CN102296107A - Primers and kit for detecting vibrio cholerae Serogroup O1 - Google Patents
Primers and kit for detecting vibrio cholerae Serogroup O1 Download PDFInfo
- Publication number
- CN102296107A CN102296107A CN2010102124693A CN201010212469A CN102296107A CN 102296107 A CN102296107 A CN 102296107A CN 2010102124693 A CN2010102124693 A CN 2010102124693A CN 201010212469 A CN201010212469 A CN 201010212469A CN 102296107 A CN102296107 A CN 102296107A
- Authority
- CN
- China
- Prior art keywords
- vibrio cholerae
- group
- primer
- pcr
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides primers and a kit for detecting vibrio cholerae Serogroup O1. The primers are composed of nucleotide sequences disclosed as SEQ ID NO:1-2. The kit contains the primers. The primers and kit provided by the invention can be used for quickly, sensitively and conveniently detecting vibrio cholerae Serogroup O1 through a simple operating procedure; and the invention is simple to operate, and has the advantages of high speed and low cost.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of primer and test kit that is used to detect vibrio cholerae O 1 group.
Background technology
Vibrio cholerae (Vibrio cholerae) belongs to Vibrio, it is the pathogenic bacteria of cholera, cholera is a kind of severe intestinal transmissible disease, it is a kind of food origin disease that the time of spreading is long, range of influence is wide, its typical clinical shows as that diarrhoea, vomiting and the body fluid that causes are thus lost, dewaters, whole body circulatory failure, electrolyte disturbance, hang down potassium syndromes, abdominal cramps even death, be defined as one of transmissible disease of necessary international quarantine by the World Health Organization, " People's Republic of China's law on the prevention and control of infectious diseases " classifies it as should implement " mandatory administration " category A infectious disease.
Cholera enterotoxin (Cholera enterotoxin CT) is the major cause that causes the cholera disease, the regulatory gene that produces enterotoxin genes be positioned at the cholera pathogenicity island (vibrio pathogenicity island, VPI).From cholera eruption and prevalence strain separated, major part has heat-stable thalline (O) antigen and heat labile flagellum (H) antigen.According to O antigen difference, nearly 200 O serotypes vibrio cholerae have been told at present.Before 1992, only two of the O1 group cholera vibrio biotypes (classical biotype and El Tor biotype) have caused seven cholera worlds and have been very popular.In October, 1992, taken place first to break out greatly by the cholera that non-O1 group cholera vibrio causes in India and Bangladesh.
" People's Republic of China's law on the prevention and control of infectious diseases " that on February 21st, 1989 China announces, the transmissible disease of regulation management are divided into first, second, the third three classes, and cholera is one of transmissible disease of two kinds of Class As management.In 2002 the 25th of China national quality supervision and test quarantines general bureau and 26 commands clearly the regulation vibrio cholerae be essential items for inspection.The rapid and precise detection of vibrio cholerae helps its natural popular monitoring and prevention, and strick precaution has certain application value to the bio-terrorism active.
At present to the detection of this bacterium, normally on alkaline agar through selective enrichment, identify by a series of biochemical method the back, wastes time and energy, and generally takes 4-6 consuming time days at least.And vibrio cholerae is under some condition that is not suitable for growing, can form a kind of survival but can not cultivation conditions (viable butnot culturable state, VBNCS), adopt traditional immunological method and biological method all can not comprehensively detect and identify vibrio cholerae.But utilize the method for detection of nucleic acids, even under the situation of not carrying out selective enrichment cultivation and purifying, also can detect evaluation.Therefore, have more advantage based on the detection method of nucleic acid than the method for traditional enrichment culture.
The Taqman fluorescence PCR method is a kind of of nucleic acid detection method, be in amplification reaction system, to add a specific fluorescent probe again in a pair of Auele Specific Primer of adding, use the fluorescent PCR detector of monitoring in real time to detect the technology of target nucleotide sequences.It also has the following advantages: (1) high specificity: " double insurance " of primer and probe, avoid the false positive that detects.(2) highly sensitive: analyze the logarithmic phase of PCR product, self-reacting device is collected fluorescent signal, has avoided many interference from human factor.(3) avoid polluting: totally-enclosed reaction, need not the PCR aftertreatment, avoid polluting, guaranteed result's reliability.(4) realize quantitatively: the utilization standard substance obtain typical curve, carry out accurately quantitatively in conjunction with the Ct value.(5) efficient low-consume: can realize the many inspections of a pipe.(6) easy and simple to handle: online real-time monitoring amplification needn't contact objectionable impurities, operational safety.(7) quick: reaction times＜1.5 hour.Just because of fluorescent PCR has these advantages, be widely used in fields such as microorganism detection, disease surveillance and Clinical Laboratory at present, improved detection efficiency greatly, shortened sense cycle, reduced the detection cost, improved economic and social benefit.
Summary of the invention
The object of the present invention is to provide a kind of primer that is used to detect vibrio cholerae O 1 group, to detect vibrio cholerae O 1 group quickly and easily, this primer is made up of the nucleotide sequence shown in the SEQ ID NO:1-2.
Primer of the present invention can be used to prepare gene chip and/or the test kit that is used to detect vibrio cholerae O 1 group.Wherein said gene chip is preferably microarray chip.
The present invention also provides a kind of gene chip that is used to detect vibrio cholerae O 1 group, and it comprises above-mentioned primer.Wherein said gene chip is preferably microarray chip.
The present invention also provides a kind of test kit that is used to detect vibrio cholerae O 1 group, and it comprises above-mentioned primer.
Test kit of the present invention also comprises probe, and its nucleotide sequence is shown in SEQ ID NO:3.
Test kit of the present invention can also comprise standard substance, positive control, negative control, damping fluid (comprising buffer and dNTP) and archaeal dna polymerase.
The method of using test kit detection vibrio cholerae O 1 group of the present invention is as follows:
(1) DNA of bacteria in the extraction sample to be checked is as template;
(2) in the fluorescent PCR thin-walled tube, add the mixture of damping fluid, primer and probe respectively, add then over against according to, negative contrast or the masterplate DNA that from test sample, extracts, and use ddH
2O supplies certain volume, mixing;
(3) mixture with mixing in the PCR thin-walled tube increases on quantitative real time PCR Instrument;
(4) analysis of fluorescence quantitative result and carry out the result and judge.
But the test kit that a kind of industrialization that detects vibrio cholerae O 1 group of the present invention's preparation is produced, the combination of components that fluorescence PCR detecting method need be used together, during use, extract sample gene group to be checked, simultaneously through comparatively simple operation program just can carry out fast, the consumption and the concentration of each component is the test gained in sensitive, the easy detection, test kit, it is easy and simple to handle to detect vibrio cholerae O 1 group with this test kit, and fast, cost is low.
For above and other objects of the present invention, feature and advantage can be become apparent, preferred embodiment cited below particularly, and conjunction with figs. are described in detail below.
Description of drawings
Fig. 1 is the electrophorogram that bacterium colony PCR identifies the positive colony that contains the rfbH gene;
Fig. 2 is each dilution amplification curve of vibrio cholerae O 1 group standard substance;
Fig. 3 is the typical curve that the vibrio cholerae O 1 group standard substance are worked out;
Fig. 4 is the amplification curve of vibrio cholerae O 1 group;
Fig. 5 is the amplification curve of vibrio cholerae He other vibrios of not somatotype.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the scope of the present invention that limits.In addition, should understand after having read the content that the present invention tells about, those skilled in the art can make various changes or modification to the present invention, and these equivalent form of values belong to the application's claims institute restricted portion equally.
Concrete principle of the present invention is to utilize Auele Specific Primer and a specificity fluorescent probe of a pair of target nucleotide sequences, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.Employed probe is the oligonucleotide of two ends difference mark fluorescent reporter group (R) and fluorescent quenching group (Q).When probe is complete, the reporter group fluorescent signal emitted is absorbed by quenching group, and in the pcr amplification process, 5 ' end 5 prime excision enzyme activity of Taq enzyme is cut degraded with the fluorescent probe enzyme of specific combination on the target nucleotide fragment, the fluorescence report group is free in the reaction system, the shielding effect that has broken away from the fluorescent quenching group, the fluorescent signal of fluorescence report group just can by instrument detecting to, the variation of fluorescent signal amount is directly proportional with the amplified production amount, thereby judges the existence of target nucleotide sequences in the sample to be tested.
The test method of unreceipted actual conditions in the following example is usually according to normal condition, as: " molecular cloning experiment guide " (third edition) (J. Sa nurse Brooker etc. work) or according to the condition of reagent manufacturers instruction.Used inorganic chemistry and organic solvent all meet the molecular biology test requirement.Primer and probe are synthetic by the precious biotech firm in Dalian, and pGEM-T Easy Vector and T4ligase are all available from Promega, and the Taq archaeal dna polymerase is given birth to worker's biotechnology company available from Shanghai, and the fluorescent PCR instrument is 7300 of American AB I.
(the sequential reception number: X59554) of the O antigen gene bunch sequence of the vibrio cholerae O 1 group of announcing according to GeneBank, analyze by functional analysis and protein water transport structure each gene of this O antigen sequence, selecting the rfbH gene of vibrio cholerae O 1 group is target gene, design special primer and probe, primer length is generally about 20 bases, between primer and primer in no complementary sequence.Designed primer and probe all can detect all known vibrio cholerae O 1 group bacterium through the Blast retrieval, do not produce positive findings with other vibrio cholerae serotypes and other bacteriums.Optimum primer, probe sequence make up as follows:
(1) upstream primer of vibrio cholerae O 1 group, its sequence are VCO1F:5-CGTTGCAGATGCTCGAGTATACC-3 (SEQ ID NO:1)
(2) downstream primer of vibrio cholerae O 1 group, its sequence are VCO1R:5-GAAGAATCAGCACGTTCCGATAT-3 (SEQ ID NO:2)
(3) the TaqMan probe of vibrio cholerae O 1 group, its sequence are O1-P:5-CAACCTTTTATGCTTTCAGTCGGTGCTCA-3 (SEQ ID NO:3)
Nucleotide sequence (the SEQ ID NO:4 of the rfbH gene of the following X59554 vibrio cholerae O 1 group of announcing for GeneBank, beginning runic in the following sequence is 531bp to the sequence between the last runic) and the design primer of mark and the design district of probe sequence, wherein the underscore sign is real-time PCR upstream and downstream design of primers district, and italic is TaqMan probe design district.ATGTATTTTTTGGGAATGAAAATGCTTAAAGATATAGTTTCGGTTTTTTATAATTGGCGTATTGTGCATCTATTGGGGGTTTCTACACTTAGAAGTAGATACTCTCGGTCTAAATTTGGACAAACTTGGTTAAGCATCACAATGTTCGTACAAATTCTCTGTATAGGGCTAATTTGGTCTTT
ATGATTATTTACCATATGTCGGTGTTGGACACATAATTTACTTGTTTTATACTCAAACAATTAACGAAAGCACAGGAATCTT
CGTTGCAGATGCTCGAGTATACCTAAATGATAGG
CAT
ATATCGGAACGTGCTGATTCTTCTTCATAATATACCAACCATATTTTTGCTTGTCATATGGTCTAGCTCGGCAAACTTTGAATTTAGTTTTATGTTTGTCATTTCGTTGAGTTTAAGTCTGTTTTTCGTCCTATTTGCTAGCTATTTTTGTGCTGTTATTTCAACGAGATTTAGAGACTTAATCCAGCTGATTGGGCTTTTGATGCAGTTAGCTTTCTTTGTAAGTCCTGTCATGTGGAAAGTAAGCTTTCTACCCGAACAATATCAAAACTATGTGTACATAAATCCATTTGCTTCGCTATTGGAATTAATTAGAAATCCGATAATAGGAATCGACGTTAAT
AGTAGCATGGACTTTTATAATTGGTATGGTCAGCTACTTCTCGTACAAAGTACTCGATAAAAAAGTCATTTTTTGGGTGTAG
The preparation and the demarcation of embodiment 2 vibrio cholerae O 1 group standard substance
(1) pcr amplification purpose band
The sequence amplification that will include real-time PCR primer and probe with PCR method come out (primer sequence is shown in SEQ ID NO:1-2), the PCR response procedures is as follows: 94 ℃ of pre-sex change 5 minutes, 94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute, and carried out 30 circulations; Last 72 ℃ are continued to extend 5 minutes, obtain the PCR product, and the agarose gel electrophoresis with 0.8% detects the size and the specificity thereof of PCR product; Product length is 531bp.The PCR product is cut glue and is reclaimed, and gives birth to the UNIQ-10 pillar DNA glue recovery test kit recovery purified pcr product of worker's biotechnology company with Shanghai.
(2) connect
With 3 * 10 of PCR purified product and Promega company
-3The pGEM-T-Easy carrier connect 24 hours in 4 ℃, cumulative volume is 10 μ l, and the 10 * damping fluid of 1 μ l and the T of 0.5U are wherein arranged
4Dna ligase obtains connecting product.
(3) electricity transforms
Preparation method with the electric transformed competence colibacillus cell of Bio-Rad company prepares the competence e.colidh5, the connection product of getting 2-3 μ l above-mentioned (2) is with after 60 μ l competence bacillus coli DH 5 alphas mix, forward in the electric shock cup of 0.2cm of Bio-Rad company and shock by electricity, voltage is 2.5kv, time is 5.0 milliseconds-6.0 milliseconds, the SOC substratum that adds 1mL after the electric shock immediately in cup makes the bacterium recovery, then bacterium is coated in 37 ℃ of incubated overnight on the LB solid medium that contains penbritin, X-Gal and IPTG, obtains blue white bacterium colony next day.
(4) bacterium colony PCR identifies
The promptly white clone of 4 white colonies of picking carries out bacterium colony PCR evaluation at random.The PCR reaction system is identical with conventional PCR in the same present embodiment of reaction conditions (1).After reaction finishes, get 3 μ l pcr amplification products and carry out the detection of 0.8% agarose gel electrophoresis.Detected result is seen (swimming lane M:DL2000Marker, swimming lane 1-4 are respectively the white colony 1-4 of picking at random) shown in Figure 1, and 4 clones identify the purpose band that 531bp is arranged through PCR as a result, all is correct clone.
(5) plasmid extracts
Get and identify correct positive colony bacterium colony 1 (called after H1981) in above-mentioned (4), it is inoculated in incubated overnight in the LB liquid nutrient medium that contains the ammonia benzyl, adopts SDS alkaline lysis method of extracting plasmid in " molecular cloning test guide " (third edition) (work such as J. Sa nurse Brooker) (PLSCONFM).This plasmid called after PLW1536.
(6) order-checking
With SP6 and T7 primer the PLW1536 plasmid that extracts is checked order, the result shows that the entrained amplified fragments sequence of PLW1536 has the nucleotide sequence of above-mentioned 531bp, show that the rfbH gene of the amplified fragments of the 531bp that PLW1536 is entrained and vibrio cholerae O 1 group sequence to be amplified is in full accord, the plasmid sequence of structure is entirely true.
(7) concentration determination of PLW1536
Get the stoste of 1 μ l PLW1536 and measure OD with NanoDrop OD instrument
260Value, the concentration of the PLW1536 stoste that the result records is 153ng/ μ l, 1 μ l PLW1536 stoste contains 4 * 10
10Individual copy.
10 times of gradient dilutions of PLW1536 stoste are obtained 4 * 10
7, 4 * 10
6, 4 * 10
5, 4 * 10
4, 4 * 10
3Individual copy real-time PCR detects, and 25 μ l reaction systems see the following form 1:
Table 1real-time PCR reaction system
Reaction tubes is put into real-time PCR instrument (ABI7300), and the parameter of setting is as follows:
95 ℃ 2 minutes
95 ℃ 15 seconds
Got back to second step, totally 40 circulations in 1 minute for 60 ℃.
Detect fluorescence in the time of 60 ℃, the selection of instrument detecting passage: when carrying out the fluorescent PCR reaction, the collection of tackling reaction tubes fluorescent signal in the used instrument is provided with, and the fluorescence detection channel of selection is consistent with the fluorescence report group of probe institute mark.Concrete method to set up is different because of instrument, answers reference reagent box working instructions.
Each dilution PLW1536 all can produce the fluorescence quotation marks as a result, and the Ct value is respectively 17.41,20.66,24.05,27.37,30.34, and amplification curve is seen Fig. 2, and quantitative data sees Table 2, and the slope of standard curve that is obtained by amplification curve is-3.257230, R
2Be that 0.999531 typical curve is seen Fig. 3 (Y=-3.257230X+40.252377).
The quantitative data of the different extent of dilution PLW1536 of table 2 quantitative fluorescent PCR
The detection of embodiment 4. vibrio cholerae samples
At first these breadboard 2 strain vibrio cholerae O 1 group bacterial strains being carried out real-time PCR detects, outside the removing template, reaction system, condition and step are all with embodiment 3, amplification curve is seen Fig. 4, quantitative data sees Table 3, its Ct value is followed successively by 19.43 and 23.3, and amplification initial concentration copy number is followed successively by 2480000 and 193709.22.
The quantitative data of the real-time PCR of table 3 vibrio cholerae O 1 group and other vibrios
Then to the laboratory not vibrio cholerae 9 strains of somatotype and other vibrios of 10 strains carry out real-timePCR and detect, with accuracy and the specificity of verifying this method, bacterial strain uses therefor sees Table 3; Method removing template outer (template and each bacterial type coupling) reaction system, reaction conditions and step are all with embodiment 3.Amplification curve is seen Fig. 5, and quantitative data sees Table 3.
Amplification shows, vibrio cholerae G2952, and G2953, G2954 is vibrio cholerae O 1 group, then further identifies with the antiserum(antisera) of vibrio cholerae O 1 group again, and serum test result shows that this three strains bacterium is vibrio cholerae O 1 group really.This shows that the method for above-mentioned foundation is accurate.
Sequence table
＜110〉Tianjin Biochip Technology Co., Ltd
Shanghai Disease Prevention and Control Centre
Shanghai City preventive medicine research institute
＜120〉be used to detect the primer and the test kit of vibrio cholerae O 1 group
<130>9P13004-CN
<160>4
<170>PatentIn?version?3.3
<210>1
<211>23
<212>DNA
＜213〉be used to detect the upstream primer of vibrio cholerae O 1 group
<400>1
cgttgcagat?gctcgagtat?acc 23
<210>2
<211>23
<212>DNA
＜213〉be used to detect the downstream primer of vibrio cholerae O 1 group
<400>2
gaagaatcag?cacgttccga?tat 23
<210>3
<211>29
<212>DNA
＜213〉be used to detect the TaqMan probe of vibrio cholerae O 1 group
<400>3
caacctttta?tgctttcagt?cggtgctca 29
<210>4
<211>531
<212>DNA
＜213〉nucleotide sequence of the rfbH gene of vibrio cholerae O 1 group
<400>4
atgtattttt?tgggaatgaa?aatgcttaaa?gatatagttt?cggtttttta?taattggcgt 60
attgtgcatc?tattgggggt?ttctacactt?agaagtagat?actctcggtc?taaatttgga 120
caaacttggt?taagcatcac?aatgttcgta?caaattctct?gtatagggct?aatttggtct 180
ttaatatgga?gaatgggagt?agatgattat?ttaccatatg?tcggtgttgg?acacataatt 240
tacttgtttt?atactcaaac?aattaacgaa?agcacaggaa?tcttcgttgc?agatgctcga 300
gtatacctaa?atgataggca?accttttatg?ctttcagtcg?gtgctcacat?atatcggaac 360
gtgctgattc?ttcttcataa?tataccaacc?atatttttgc?ttgtcatatg?gtctagctcg 420
gcaaactttg?aatttagttt?tatgtttgtc?atttcgttga?gtttaagtct?gtttttcgtc 480
ctatttgcta?gctatttttg?tgctgttatt?tcaacgagat?ttagagactt?aatccagctg 540
attgggcttt?tgatgcagtt?agctttcttt?gtaagtcctg?tcatgtggaa?agtaagcttt 600
ctacccgaac?aatatcaaaa?ctatgtgtac?ataaatccat?ttgcttcgct?attggaatta 660
attagaaatc?cgataatagg?aatcgacgtt?aatcctttag?catttgtttc?gttagtagca 720
tggactttta?taattggtat?ggtcagctac?ttctcgtaca?aagtactcga?taaaaaagtc 780
attttttggg?tgtag 795
Claims (8)
1. a primer that is used to detect vibrio cholerae O 1 group is characterized in that, is made up of the nucleotide sequence shown in the SEQ IDNO:1-2.
2. the described primer of claim 1 is used for detecting the application of the test kit and/or the gene chip of vibrio cholerae O 1 group in preparation.
3. application according to claim 2 is characterized in that described gene chip is a microarray chip.
4. a test kit that is used to detect vibrio cholerae O 1 group is characterized in that, comprises the described primer of claim 1.
5. test kit according to claim 4 is characterized in that, also comprises probe, and the nucleotide sequence of this probe is shown in SEQ ID NO:3.
6. according to claim 4 or 5 described test kits, it is characterized in that, also comprise standard substance, positive control, negative control, damping fluid and archaeal dna polymerase.
7. a gene chip that is used to detect vibrio cholerae O 1 group is characterized in that, comprises the described primer of claim 1.
8. gene chip according to claim 7 is characterized in that, described gene chip is a microarray chip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102124693A CN102296107A (en) | 2010-06-28 | 2010-06-28 | Primers and kit for detecting vibrio cholerae Serogroup O1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102124693A CN102296107A (en) | 2010-06-28 | 2010-06-28 | Primers and kit for detecting vibrio cholerae Serogroup O1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102296107A true CN102296107A (en) | 2011-12-28 |
Family
ID=45356782
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102124693A Pending CN102296107A (en) | 2010-06-28 | 2010-06-28 | Primers and kit for detecting vibrio cholerae Serogroup O1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102296107A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104769133A (en) * | 2012-11-08 | 2015-07-08 | 霍夫曼-拉罗奇有限公司 | Method of improving microarray performance by strand elimination |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1397649A (en) * | 2002-08-19 | 2003-02-19 | 上海华冠生物芯片有限公司 | Biochip base on 16S rDNA gene for diagnosing frequently encountered pathogenic bacteria |
| CN1831142A (en) * | 2005-12-15 | 2006-09-13 | 深圳太太基因工程有限公司 | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus |
-
2010
- 2010-06-28 CN CN2010102124693A patent/CN102296107A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1397649A (en) * | 2002-08-19 | 2003-02-19 | 上海华冠生物芯片有限公司 | Biochip base on 16S rDNA gene for diagnosing frequently encountered pathogenic bacteria |
| CN1831142A (en) * | 2005-12-15 | 2006-09-13 | 深圳太太基因工程有限公司 | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus |
Non-Patent Citations (1)
| Title |
|---|
| 罗可天等: "O1群和O139群霍乱弧菌荧光PCR 快速检测方法的建立", 《中国热带医学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104769133A (en) * | 2012-11-08 | 2015-07-08 | 霍夫曼-拉罗奇有限公司 | Method of improving microarray performance by strand elimination |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN105112519A (en) | CRISPR-based Escherichia coli O157:H7 strain detection reagent box and detection method | |
| CN103468811B (en) | Yersinia enterocolitica virulence gene multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit | |
| CN102586438A (en) | LAMP-based (loop-mediated isothermal amplification-based) visual fluorogenic and chromogenic genetic testing method for microorganisms | |
| CN106967816A (en) | Detect the RPA specific primers of vibrio parahaemolytious and kit and application in food | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN109680079A (en) | Detect RPA primer, probe, kit and the method for vibrio parahemolyticus | |
| CN105400778A (en) | Kit capable of detecting 10 pathogenic vibrios simultaneously and detection method | |
| CN107746890A (en) | Identify the multiple PCR detection primer and method of Listeria monocytogenes serotype | |
| CN102925548B (en) | Actinobacillus pleuropneumoniae LAMP kit and application method thereof | |
| CN104694620A (en) | LAMP (loop-mediated isothermal amplification) and primer set adopted molecular detection method of a variety of microorganisms | |
| CN101974630A (en) | Fluorescent quantitative RT-PCR detection method of M.tuberculosis-complex | |
| CN110923343A (en) | Isothermal amplification primer group and kit for rapidly detecting salmonella pullorum | |
| CN101974644A (en) | Staphylococcus aureus enterotoxin gene PCR (Polymerase Chain Reaction) parting detection kit and method | |
| CN111057775B (en) | Specific novel molecular target for identifying salmonella and rapid detection method thereof | |
| CN105603091B (en) | A kind of comma bacillus multiple fluorescence PCR detection reagent box and its preparation and application | |
| CN115747361B (en) | Real-time fluorescence MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN100386442C (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN102676653A (en) | Non-diagnostic method for detection of O1 group and O139 group of vibrio cholerae through double TaqMan probe fluorescence RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
| CN102296107A (en) | Primers and kit for detecting vibrio cholerae Serogroup O1 | |
| CN102312013B (en) | Primers and probes for detecting 89K pathogenicity island genes of Streptococcus suis serotype 2, real-time fluorescence quantitative PCR method and kit thereof | |
| CN102533967B (en) | Reagent kit and method for detecting multiple real-time fluorescent quantitative polymerase chain reaction (PCR) of vibrio cholerae toxin genes | |
| CN100395350C (en) | Prime and probe sequence for detecting nucleotide fregment of comma bacillus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20111228 |