CN1831140A - Pimer and probe sequence for detecting nucleotide fragment of paratypic hemolytic vibrio - Google Patents
Pimer and probe sequence for detecting nucleotide fragment of paratypic hemolytic vibrio Download PDFInfo
- Publication number
- CN1831140A CN1831140A CNA2005101208934A CN200510120893A CN1831140A CN 1831140 A CN1831140 A CN 1831140A CN A2005101208934 A CNA2005101208934 A CN A2005101208934A CN 200510120893 A CN200510120893 A CN 200510120893A CN 1831140 A CN1831140 A CN 1831140A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- probe
- vibrio parahaemolyticus
- probe sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR expanding primer and probe sequence of vibrio parahaemolyticus nucleotide section. The primer sequence includes headwaters primer vp1231pf and the sequence is GCGACCTTTCTCTGAAATATTAATTGT, and down stream primer and the sequence is the primer pair of CATTCGCGTGGCAAACATC, and 10 basic group expanding towards 5'end direction, 4 basic group expanding towards 3'end direction from headwaters primer, and 8 basic group expanding towards 3'end direction, and 10 basic group area range primer sequence toward 5'end expanding direction. The probe sequence includes: 8 basic groups toward 3'end direction of CGCACAAGGCTCGACGGCTGA of vp1259pb, and probe sequence gained toward 5'directon expanding from 4 basic group area ranges.
Description
Technical field
The present invention relates to a kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments.
Background technology
Vibrio parahaemolyticus is a common pathogenic bacteria in food, is to cause poisoning by food and the The main pathogenic fungi of food origin disease.Vibrio parahemolyticus extensively survives in coastal seawater and the fish and shellfish food, and thermal zone is more.The recall rate of China this bacterium of Coastal Area in Eastern China is 57.4～66.5%, and is higher with summer and autumn especially.The bacterial bearing rate average out to 45～48% of marine fishes and shrimps, summer is up to 90%.The fish and shellfish bacterial bearing rate of pickling also reaches 42.4%, and present vibrio parahaemolytisus poisoning accounts for the 3rd of bacterial food poisoning, and the coastal cities that have can hold pride of place.The main food borne transmission of Vibrio parahemolyticus, main food are sea-food or salt pickled prod, and common person is crab class, cuttlefish, jellyfish, fish, yellow mud spiral shell etc., are egg product, meat or vegetables secondly.How feed meat or vegetables and cause the patient cause because of foodstuff container or chopping block pollute institute.The food poisoning men and women, old and young that Vibrio parahemolyticus causes all can be ill, but be many with person between twenty and fifty, and immunizing power is not strong after being ill, but superinfection.This sick pilosity is born in the Xia Qiu coastland, often causes collective's morbidity.Coastland morbidity in recent years has the trend that increases.In 2002 the 25th of State Administration for Quality Supervision and Inspection and Quarantine and 26 commands clearly the regulation Vibrio parahaemolyticus be essential items for inspection.Present detection to this bacterium, GB and the rower traditional flat board cultivation or the methods of integrated enzyme reaction (ELISA) of adopting more, these method stepss are loaded down with trivial details, waste time and energy, generally take 4-6 consuming time days at least, and because the influence of multiple interfering factors, the accuracy of detected result reduces easily, has brought very adverse influence for the import and export of food.Therefore, it is imperative to set up a kind of pathogenic bacterium detection method quicker, accurate, easy and simple to handle.
Domestic and international application mainly is divided three classes: regular-PCR technology, fluorescent PCR technology and biochip technology in the Protocols in Molecular Biology that foodborne bacterial pathogens detects at present.Method for gene chip detection efficiency height, but technology that is that all right is ripe, false positive rate and false negative rate all are difficult to control, and cost is higher, also is in conceptual phase at present.Regular-PCR method and technology maturation also is used for the detection of foodborne bacterial pathogens the earliest, but need carry out aftertreatment to the PCR product, very easily causes the PCR product pollution, and certain non-specific amplification is arranged.Fluorescent PCR is on the basis of regular-PCR, adds a specific fluorescent probe again in a pair of Auele Specific Primer of adding in amplification reaction system, uses the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.Except the advantage with regular-PCR, it also has the following advantages:
(1) specificity is stronger, and sensitivity is higher.Since used more one can with the fluorescent probe of template complementary pairing, improved specificity, and collected fluorescent signal by self-reacting device, avoided the subjectivity of artificial judgment, can further improve sensitivity again.(2) totally-enclosed reaction, online real-time monitoring fluorescence, aftertreatment that need not the PCR product is avoided polluting, and has guaranteed result's reliability.(3) data analysis is selected in the logarithmic phase of nucleic acid amplification, abandons the multifactor interferential end point analysis method that is subjected to of regular-PCR method, makes quantitatively more accurately and reliably.(4) can realize the two inspections of single tube or many inspections, also can design mark in the specific aim, monitoring extraction efficiency and get rid of inhibitor and disturb.(5) do not contact toxic reagent, operational safety.(6) help mass-producing, automatization and network management.(7) scope of application is wider, can detect the nucleic acid of any bacterium in theory.
Summary of the invention
The purpose of this invention is to provide a kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments.
Based on above-mentioned purpose, the present invention by the following technical solutions:
The primer and the probe sequence that are used to detect the Vibrio parahaemolyticus nucleotide fragments comprise:
By upstream primer vp1231pf sequence is that GCGACCTTTCTCTGAAATATTAATTGT and downstream primer vp1286pr sequence are that the primer formed of CATTCGCGTGGCAAACATC is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer vp1231pf position of this primer, extend 4 bases to 3 ' extreme direction, 8 bases are extended to 3 ' extreme direction in downstream primer vp1286pr position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.Probe sequence comprises: by probe vp1259pb sequence is the probe sequence that CGCACAAGGCTCGACGGCTGA extends 8 bases and obtains in 5 ' extreme direction extends 4 base zone scopes to 3 ' extreme direction.
Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
Description of drawings
Fig. 1 utilizes primer vp1231pf/vp1259pr and probe vp1259pb to be detected the fluorescent PCR amplification figure of Vibrio parahaemolyticus positive.
Embodiment
1. primer and probe design: by respectively all known vibrio parahaemolyticus gene group sequences being compared analysis, select section (the Vibrio parahaemolyticus toxR gene of no secondary structure and high conservative, its sequence is seen appendix), design many to primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Optimum primer, probe sequence make up as follows:
Upstream primer vp1231pf:GCGACCTTTCTCTGAAATATTAATTGT
Downstream primer vp1286pr:CATTCGCGTGGCAAACATC
Probe vp 1259pb:CGCACAAGGCTCGACGGCTGA
2. the foundation of reaction system and optimization: the target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: get Vibrio parahaemolyticus reference culture recovery back and cultivated 48 hours, get nutrient solution 1ml and carry out 10 times of gradient dilutions, choose 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6Totally 6 extent of dilution are as serial positive template, extract genomic nucleic acids respectively, carry out pcr amplification with the primer and the probe of the longest amplified fragments in the above-mentioned detection sequence area respectively again, and the template when getting wherein person between the Ct value 24-27 as reaction system optimization later on.
2.1 the optimization of primer concentration is in reaction system, the primer concentration of Vibrio parahaemolyticus is done to detect after the multiple proportions serial dilution from 0.1 μ mol/L to 0.8 μ mol/L respectively, analysis by test-results is compared, and determines that best primer final concentration is 0.2 μ mol/L.
2.2 under the constant prerequisite of the optimization of magnesium ion concentration other condition in reaction system, with MgCl
2Concentration increase progressively with 0.5mmol/L from 1mmol/L to 2.5mmol/L, be magnesium ion concentration in the test kit reaction system through the selected 2.5mmol/L of repeated experiments repeatedly.
2.3 the optimization of Taq archaeal dna polymerase (Taq enzyme) consumption is by comparing the optimization experiment result of Taq enzyme dosage (in the Unit of unit), selected 2U is as the consumption of Taq enzyme in the test kit reaction system.
2.4 the optimization of dNTPs concentration detects by the dNTPs that uses different concns, selects the usage quantity of 0.2mmol/L as dNTPs in the test kit reaction system after the comprehensive assessment.
2.5 the optimization of concentration and probe concentration is in reaction system, the concentration and probe concentration of Vibrio parahaemolyticus is done to detect after the multiple proportions serial dilution from 0.05 μ mol/L to 0.2 μ mol/L respectively, analysis by test-results is compared, and determines that best probe final concentration is 0.1 μ mol/L.
Utilize above-mentioned primer and probe to carry out the foundation of reaction system, determine that at last the fluorescent PCR reaction system that adopts is 40 μ l systems, required each component and respective concentration see Table 1.
PCR reaction system after table 1 is optimized
| Component | |
| 10 * | 1× |
| Mg 2+Concentration | 2.5mmol/L |
| DNTPs (containing dUTP) | 0.2mmol/L |
| The Taq enzyme | 2U |
| Primer (upstream) | 0.2μmol/L |
| Primer (downstream) | 0.2μmol/L |
| Probe | 0.1μmol/L |
| Template | 2μl |
| Moisturizing extremely | 40μl |
Annotate: a. at the fluorescent PCR reaction volume not simultaneously, each reagent should be adjusted in proportion.
B. the instrument difference of Shi Yonging should be done reaction parameter suitably to adjust.
3. the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, should be with reference to the instrument working instructions.
4.PCR it is as follows that condition is selected:
95 ℃ of 2min, 1 circulation;
95 ℃ of 5sec, 60 ℃ of 40sec, 40 circulations.
5. detection step:
(1) chooses primer and probe;
(2) prepare template to be measured, can adopt phenol-chloroform method to extract the genomic dna of Vibrio parahaemolyticus in the sample of various sources;
(3) foundation of reaction system: a, determine best primer concentration; B, determine magnesium ion concentration; C, determine Taq archaeal dna polymerase (Taq enzyme) consumption; D, determine dNTPs concentration; E, determine concentration and probe concentration;
(4) sense channel of selection instrument;
(5) go up machine testing.
6. embodiment
Choose primer to vp1231pf/vp1259pr and probe vp1259pb, with Vibrio parahaemolyticus nutrient solution to be checked phenol-chloroform method extracting genomic dna.Concrete steps are as follows:
(1) Vibrio parahaemolyticus enrichment liquid to be checked (about 1ml) is added in the centrifuge tube of 1.5ml, centrifugal 5 minutes of 12000rpm removes supernatant.
(2) add dna cleavage liquid 700ul, fully mixing is resuspended, and water-bath was boiled 5 minutes.
(3) add isopyknic phenol-chloroform (V/V=1: 1) solution, fully centrifugal behind the mixing, centrifugal 5 minutes of 13000rpm.
(4) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add isopyknic chloroform, mixing, centrifugal 5 minutes of 13000rpm.
(5) supernatant liquor is moved in the centrifuge tube of another 1.5ml, add the Virahol of 0.6 times of volume, the mixing that turns upside down, centrifugal 5 minutes of 13000rpm.
(6) use 70% alcohol flushing after abandoning supernatant, centrifugal 5 minutes of 13000rpm, the careful suction abandoned supernatant, and inversion is dried.
(7) in dried centrifuge tube, add the abundant mixing of 50ul DNA lysate, stand-by as dna profiling.
In 40ul fluorescent PCR reaction system, add the above vibrio parahaemolyticus gene group DNA 2ul that extracts, carry out fluorescent PCR according to aforementioned PCR reaction conditions and detect.After testing, then show positive amplification curve if contain Vibrio parahaemolyticus in the nutrient solution to be checked, its detection sensitivity can reach 1000 copy/ml; Then do not have amplified signal if do not contain Vibrio parahaemolyticus in the nutrient solution to be checked, point out above-mentioned primer having good sensitivity and specificity with probe.
7. advantage of the present invention:
(1) detection sensitivity of primer provided by the invention and probe can reach 1000 copy/ml, illustrates that it has good sensitivity.
(2) primer provided by the invention and probe do not have amplified signal for the detection sample standard deviation that does not contain Vibrio parahaemolyticus, illustrate that it has good specificity.
(3) because the present invention adopts the goal gene of the native gene toxR of Vibrio parahaemolyticus as amplification, avoided the generation of false negative result.
(4) because the present invention adopts the fluorescent PCR technology as detection method, entire reaction is all carried out in the reaction tubes of sealing, has avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form aerosol and has polluted and cause false positive results; Because the PCR product is monitored in real time, saved monitoring time greatly, saved manpower and materials.
Appendix
Vibrio parahaemolyticus toxR gene
atgactaaca tcggcaccaa atttctactt gctcaaaggt ttacctttga tccaaatagt 60
aattcgccgc agaccaacaa agcggcaacg aagttgtacg attaggaagc aacgaaagcc 120
gtatactcct gatgttggcg gagagaccaa acgaagtttt aacccgtaac gagcttcacg 180
agtttgtttg gcgtgagcaa ggttttgagg tggatgactc aagcctgact caagcgattt 240
ctactctgcg taagatgttg aaggattcaa ccaaatctcc agagtttgtt aaaaccgttc 300
caaaacgagg ctatcaactc atttgtactg ttgaacgcct aagcccgctt tcttcagact 360
caagctcaat tgaagttgaa gaacctgctt ctgataacaa tgacgcctct gctaatgagg 420
tagaaacgat cgtagagccg tctttagcga cgccttctga cgcaatcgtt gaaccagaag 480
cgccagtagt acctgaaaaa gcacctgtgg cttctgctgt gaatccttgg attccacgcg 540
ttattttatt tttggcacta ttactaccga tttgcgtact gctgtttaca aacccagcgg 600
aatctcagtt ccgtcagatt ggtgagtatc agaatgtacc agtgatgaca cctgtaaatc 660
acccgcaaat aaacaactgg ctgccttcta ttgagcagtg cattgaacgc tacgttaagc 720
accatgcaga agactcgtta ccagtggaag tgattgccac tggcggacaa aataaccagt 780
tgattttgaa ctacattcat gacagcaacc actcgtatga gaacgtgaca ttgcgtattt 840
tcgcaggtca aaatgatcca acagacatct gcaaataaag gaggccagca tgaagattaa 900
agtagcatct gcggttttgg ccgtatctat ccttttcagt ggttggttgt actggggcag 960
tgaccttaaa gttgagcaag tgcttacgtc aaatgaatgg cagtcaacca tggtgactgt 1020
gattactgat aacttgccag acgataccgt aggcccgtta cgtcgagtga atgtggagtc 1080
gaacgttaag tacctaccga atggcgatta cattcgcgtg gcaaacatca aactgttcgc 1140
acaaggctcg acggctgaat cgacaattaa tatttcagag aaaggtcgct gggaagtgag 1200
tgataactat ctgcttgttt ctccttctga gttcaaagat atttcttctt ctcaatccaa 1260
ggatttttct gaagcgcaac tacgcttaat tactcaaatc tttaagctag atgcagaac 1319
Sequence table
＜110〉Shenzhen Taitai Genetic Engineering Co., Ltd.
＜120〉a kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments
<160>3
<170>PatentIn version 3.3
<210>1
<211>27
<212>DNA
＜213〉artificial sequence
<400>1
gcgacctttc tctgaaatat taattgt 27
<210>2
<211>19
<212>DNA
＜213〉artificial sequence
<400>2
cattcgcgtg gcaaacatc 19
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<400>3
cgcacaaggc tcgacggctg a 21
Claims (4)
1. primer sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments, it is characterized in that described primer sequence comprises: by upstream primer vp1231pf sequence is that GCGACCTTTCTCTGAAATATTAATTGT and downstream primer vp1286pr sequence are that the primer formed of CATTCGCGTGGCAAACATC is right, and 10 bases are extended to 5 ' extreme direction in the right upstream primer vp1231pf position of this primer, extend 4 bases to 3 ' extreme direction, 8 bases are extended to 3 ' extreme direction in downstream primer vp1286pr position, the primer sequence that obtains in 5 ' extreme direction extends 10 base zone scopes.
2. the primer sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments according to claim 1 is characterized in that described primer sequence comprises: upstream primer vp1231pf sequence is that GCGACCTTTCTCTGAAATATTAATTGT and downstream primer vp1286pr sequence are CATTCGCGTGGCAAACATC.
3. probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments is characterized in that described probe sequence comprises: by probe vp1259pb sequence is the probe sequence that CGCACAAGGCTCGACGGCTGA extends 8 bases and obtains in 5 ' extreme direction extends 4 base zone scopes to 3 ' extreme direction.
4. the probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments according to claim 3 is characterized in that described probe vp1259pb sequence is CGCACAAGGCTCGACGGCTGA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101208934A CN100557029C (en) | 2005-12-15 | 2005-12-15 | A kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005101208934A CN100557029C (en) | 2005-12-15 | 2005-12-15 | A kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1831140A true CN1831140A (en) | 2006-09-13 |
| CN100557029C CN100557029C (en) | 2009-11-04 |
Family
ID=36993638
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005101208934A Expired - Fee Related CN100557029C (en) | 2005-12-15 | 2005-12-15 | A kind of primer and probe sequence that is used to detect the Vibrio parahaemolyticus nucleotide fragments |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100557029C (en) |
-
2005
- 2005-12-15 CN CNB2005101208934A patent/CN100557029C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN100557029C (en) | 2009-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105316422A (en) | Kit for rapidly detecting pathogeny of acute hepatopancreatic necrosis disease of prawns and application of kit | |
| CN103725776B (en) | ARMS-based method for detecting botryis cinerea SdhB gene H272Y mutation | |
| CN102260744A (en) | Gene detection method for specificity indicating of poultry manure pollution | |
| CN103898108A (en) | Nucleotide specific to Vibrio fluvialis O2, O4, O13, O15 and O18 and application thereof | |
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| CN1831142A (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN1932034A (en) | Roundworm egg detecting real-time fluorescence PCR primer and probe | |
| CN103468806A (en) | Quick detection method for scallop pathogenic vibrio splendidus | |
| CN1749413A (en) | Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence | |
| CN1506468A (en) | PCR test kit for hygrophilous aeromonad and its test method | |
| CN1880472A (en) | Detection kit for pine wood nematode and detection method therefor | |
| CN1834260A (en) | Primer and probe sequence for detecting nucleotide fragment of 0139 group choleraic vibrio | |
| CN1831143A (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus | |
| CN1865937A (en) | Real-time fluorescent quantitative detection method for simultaneous detection of A-type and B-type influenza virus and kit therefor | |
| CN1749414A (en) | Primer for detecting E. coli 0157:H7 nucleotide segment and probe sequence | |
| CN1743459A (en) | Primer for detecting salmonella nucleotide fragment and probe sequence | |
| CN101041853A (en) | Primer, probe and real-time fluorescent PCR reagent case for detecting tobacco black shank bacterium | |
| CN1831141A (en) | Primer and probe sequence for detecting nucleotide fragment of shigella | |
| CN1831140A (en) | Pimer and probe sequence for detecting nucleotide fragment of paratypic hemolytic vibrio | |
| CN1837364A (en) | Real-time fluorescence PCR immobilization kit of wheat dwarf bunt germ (Tilletia controversa kuhn) and its detection method | |
| CN104531860A (en) | Molecular detection method for shigella and application thereof | |
| CN104450929A (en) | Molecular detection method of salmonella and application thereof | |
| CN1932037A (en) | Method of screening transgenic wheat | |
| CN1749412A (en) | Primer for detecting nucleotide segment of jejunum campylobacter and probe sequence | |
| CN1563411A (en) | Kit of testing garlic virus and testing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20091104 Termination date: 20171215 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |