CN1749412A - Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence - Google Patents

Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence Download PDF

Info

Publication number
CN1749412A
CN1749412A CNA2004100512078A CN200410051207A CN1749412A CN 1749412 A CN1749412 A CN 1749412A CN A2004100512078 A CNA2004100512078 A CN A2004100512078A CN 200410051207 A CN200410051207 A CN 200410051207A CN 1749412 A CN1749412 A CN 1749412A
Authority
CN
China
Prior art keywords
primer
sequence
probe
extreme direction
campylobacter jejuni
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CNA2004100512078A
Other languages
Chinese (zh)
Other versions
CN100395345C (en
Inventor
肖性龙
林镜中
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHENZHEN TAITAI GENETIC ENGINEERING Co Ltd
Original Assignee
SHENZHEN TAITAI GENETIC ENGINEERING Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHENZHEN TAITAI GENETIC ENGINEERING Co Ltd filed Critical SHENZHEN TAITAI GENETIC ENGINEERING Co Ltd
Priority to CNB2004100512078A priority Critical patent/CN100395345C/en
Publication of CN1749412A publication Critical patent/CN1749412A/en
Application granted granted Critical
Publication of CN100395345C publication Critical patent/CN100395345C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is PCR proliferation primer and probe sequence for detecting nucleotide segment of jejunum campylobacter. The primer sequence includes the primer pair comprising upstream primer sequence CJU of TTGGTATGGCTATAGGAACTCTTATAGCT and downstream primer sequence CJR of CACACCTGAAGTATGAAGTGGTCTAAGT, as well as 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of upstream primer CJU and 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of downstream primer CJR. The probe sequence includes probe CJ-p1 sequence ATGGCATATCCTAATTTA, 10 bases extending in the 3' end direction and 5 bases extending in the 5' end direction.

Description

A kind of primer and probe sequence that is used to detect the campylobacter jejuni nucleotide fragments
Technical field
The present invention relates to a kind of primer and probe sequence that is used to detect the campylobacter jejuni nucleotide fragments.
Background technology
Campylobacter jejuni is pathogenic bacterium common in the import and export food, is to cause poisoning by food and the The main pathogenic fungi of food origin disease.The intracellular toxin of this bacterium can attack small intestine and big intestinal mucosa causes acute enteritis, also can cause the outbreak of epidemic or the mass food poisoning of diarrhoea.Being generally its latent period 3～5 days, is jejunum, ileum and colon to people's pathogenic position, and cardinal symptom is diarrhoea and stomachache, heating sometimes, and idol has vomiting and dehydration.Bacterium can go into blood flow by intestinal mucosa sometimes and cause septicemia and other organs infections, as meningitis, sacroiliitis, pyelonephritis etc.The pregnant woman infects this bacterium can cause miscarriage, premature labor, and the newborn infant is contaminted.In 2002 the 25th of State Administration for Quality Supervision and Inspection and Quarantine and 26 commands clearly the regulation campylobacter jejuni be essential items for inspection.Present detection to this bacterium, GB and the rower traditional flat board cultivation or the methods of integrated enzyme reaction (ELISA) of adopting more, these method stepss are loaded down with trivial details, waste time and energy, generally take 4-6 consuming time days at least, and because the influence of multiple interfering factors, the accuracy of detected result reduces easily, has brought very adverse influence for the import and export of food.Therefore, it is imperative to set up a kind of pathogenic bacterium detection method quicker, accurate, easy and simple to handle.
Domestic and international application mainly is divided three classes: regular-PCR technology, fluorescent PCR technology and biochip technology in the Protocols in Molecular Biology that foodborne bacterial pathogens detects at present.Method for gene chip detection efficiency height, but technology that is that all right is ripe, false positive rate and false negative rate all are difficult to control, and cost is higher, also is in conceptual phase at present.Regular-PCR method and technology maturation also is used for the detection of foodborne bacterial pathogens the earliest, but need carry out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged.Fluorescent PCR is on the basis of regular-PCR, adds a specific fluorescent probe again in a pair of Auele Specific Primer of adding in amplification reaction system, uses the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages: (1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve sensitivity again.(2) totally-enclosed reaction, online real-time monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability.(3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the multifactor interferential end point analysis method that is subjected to of regular-PCR method, makes quantitatively more accurately and reliably.(4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb.(5) do not contact toxic reagent, operational safety.(6) help mass-producing, automatization and network management.(7) scope of application is wider, can detect the nucleic acid of any bacterium in theory.
Summary of the invention
The purpose of this invention is to provide a kind of primer and probe sequence that is used to detect the campylobacter jejuni nucleotide fragments.
Based on above-mentioned purpose, the present invention by the following technical solutions:
The primer and the probe sequence that are used to detect the campylobacter jejuni nucleotide fragments comprise:
1. be that TTGGTATGGCTATAGGAACTCTTATAGCT and downstream primer CJR sequence are that the primer formed of CACACCTGAAGTATGAAGTGGTCTAAGT is right by upstream primer CJU sequence, and 10 bases are extended to 5 ' extreme direction in the right upstream primer CJU position of this primer, extend 10 bases to 3 ' extreme direction, 10 bases are extended to 3 ' extreme direction in downstream primer CJR position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.Probe sequence comprises: by probe CJ-p1 sequence is the probe sequence that ATGGCATATCCTAATTTA extends 10 bases and obtains in 5 ' extreme direction extends 5 base zone scopes to 3 ' extreme direction.
2. be that TTCACGGCGAATTCCAATAAG and downstream primer CJRR sequence are that the primer formed of TCTTTGTTTATGGGTGTGACTACATCT is right by upstream primer CJUF sequence, and 10 bases are extended to 5 ' extreme direction in the right upstream primer CJUF position of this primer, extend 10 bases to 3 ' extreme direction, 10 bases are extended to 3 ' extreme direction in downstream primer CJUR position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.Probe sequence comprises: by probe CJ-p2 sequence is the probe sequence that TAAAACCCAAACAAGAACA extends 10 bases and obtains in 5 ' extreme direction extends 10 base zone scopes to 3 ' extreme direction.
Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
Description of drawings
Fig. 1 utilizes primer CJU/CJR and probe CJ-p1 to be detected the fluorescent PCR amplification figure of campylobacter jejuni positive.
Embodiment
1. primer and probe design: by respectively all known campylobacter jejuni gene group sequences being compared analysis, select section (the campylobacter jejuni open reading frame C sequence of no secondary structure and high conservative, its complete sequence is seen appendix), design many to primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Optimum primer, probe sequence make up as follows:
(1) upstream primer CJU:TTGGTATGGCTATAGGAACTCTTATAGCT
Downstream primer CJR:CACACCTGAAGTATGAAGTGGTCTAAGT
Probe CJ-p1:ATGGCATATCCTAATTTA
(2) upstream primer CJUF:TTCACGGCGAATTCCAATAAG
Downstream primer CJRR:TCTTTGTTTATGGGTGTGACTACATCT
Probe CJ-p2:TAAAACCCAAACAAGAACA
2. the foundation of reaction system and optimization: the target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: get campylobacter jejuni reference culture recovery back and cultivated 48 hours, get nutrient solution 1ml and carry out 10 times of gradient dilutions, choose 10 -1, 10 -2, 10 -3, 10 -4, 10 -5, 10 -6Totally 6 extent of dilution are as serial positive template, extract genomic nucleic acids respectively, carry out pcr amplification with the primer and the probe of the longest amplified fragments in the above-mentioned detection sequence area respectively again, and the template when getting wherein person between the Ct value 24-27 as reaction system optimization later on.
2.1 the optimization of primer concentration is in reaction system, the primer concentration of campylobacter jejuni is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.8 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.2 μ mol/L.
2.2 under the constant prerequisite of the optimization of magnesium ion concentration other condition in reaction system, with MgCl 2Concentration increase progressively with 0.5mmol/L from 1mmol/L to 2.5mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 2.5mmol/L of repeated experiments repeatedly.
2.3Taq the optimization of archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 2U is as the consumption of Taq enzyme in the test kit reaction system.
2.4dNTPs the optimization of concentration detects by the dNTPs that uses different concns, selects the usage quantity of 0.2mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.
2.5 the optimization of concentration and probe concentration is in reaction system, the concentration and probe concentration of campylobacter jejuni is done to detect after the multiple proportions serial dilution from 0.05 μ mol/L to 0.2 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.1 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the fluorescent PCR reaction system that adopts is 40 μ l systems, required each component and respective concentration see Table 1.
PCR reaction system after table 1 is optimized
Component Final concentration
10 * PCR reaction buffer 1×
Mg 2+Concentration 2.5mmol/L
DNTPs (containing dUTP) 0.2mmol/L
The Taq enzyme 2U
Primer (upstream) 0.2μmol/L
Primer (downstream) 0.2μmol/L
Probe 0.1μmol/L
Template 2μl
Moisturizing extremely 40μl
Annotate: a. at the fluorescent PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.
B. the instrument difference of Shi Yonging should be done reaction parameter suitably to adjust.
3. the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
4.PCR it is as follows that condition is selected:
95 ℃ of 2min, 1 circulation;
95 ℃ of 5sec, 60 ℃ of 40sec, 40 circulations.
5. detection step:
(1) chooses primer and probe;
(2) prepare template to be measured, can adopt phenol-chloroform method to extract the genomic dna of campylobacter jejuni in the sample of various sources;
(3) foundation of reaction system: a, determine best primer concentration; B, determine magnesium ion concentration; C, determine Taq archaeal dna polymerase (Taq enzyme) consumption; D, determine dNTPs concentration; E, determine concentration and probe concentration;
(4) sense channel of selection instrument;
(5) go up machine testing.
6. embodiment
Choose primer to CJU/CJR and probe CJ-p1, with jejunum campylobacter bacteria culture fluid to be checked phenol-chloroform method extracting genomic dna.Concrete steps are as follows:
(1) campylobacter jejuni enrichment liquid to be checked (about 1ml) is added in the centrifuge tube of 1.5ml, centrifugal 5 minutes of 12000rpm removes supernatant.
(2) add dna cleavage liquid 700ul, fully mixing is resuspended, and water-bath was boiled 5 minutes.
(3) add isopyknic phenol-chloroform (V/V=1: 1) solution, fully centrifugal behind the mixing, centrifugal 5 minutes of 13000rpm.
(4) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add isopyknic chloroform, mixing, centrifugal 5 minutes of 13000rpm.
(5) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add the Virahol of 0.6 times of volume, the mixing that turns upside down, centrifugal 5 minutes of 13000rpm.
(6) use 70% alcohol flushing after abandoning supernatant, centrifugal 5 minutes of 13000rpm, the careful suction abandoned supernatant, and inversion is dried.
(7) in dried centrifuge tube, add the abundant mixing of 50ul DNA lysate, stand-by as dna profiling.
In 40ul fluorescent PCR reaction system, add the above campylobacter jejuni gene group DNA 2ul that extracts, carry out fluorescent PCR according to aforementioned PCR reaction conditions and detect.After testing, then show positive amplification curve if contain campylobacter jejuni in the nutrient solution to be checked, its detection sensitivity can reach 1000 copy/ml; Then do not have amplified signal if do not contain campylobacter jejuni in the nutrient solution to be checked, point out above-mentioned primer having good sensitivity and specificity with probe.
7. advantage of the present invention:
(1) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.
(2) primer provided by the invention and probe do not have amplified signal for the detection sample standard deviation that does not contain campylobacter jejuni, illustrate that it has good specificity.
(3) because the present invention adopts the goal gene of the native gene open reading frame C sequence of campylobacter jejuni as amplification, avoided the generation of false negative result.
(4) because the present invention adopts the fluorescent PCR technology as detection method, entire reaction is all carried out in the reaction tubes of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form aerosol and has polluted and cause false positive results; Because the PCR product is monitored in real time, saved monitoring time greatly, saved manpower and materials.
Appendix
Campylobacter jejuni open reading frame C sequence
5’-CACCATTTACCCATTCCAGTAACAAAATAAGTTGGTACTTCCATGTTGTTAAAAAGATAAAGCATAG
CTATACCTAAAAATGTAGCTATATAATACCATAGAGAAATATAAAGGGTTTT TTCACGGCGAATTCCAAT
CJUF
AAGTCCAAAAATACTTACACCCCA TAAAACCCAAACAAGAACAACAAGAATATCTAAAGGCCACTCAAGC
CJ-p2
TCTGCATATTCTTT AGATGTAGTCACACCCATAAACAAAGATATAACAGCTAAAACCATAGTAAGCATAT
CJRR
AAAGCCAAAAATGAAGCTTACCAACAGCCATTAAAAATCTTGACTCAGCCATACTCACTTTAAGAACACG
CTGACCTATATAATACCAAGTTGCCCAAATCCCTGAAAGCATAAAACCAAAAAT CACACCTGAAGTATGA
CJR
AGTGGTCTAAGTCTTGAAAAAGTGGCATATTCTCCTGCTAAATAATT TAAATTAGGATATGCCATTTGAA
CJ-p1
A AGCTATAAGAGTTCCTATAGCCATACCAACAATGCCAAACAATATGGTCGCAAACATAAAATATCTTGC
CJU
AACCGTATAGTCGTAATTTAATACATTACCTGGATGCATCGACTTTCTCCTTAAAATTTTTGATAACAAG
AGAATATTATAGAATATTAATTATACATTTTTTCTTAAAAATGATAATTTTGTTAATCATTTGTTATGTT
TTATATTTTAAGGCTAAATCAGTCTTATTTATTGATATTTATCTTATAACCTAAACTTGGCACATTTTTT
ATAAAATCTTCACCCACTTTATCTCTTACTCTTTTTATAAAAGTTCTAACAGCAGTATCGCTCACATGTT
CAC-3’

Claims (8)

1. primer sequence that is used to detect the campylobacter jejuni nucleotide fragments, it is characterized in that described primer sequence comprises: by upstream primer CJU sequence is that TTGGTATGGCTATAGGAACTCTTATAGCT and downstream primer CJR sequence are that the primer formed of CACACCTGAAGTATGAAGTGGTCTAAGT is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer CJU position of this primer, 10 bases are extended to 3 ' extreme direction in downstream primer CJR position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.
2. the primer sequence that is used to detect the campylobacter jejuni nucleotide fragments according to claim 1 is characterized in that described primer sequence comprises: upstream primer CJU sequence is that TTGGTATGGCTATAGGAACTCTTATAGCT and downstream primer CJR sequence are CACACCTGAAGTATGAAGTGGTCTAAGT.
3. probe sequence that is used to detect the campylobacter jejuni nucleotide fragments is characterized in that described probe sequence comprises: by probe CJ-p1 sequence is the probe sequence that ATGGCATATCCTAATTTA extends 10 bases and obtains in 5 ' extreme direction extends 5 base zone scopes to 3 ' extreme direction.
4. the probe sequence that is used to detect the campylobacter jejuni nucleotide fragments according to claim 3 is characterized in that described probe CJ-p1 sequence is ATGGCATATCCTAATTTA.
5. primer sequence that is used to detect the campylobacter jejuni nucleotide fragments, it is characterized in that described primer sequence comprises: by upstream primer CJUF sequence is that TTCACGGCGAATTCCAATAAG and downstream primer CJRR sequence are that the primer formed of TCTTTGTTTATGGGTGTGACTACATCT is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer CJUF position of this primer, extend 10 bases to 3 ' extreme direction, 10 bases are extended to 3 ' extreme direction in downstream primer CJRR position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.
6. the primer sequence that is used to detect the campylobacter jejuni nucleotide fragments according to claim 5 is characterized in that described primer sequence comprises: upstream primer CJUF sequence is that TTCACGGCGAATTCCAATAAG and downstream primer CJRR sequence are TCTTTGTTTATGGGTGTGACTACATCT.
7. one kind is used for the probe sequence that campylobacter jejuni fluorescence PCR detects, and it is characterized in that described probe sequence comprises: by probe CJ-p2 sequence is the probe sequence that TAAAACCCAAACAAGAACA extends 10 bases and obtains in 5 ' extreme direction extends 10 base zone scopes to 3 ' extreme direction.
8. the probe sequence that is used to detect the campylobacter jejuni nucleotide fragments according to claim 7 is characterized in that described probe CJ-p2 sequence is TAAAACCCAAACAAGAACA.
CNB2004100512078A 2004-08-20 2004-08-20 Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence Expired - Fee Related CN100395345C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2004100512078A CN100395345C (en) 2004-08-20 2004-08-20 Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2004100512078A CN100395345C (en) 2004-08-20 2004-08-20 Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence

Publications (2)

Publication Number Publication Date
CN1749412A true CN1749412A (en) 2006-03-22
CN100395345C CN100395345C (en) 2008-06-18

Family

ID=36605068

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2004100512078A Expired - Fee Related CN100395345C (en) 2004-08-20 2004-08-20 Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence

Country Status (1)

Country Link
CN (1) CN100395345C (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101624625B (en) * 2009-03-20 2012-01-11 曹际娟 Detection kit for common campylobacter in foods and detection method thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1396270A (en) * 2001-07-16 2003-02-12 军事医学科学院卫生学环境医学研究所 DNA microarray for detecting frequently countered pathogenic bacteria in water

Also Published As

Publication number Publication date
CN100395345C (en) 2008-06-18

Similar Documents

Publication Publication Date Title
CN105154589B (en) A kind of multi-fluorescence immunoassay method of quick differentiation PEDV, TGEV, PoRV
CN113862393A (en) Method for rapidly detecting cryptococcus gatherensis
CN102925548B (en) Actinobacillus pleuropneumoniae LAMP kit and application method thereof
CN100404689C (en) Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof
CN101709331B (en) Kit for quantitatively detecting vibrio parahaemolyticus in food and clinic sample
CN100386442C (en) Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus
CN101235413B (en) Method and kit for detecting Shigella and ipaH pathogenicity island thereof
CN1749413A (en) Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence
CN1743459A (en) Primer for detecting salmonella nucleotide fragment and probe sequence
CN100395350C (en) Prime and probe sequence for detecting nucleotide fregment of comma bacillus
CN100386443C (en) Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio
CN1749414A (en) Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence
CN103525923A (en) Primer, probe and method for qualitatively and quantitatively detecting witches' broom phytoplasma
CN102676653A (en) Non-diagnostic method for detection of O1 group and O139 group of vibrio cholerae through double TaqMan probe fluorescence RT-PCR (Reverse Transcription-Polymerase Chain Reaction)
CN1749412A (en) Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence
CN105200122A (en) Quantitative detection kit for wheat stripe rust and application thereof
CN101294224B (en) Primer and probe sequence for testing pig parvoviral nucleotide fragment
CN103320528B (en) Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe
CN100402667C (en) Primer and probe sequence for detecting nucleotide fragment of shigella
CN102925568B (en) Primer and probe for detecting acidovorax citrulli and detection method for acidovorax citrulli
CN105567831A (en) Qualitative and quantitative detection method for food microorganisms
CN1243107C (en) Method of PCR detecting SARS virus gene
CN103320527A (en) Primer pair and probe for detecting avian influenza virus in sample by fluorescence RT-PCR and kit containing primer pair and probe
CN101195845A (en) Primer and probe sequence for detecting pseudorabies virus nucleotide fragment of pig
CN100557029C (en) A kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080618

Termination date: 20170820

CF01 Termination of patent right due to non-payment of annual fee