it is as follows that condition is selected:
95 ℃ of 2min, 1 circulation;
95 ℃ of 5sec, 60 ℃ of 40sec, 40 circulations.
5. detection step:
(1) chooses primer and probe;
(2) prepare template to be measured, can adopt phenol-chloroform method to extract the genomic dna of O1 group cholera vibrio in the sample of various sources;
(3) foundation of reaction system: a, determine best primer concentration; B, determine magnesium ion concentration; C, determine Taq archaeal dna polymerase (Taq enzyme) consumption; D, determine dNTPs concentration; E, determine concentration and probe concentration;
(4) sense channel of selection instrument;
(5) go up machine testing.
6. embodiment
Choose primer to F605/R703 and probe Pb645, with O1 group cholera vibrio nutrient solution to be checked phenol-chloroform method extracting genomic dna.Concrete steps are as follows:
(1) O1 group cholera vibrio enrichment liquid (about 1ml) to be checked is added in the centrifuge tube of 1.5ml, centrifugal 5 minutes of 12000rpm removes supernatant.
(2) add dna cleavage liquid 700ul, fully mixing is resuspended, and water-bath was boiled 5 minutes.
(3) add isopyknic phenol-chloroform (V/V=1: 1) solution, fully centrifugal behind the mixing, centrifugal 5 minutes of 13000rpm.
(4) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add isopyknic chloroform, mixing, centrifugal 5 minutes of 13000rpm.
(5) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add the Virahol of 0.6 times of volume, the mixing that turns upside down, centrifugal 5 minutes of 13000rpm.
(6) use 70% alcohol flushing after abandoning supernatant, centrifugal 5 minutes of 13000rpm, the careful suction abandoned supernatant, and inversion is dried.
(7) in dried centrifuge tube, add the abundant mixing of 50ul DNA lysate, stand-by as dna profiling.In 40u l fluorescent PCR reaction system, add the above O1 group cholera vibrio genomic dna 2ul that extracts, carry out fluorescent PCR according to aforementioned PCR reaction conditions and detect.After testing, then show positive amplification curve if contain the O1 group cholera vibrio in the nutrient solution to be checked, its detection sensitivity can reach 1000 copy/ml; Then do not have amplified signal if do not contain the O1 group cholera vibrio in the nutrient solution to be checked, point out above-mentioned primer having good sensitivity and specificity with probe.
7. advantage of the present invention:
(1) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.
(2) primer provided by the invention and probe do not have amplified signal for the detection sample standard deviation that does not contain the O1 group cholera vibrio, illustrate that it has good specificity.
(3) because the present invention adopts the goal gene of the native gene rfbM of O1 group cholera vibrio as amplification, avoided the generation of false negative result.
(4) because the present invention adopts the fluorescent PCR technology as detection method, entire reaction is all carried out in the reaction tubes of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form aerosol and has polluted and cause false positive results; Because the PCR product is monitored in real time, saved monitoring time greatly, saved manpower and materials.
Appendix
O1 group cholera vibrio rfbM gene
tgctaaaact acgtttccca ctacctgtat tccgtaacgc ccgagaaatc gctaatggca 60
ggaatgcccg aatggcgtta aaaggtttag tagctaaccg agctgcactt attattagcc 120
cttcctttgg gagttctcag tactttgaac aagtcgttcg ccttattaac gcacaaagtg 180
tccgggtgat agagcgctct tggcaaggag aaccaagtgt agaggaactt tctggagtta 240
ttggagagct tgaagatttt aagccagact atattcttgc acttggcggc ggttctatca 300
ttgatggagc taagctcgct tggttattct acgaatgccc aactcttgaa tcagaacttc 360
tatatcgacc atttgcattg ccatcccttc gtggtcgcgc aaaatttgct gcaataccaa 420
caacggtagg ggctggctct gaagtttcat ccgctgctgt catgcttgat agtgttacaa 480
acagcaaaaa ggcagttgtc actcatgatt ttttaccaga cttagtgatc cttgatcctg 540
acttggtttc agaagttcca cctaaggtat tgaaaacaac tgtggccgat gctctctctc 600
acgccattga aggttatgtc tctttgattg ataacccttt gatgaatact tttgctgagc 660
aggcggtatc aataatctac cgctatcgac atcaattttc caatgataat tggagcagcg 720
aaatgctttc tgaactgcaa caagctgcta tgtttgcagg gtgggttcaa aatcattgca 780
tagttggtct ttcacatgcc attgctcacc agctaggtac gtttaatata ggccacggat 840
tggcgaacgg tttattaatg cctgcggtga tcaactttaa ttaccgcgaa catacagctg 900
caactaagta tgaacaattg atctataaat ccgggttacc taataaagaa gcattattag 960
aacttttgaa gtattggtag 980
Sequence table
＜110〉Shenzhen Taitai Genetic Engineering Co., Ltd.
＜120〉a kind of primer and probe sequence that is used to detect O1 group cholera vibrio nucleotide fragments
<160>3
<170>PatentIn version 3.3
<210>1
<211>23
<212>DNA
＜213〉artificial sequence
<400>1
cacgccattg aaggttatgt ctc 23
<210>2
<211>26
<212>DNA
＜213〉artificial sequence
<400>2
aaattgatgt cgatagcggt agatta 26
<210>3
<211>27
<212>DNA
＜213〉artificial sequence
<400>3
ccgcctgctc agcaaaagta ttcatca 27
Claims (4)
1. primer sequence that is used to detect O1 group cholera vibrio nucleotide fragments, it is characterized in that described primer sequence comprises: by upstream primer F605 sequence is that CACGCCATTGAAGGTTATGTCTC and downstream primer R703 sequence are that the primer formed of AAATTGATGTCGATAGCGGTAGATTA is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer F605 position of this primer, extend 10 bases to 3 ' extreme direction, 6 bases are extended to 3 ' extreme direction in downstream primer R703 position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.
2. the primer sequence that is used to detect O1 group cholera vibrio nucleotide fragments according to claim 1 is characterized in that described primer sequence comprises: upstream primer F605 sequence is that CACGCCATTGAAGGTTATGTCTC and downstream primer R703 sequence are AAATTGATGTCGATAGCGGTAGATTA.
3. probe sequence that is used to detect O1 group cholera vibrio nucleotide fragments is characterized in that described probe sequence comprises: by probe Pb645 sequence is the probe sequence that CCGCCTGCTCAGCAAAAGTATTCATCA extends 6 bases and obtains in 5 ' extreme direction extends 10 base zone scopes to 3 ' extreme direction.
4. the probe sequence that is used to detect O1 group cholera vibrio nucleotide fragments according to claim 3 is characterized in that described probe Pb645 sequence is CCGCCTGCTCAGCAAAAGTATTCATCA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101208953A CN100386442C (en) | 2005-12-15 | 2005-12-15 | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101208953A CN100386442C (en) | 2005-12-15 | 2005-12-15 | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1831142A true CN1831142A (en) | 2006-09-13 |
| CN100386442C CN100386442C (en) | 2008-05-07 |
Family
ID=36993640
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101208953A Expired - Fee Related CN100386442C (en) | 2005-12-15 | 2005-12-15 | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100386442C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967516A (en) * | 2010-04-12 | 2011-02-09 | 中山大学达安基因股份有限公司 | Vibrio cholerae typing and virulence gene detection kit and detection method |
| CN102296107A (en) * | 2010-06-28 | 2011-12-28 | 天津生物芯片技术有限责任公司 | Primers and kit for detecting vibrio cholerae Serogroup O1 |
| CN101768634B (en) * | 2008-12-31 | 2012-07-04 | 蔡剑平 | Composition for detecting O1 group vibrio cholerae, kit and detection method |
| CN101768636B (en) * | 2009-01-06 | 2012-08-15 | 蔡剑平 | Composition and kit for detecting vibrio cholerae and detection method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5426025A (en) * | 1992-05-28 | 1995-06-20 | Florida State University | Species-specific DNA probes for vibrio vulnificus methods and kits |
-
2005
- 2005-12-15 CN CNB2005101208953A patent/CN100386442C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101768634B (en) * | 2008-12-31 | 2012-07-04 | 蔡剑平 | Composition for detecting O1 group vibrio cholerae, kit and detection method |
| CN101768636B (en) * | 2009-01-06 | 2012-08-15 | 蔡剑平 | Composition and kit for detecting vibrio cholerae and detection method |
| CN101967516A (en) * | 2010-04-12 | 2011-02-09 | 中山大学达安基因股份有限公司 | Vibrio cholerae typing and virulence gene detection kit and detection method |
| CN101967516B (en) * | 2010-04-12 | 2012-10-03 | 中山大学达安基因股份有限公司 | Vibrio cholerae typing and virulence gene detection kit and detection method |
| CN102296107A (en) * | 2010-06-28 | 2011-12-28 | 天津生物芯片技术有限责任公司 | Primers and kit for detecting vibrio cholerae Serogroup O1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100386442C (en) | 2008-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| CN1831142A (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN101235413B (en) | Method and kit for detecting Shigella and ipaH pathogenicity island thereof | |
| CN1405328A (en) | Fluorescent quantitative PCR kit for rapid and quantitative detecting hog choleravirus and hog cholera lapinized vaccine and its use | |
| CN1834260A (en) | Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio | |
| CN1831143A (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus | |
| CN1880472A (en) | Detection kit for pine wood nematode and detection method therefor | |
| CN112981006A (en) | Efficient quintuplet shrimp disease detection primer and kit | |
| CN1865937A (en) | Real-time fluorescent quantitative detection method for simultaneous detection of A-type and B-type influenza virus and kit therefor | |
| CN1749413A (en) | Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence | |
| CN1743459A (en) | Primer for detecting salmonella nucleotide fragment and probe sequence | |
| CN1749414A (en) | Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence | |
| CN101294224B (en) | Primer and probe sequence for testing pig parvoviral nucleotide fragment | |
| CN1233843C (en) | Kit of testing garlic virus and testing method | |
| CN1837364A (en) | Real-time fluorescence PCR immobilization kit of wheat dwarf bunt germ (Tilletia controversa kuhn) and its detection method | |
| CN1831141A (en) | Primer and probe sequence for detecting nucleotide fragment of shigella | |
| CN1814788A (en) | Waters frequent food born pathogenic hacteria multiple PCR rapid detecting kit and its detecting method | |
| CN1932037A (en) | Method of screening transgenic wheat | |
| CN1749412A (en) | Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence | |
| CN1243107C (en) | Method of PCR detecting SARS virus gene | |
| CN1831140A (en) | Pimer and probe sequence for detecting nucleotide fragment of paratypic hemolytic vibrio | |
| CN101195845A (en) | Primer and probe sequence for detecting pseudorabies virus nucleotide fragment of pig | |
| CN113337626B (en) | Method for detecting acute strain and subacute strain of prawn VPAHPND | |
| CN1944666A (en) | Primer sequence and detecting reagent kit for detecting prawn white spot syndrome virus | |
| CN1296489C (en) | Primer and probe sequence of real time fluencent RT-PCR detection used for H5 sub-type poultry influenza |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080507 Termination date: 20171215 |