CN1807629A - Authentication and uses of adversity specificly induced two-directional expression activity rice promotor CPIP - Google Patents

Abstract

The invention discloses a promotor CPIP from Oryza Sativa L in the plant genetic engineering domain, which is characterized by the following: the promotor CPIP possesses SEQ ID NO: 1 with nucleic acid sequence, which controls two alfapsin inhibition sub-genes simultaneously; the alfapsin inhibition sub-gene is controlled by promotor CPIP in backward-forward direction, which makes answering reaction with arid, salt-forced and abscisic acid(ABA); the promotor region contains a plurality of hostile environment answering cis-form appliance elements; the promotor CPIP controls GUS report gene in backward-forward direction to converse rice; the GUS gene is induced and expressed strongly in the condition of arid and salt-forced.

Description

Special evaluation and the utilization of inducing the active rice starter CPIP of two-way expression of adverse circumstance

Technical field

The invention belongs to the plant gene engineering technology field.Relate in particular to the isolation identification and the application of the special evoked promoter of a kind of plant adverse circumstance.This promotor is named as CPIP, is induced by arid or salt and has two-way abduction delivering activity, is applied to the genetic transformation of plant stress-resistance gene especially for important crop adversity gene, reaches the purpose that improves stress resistance of plant.

Background technology

Paddy rice is one of most important food crop, and China is first kind of rice big country in the world.Rice yield and quality in abiotic stress (arid, damage to plants caused by sudden drop in temperature with the soil salinization etc.) serious threat.When facing environment stress; many signal transduction systems of plant are unlocked; a collection of response gene is induced; regulatory gene (transcription factor, protein kinase etc. the) (Xiong etc. that comprise the functional protein gene (osmoregulation material, antioxidant, functional protein etc.) that directly shields and in signal transmission and stress response genetic expression, play regulating effect; Cell signaling during cold; droughtand salt stress.Plant Cell.14 (suppl); S165-S183,2002).Although existing bibliographical information has separated a large amount of anti contravariance related genes from plant and in plant these gene pairss of overexpression improve stress resistance of plant certain effect (Thomashow etc. arranged, Plant coldacclimation:Freezing tolerance genes and regulatory mechanisms.Annu.Rev.Plant Physiol.PlantMol Biol 50:571-599,1999; Shinozaki etc., Molecular response to dehydration and low temperature:Differences and cross-talk between two stress signaling pathways.Curr Opin Plant Biol 3:217-223.2000; Saijo etc., Over-expression of a single Ca ²⁺-dependent protein kinase confers both cold andsalt/drought tolerance on rice plants.Plant J 23:319-327,2000; Kim etc., CIPK3, a calciumsensor-associated protein kinase that regulates abscisic acid and cold signal transduction inArabidopsis.Plant Cell 15:411-423,2003), but overexpression tends to produce some negative influences, as influence the original yield potential of plant or cause the lethal effect or the intensive multiple-effect (Shavindra etc. of transfer-gen plant, Transgenic approaches toincrease dehydration-stress tolerance in plants.Mol Breed 5:493-503,1999).The expression that utilizes the adverse circumstance inducible promoter to control adversity gene more and more comes into one's own, the promotor that some adverse circumstances are replied, as SalT promotor (Garcia etc., Theexpression of the salt-responsive gene salT from rice is regulated by hormonal and developmentalcues, Planta.207:172-180,1998), RD29A promotor (Yamaguchi-Shinozaki etc., Characterization ofthe expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and analysis of itspromoter in transgenic plants.Mol Gen Genet 23:331-340,1993; Kasuga etc., A combination of theArabidopsis DREB1A gene and stress-inducible rd29A promoter improved drought-and low-temperaturestress tolerance in tobacco by gene transfer.Plant Cell Physiol 45:346-350,2004), HVA1 promotor (Xu etc., Expression of a late embryogenesis abundant protein gene, HVA1, from barley conferstolerance to water deficit and salt stress in transgenic rice.Plant Physiol 110:249-257,1996; Ho and Wu etc., Production of water stress or salt stress tolerant transgenic cereal plants USpatent, US5981842,1999) also identified out and attempted in the degeneration-resistant improvement of some crops, using.But promotor of having identified or specificity strong (being that the non-expression amount of inducing under the situation is higher), or induce intensity not high, make actual using value have a greatly reduced quality.On the other hand, for the consideration of biological safety, press for condition induction type (inducing) promotor especially and come selection markers expression of gene in the control of heredity conversion process as salt.In addition, because nearly all promotor that is used for genetic transformation expression activity of all having only folk prescription to make progress up to the present; Even indivedual promotors have expression activity at other direction, but do not have actual application value owing to activity is very low usually.Have the active promotor of bidirectional strength abduction delivering and not only when making up the genetic transformation carrier, can reduce the external source number of fragments, and can be used to control polygenic vector construction and the conversion that needs coordinate expression just can work.But still there are not the evaluation of the active promotor of bidirectional strength abduction delivering and the report that in genetic transformation, utilizes up to now.

The present invention be identify the rice protein enzyme of adverse circumstance induced strong such as salt and arid suppress subbase because of promotor, it is active and control a proteolytic enzyme respectively and suppress sub-expression of gene that this promotor has the strong abduction delivering of two-way adverse circumstance.By the promoter activity analysis, will have the active promotor section of the strong abduction delivering of two-way adverse circumstance and be used for regulating and control the expression of selection markers gene and adversity gene (or controlling a plurality of adversity genes simultaneously), thereby improve the resistance of plant effectively in paddy rice.

Summary of the invention

The objective of the invention is clone, a salt of evaluation and arid induced strong and have the active plant endogenous promotor of two-way expression, and utilize this promotor to make up the expression vector of anti contravariance related gene, reach the resistance that improves plant by genetic transforming method.

The present invention is achieved through the following technical solutions:

At first be separated salt and arid induced strong expression promoter.Isolating salt and arid induced strong expression promoter (sequence of this promotor is shown in SEQ ID NO:1) derive from paddy rice.The paddy rice native gene of this promotor control is two members that Chymotrypsin suppresses son (ChymotrypsinProteinase inhibitor) family, and promptly these two gene differential concatenations are arranged and are subjected to have the active promotor control of two-way expression (as shown in Figure 2) jointly.This promotor called after CPIP (Chymotrypsin Proteinase Inhibitor Promoter).These two genes are called after OsCPI1 (GenBank accession number AY878695) and OsCPI2 (GenBank accession number AY878694) respectively, and they can both be by arid, high-salt stress, damage to plants caused by sudden drop in temperature and dormin (ABA) is induced (as shown in Figure 3).The nucleotide sequence of this promotor CPIP is shown in SEQ ID NO:1,1893 bases of sequence total length, according to existing bibliographical information, Skriver etc. for example, Cis-acting DNA elements responsive togibberellin and its antagonist abscisic acid.Proc Natl Acad Sci USA.88:7266-7270.1991; Simpson etc., Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene functionin induction by dehydration stress and dark-induced senescence.Plant J 33:259-270,2003 and Urao etc., An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to theconserved MYB recognition sequence.Plant Cell 5:1529-1539,1993; Abe etc., Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signalling.Plant Cell15:63-78,2003, we learn wherein at 307-311,423-427,571-575, the relevant ABA response element ABRELATERD1 of adverse circumstance is contained in 1173-1177 base position, and at base position 325-330,801-806,878-883,1384-1389,1849-1854 contain MYB class transcription factor bonded arid and reply cis-acting elements.

Promotor CPIP provided by the present invention contains in the zone the relevant cis-acting elements (as shown in Figure 1) of a plurality of adverse circumstances, can play responsing reaction to adverse circumstance and ABA specifically.The applicant utilizes the forward of promotor CPIP and the reverse inducible expression's carrier pCAMBIA1391Z-CPIP (as shown in Figure 4) that makes up can induce reporter gene GUS consumingly when plant is subjected to environment stress expression (shown in Fig. 5,6,7).Effect of the present invention sees embodiment for details.

More detailed technical scheme is as described below:

A kind ofly induced by arid or salt and have the active promotor CPIP of two-way abduction delivering, its nucleotide sequence is shown in SEQ ID NO:1.Specifically it is the sequence shown in the 1-1893 bit base shown in the SEQ ID NO:1.

As described in accompanying drawing 1, (CAAT-box for example TATA-box), also comprises a plurality of adverse circumstances and replys cis-acting elements (ACGTATERD1 for example except that containing basic promoter element in the zone of above-mentioned promoter sequence, ABRELATERD1, MYB1AT and MYBCORE) combination.

The applicant becomes a kind of plant expression vector pCAMBIA1391Z-CPIP (as described in accompanying drawing 4) with all or part of sequence construct of described promotor CPIP, by agriculture bacillus mediated genetic transforming method with described plant expression vector pCAMBIA1391Z-CPIP rice transformation Cultivar plant, obtain the transgenic rice plant of salt tolerant or drought resisting, thereby finished the present invention.

Promotor of the present invention can be by the adversity resistant plant material of genetic transformation cultivation.The material of described adversity resistant plant is meant plant, seed or cell clone.

According to above technical scheme, obviously, the expression vector that beyond applicant or the applicant other people can utilize promotor CPIP provided by the present invention to make up anti contravariance related gene transforms plant to improve the resistance of plant.Recipient plant can be the cereal crop that comprises paddy rice, wheat, corn etc., can certainly comprise some other important cash crop, for example the application on corn, cotton, rape or the tomato crop.

Description of drawings

Sequence table SEQ ID NO:1 discloses the sequence of the present invention clone's rice starter CPIP.

Fig. 1: demonstration be promotor CPIP sequence.The underscore sequence is the used primer sequence of amplification promotor CPIP.What shade showed is basic promoter element sequence.The adverse circumstance response element core sequence of ABRE class is represented with text box.MYB class adverse circumstance response element sequence is represented with wavy line.

Fig. 2: the position relation in rice genome (it is long-armed to be positioned at first dyeing, adds red frame) that is promotor CPIP with OsCPI1 and two genes of OsCPI2 of demonstration.Promotor CPIP has comprised OsCPI1 and two genes of OsCPI2 first exon separately to guarantee transcriptional activity.

Fig. 3: demonstration be that OsCPI1 and OsCPI2 gene can be by multiple adverse circumstance (arid, 200mM/L NaCl, 100 μ M/L ABA) abduction deliverings.

Fig. 4: be the expression vector pCAMBIA1391Z-CPIP physical map that the present invention makes up.This carrier contains Totomycin (HRG) resistance screening gene, and promotor CPIP is fused to gus gene 5 ' end non-translational region.Primer CPIP-F/M13F is if can amplify about 1900bp fragment, and promptly the CPIP forward is connected into; Otherwise CPIP is reversed and is connected into.

Fig. 5: demonstration be the abduction delivering of promotor CPIP forward control gus gene down under the drought stress processing.After the rice conversion plant arid of CPIP-GUS fusion gene was handled, by the point in time sampling that marks among the figure, Northern detected the variation (A) of GUS expression amount and the gus protein activity (B) of quantitative assay corresponding plants sampling spot.Wild-type plant (CK) is a drought stress in soil with positive transformed plant b; Positive plant a exposes drought stress in the air after blotting root moisture.

Fig. 6: demonstration be reporter gene GUS transgenic paddy rice GUS expression amount (A) and GUS activation analysis (B) in high salt (200mM/L NaCl) lower blade under the promotor CPIP forward control.Among the figure: CK is the wild-type contrast, and a, b are two independent transformed plants.

Fig. 7: demonstration be CPIP oppositely control reporter gene GUS transgenic paddy rice down coerce GUS expression amount (A) and GUS activation analysis (B) in the lower blade at arid, high salt (200mM/L NaCl).Ck1: arid is handled the wild-type plant; (a): arid is handled transformed plant; Ck2:NaCl handles the wild-type plant; (b): NaCl handles transformed plant.

Embodiment

Embodiment 1, promotor CPIP separate and identify

Drought-induced gene expression spectrum analysis by rice varieties " middle non-irrigated No. 5 " (commercial variety that provides by Chinese Shanghai Academy of Agricultural Sciences), found a cDNA who is subjected to arid induced strong (drought stress later stage expression amount improves more than 12 times), through sequential analysis determine this cDNA be Chymotrypsin of complete full-length cDNA coding suppress subbase because of, accession number is AY878695 in the GenBank database; Analyzing for convenient, is this unnamed gene OsCPI1.Dna sequence dna with OsCPI1 is searched the rice genome sequence, exists a sequence similarity to reach 82% homologous gene (called after OsCPI2) in the position from about 1118 base pairs of this gene, and its transcriptional orientation is opposite with OsCPI1.In KOME database (http://cdna01.dna.affrc.go.jp/cDNA/), find a full-length cDNA to be numbered AK062495 with this OsCPI2 sequence 100% coupling.

At known OsCPI1 and OsCPI2 is two transcriptional orientation opposites and only at interval on the basis of the gene of 1118bp, next step is exactly to separate the common promotor that may control these two genes.Concrete steps are as follows: carry out pcr amplification according to the OsCPI1 full length cDNA sequence has found the genome sequence (the GenBank accession number is AP002866) of corresponding japonica rice " Japan fine " and chosen this gene transcription initiation site upstream 2Kb in GeneBank scope as candidate's promoter region.Design primer: CPIP-F ( GGATCCGCTTGCTGTCTGATGAACTC) and CPIP-R ( GGATCCAAACAATCGAGAAGATCCAA) the italic underscore is represented the restriction enzyme site BamHI that adds.At first utilize primer CPIP-F, CPIP-R with (the CTAB method extracting of the fine genomic dna of Japan, with reference to reported method such as Zhang: genetic diversity anddifferentiation of indica an japonica rice detected by RFLP analysis, 1992, Theor Appl Genet, 83,495-499) increase for template, reaction conditions is: 94 ℃ of pre-sex change 5min; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 2mim, 30 circulations; 72 ℃ are extended 10min.The PCR product digs through 1.2% agarose gel electrophoresis and is connected on the pGEM-T Easy carrier after glue reclaims, screening positive clone and order-checking (ABI3730 sequenator, Applied Biosystem, order-checking is finished at national plant gene center [Wuhan]), the result confirms: institute's extension increasing sequence is the back mover CPIP sequence of expection, and it comprises a plurality of droughts, the ABA adverse circumstance is replied cis-acting elements (as Fig. 1).

The abduction delivering of embodiment 2, detection paddy rice native gene OsCPI1 and OsCPI2

With rice varieties " precious Shan 97 " (China extensively promotes the rice varieties of cultivation) is material, carries out arid, high-salt stress and dormin (ABA) respectively in 3 leaf phases and handles.It is rice seedling root moisture to be blotted be exposed in the air in 0h that arid is handled, 30min, and 2h, 4h, the 6h sampling, high-salt stress is that the seedling kind of planting in the soil is poured in the 200mM NaCl solution and at 0h, 3h, 1h takes a sample behind the 3d.It is that the seedling root is immersed in the 100 μ M ABA solution and at 0h that ABA handles, 30min, and 3h, 6h takes a sample behind 24h and the 72h.Extract blade total RNA (Trizol reagent, carry out after Invitrogen) RNA change film (with reference to J. Sa nurse Brooker etc., the molecular cloning experiment guide, the third edition, Jin Dongyan etc. (translating), Science Press, and be respectively probe with OsCPI1, OsCPI2 and do Northern hybridization 2002, Beijing).The result shows that OsCPI1, OsCPI2 all can be by arid, high salt and ABA abduction deliverings (as Fig. 3).

The drought-induced activity identification of embodiment 3, promotor CPIP

Embodiment of the present invention are exactly to make up the gus gene expression vector of promotor CPIP and be transformed into the drought-induced expression activity that detects promotor CPIP in the rice varieties " in spend 11 " (from crop investigations institute of Chinese Academy of Agricultural Sciences commercial variety) quantitatively.Concrete operations are as follows:

At first the PCR product with isolating promotor CPIP among the embodiment 1 is connected into pGEM-T Easy carrier (available from Promega company), transformed into escherichia coli DH10B (available from Promega company) and blue hickie screening positive clone.Because adding the BamHI restriction enzyme site during design primer, connect the multiple clone site acquisition reporter gene expression carrier pCAMBIA1391Z-CPIP-GUS (infer its forward, oppositely all might realize) that product is connected into expression vector pCAMBIA1391Z (from the carrier of CAMBIA public use, carrier contains gus reporter gene) by single endonuclease digestion.After cutting checking positive colony determines that fragment is connected in the carrier by enzyme, do pcr amplification reaction by universal primer M13F on the pCAMBIA1391Z carrier and designed primer CPIP-F (sequence is with embodiment 1) again, determine that promotor CPIP is connected into the positive and negative directivity of expression vector (seeing Figure of description 4 for details) in the carrier.Positive and negative two direction reporter gene expression carriers are imported to by agriculture bacillus mediated rice genetic transformation system respectively spend in 11 in the rice varieties, through the callus of cultivating in advance, infecting, cultivating altogether, screening having hygromycin resistance, break up, take root, practice transplantation of seedlings, obtain transfer-gen plant.Agriculture bacillus mediated paddy rice (japonica rice subspecies) genetic conversion system is mainly used people's reported method such as Hiei (referring to Efficienttransformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of theT-DNA, 1994, Plant Journal 6:271-282) is optimized on the basis.The method of the key step of genetic transformation of the present invention, substratum and preparation thereof is as described below:

(1) reagent and solution abbreviation

The abbreviation of the used plant hormone of substratum is expressed as follows among the present invention: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (Casein Enzymatic Hydrolysate, caseinhydrolysate); HN (HygromycinB, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (N6 macroelement composition solution); N6mix (N6 trace element composition solution); MSmax (MS macroelement composition solution); MSmix (MS trace element composition solution)

(2) main solution formula

1) N6 substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation):

Saltpetre (KNO ₃) 28.3 grams

Potassium primary phosphate (KH ₂PO ₄) 4.0 grams

Ammonium sulfate ((NH ₄) ₂SO ₄) 4.63 grams

Sal epsom (MgSO ₄7H ₂O) 1.85 grams

Calcium chloride (CaCl ₂2H ₂O) 1.66 grams

Mentioned reagent is dissolved one by one, be settled to 1000 milliliters with distilled water under the room temperature then.

2) N6 substratum trace element mother liquor (is prepared according to 100 times of concentrated solutions (100X)

Potassiumiodide (KI) 0.08 gram

Boric acid (H ₃BO ₃) 0.16 gram

Manganous sulfate (MnSO ₄4H ₂O) 0.44 gram

Zinc sulfate (ZnSO ₄7H ₂O) 0.15 gram

Mentioned reagent is at room temperature dissolved and be settled to 1000 milliliters with distilled water.

3) molysite (Fe ₂EDTA) stock solution (according to the preparation of 100X concentrated solution)

With 3.73 gram b diammonium disodium edta (Na ₂EDTA2H ₂O) and 2.78 the gram FeSO ₄7H ₂O dissolves respectively, mixes and is settled to 1000 milliliters with distilled water, bathes 2 hours to 70 ℃ of temperature, and 4 ℃ of preservations are standby.

4) VITAMIN stock solution (according to the preparation of 100X concentrated solution)

Nicotinic acid (Nicotinic acid) 0.1 gram

VITMAIN B1 (Thiamine HCl) 0.1 gram

Vitamin B6 (Pyridoxine HCl) 0.1 gram

Glycine (Glycine) 0.2 gram

Inositol (Inositol) 10 grams

Adding distil water is settled to 1000 milliliters, and 4 ℃ of preservations are standby.

5) MS substratum macroelement mother liquor (MSmax mother liquor) (according to the preparation of 10X concentrated solution)

Ammonium nitrate (NH ₄NO ₃) 16.5 grams

Saltpetre 19.0 grams

Potassium primary phosphate 1.7 grams

Sal epsom 3.7 grams

Calcium chloride 4.4 grams

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

6) MS substratum trace element mother liquor (MSmin mother liquor) (according to the preparation of 100X concentrated solution)

Manganous sulfate (MnSO ₄4H ₂O) 2.23 grams

Zinc sulfate (ZnSO ₄7H ₂O) 0.86 gram

Boric acid (H ₃BO ₃) 0.62 gram

Potassiumiodide (KI) 0.083 gram

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.025 gram

Copper sulfate (CuSO ₄5H ₂O) 0.0025 gram

Cobalt chloride (CoCl ₂6H ₂O) 0.0025 gram

Mentioned reagent is at room temperature dissolved, and be settled to 1000 milliliters with distilled water.

7) 2, the preparation of 4-D stock solution (1 mg/ml):

Weigh 2,100 milligrams of 4-D dissolved 5 minutes with 1 milliliter of 1N potassium hydroxide, added then to be settled to 100 milliliters after 10 ml distilled waters dissolve fully, preserved under room temperature.

8) preparation of 6-BA stock solution (1 mg/ml):

Weigh 100 milligrams of 6-BA,, be settled to 100 milliliters, room temperature preservation after adding the dissolving fully of 10 ml distilled waters then with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes.

9) preparation of naphthylacetic acid (NAA) stock solution (1 mg/ml):

Weigh 100 milligrams of NAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.

10) preparation of indolylacetic acid (IAA) stock solution (1 mg/ml):

Weigh 100 milligrams of IAA, with 1 milliliter of 1N potassium hydroxide dissolving 5 minutes, be settled to 100 milliliters after adding the dissolving fully of 10 ml distilled waters then, 4 ℃ of preservations are standby.

11) preparation of glucose stock solution (0.5 grams per milliliter):

Weigh glucose 125 grams, be settled to 250 milliliters with dissolved in distilled water then, the back 4 ℃ of preservations of sterilizing are standby.

12) preparation of AS stock solution:

Weigh AS 0.392 gram, add 10 milliliters of dissolvings of DMSO, divide to be filled in 1.5 milliliters of centrifuge tubes, 4 ℃ of preservations are standby.

13) 1N potassium hydroxide stock solution

Weigh potassium hydroxide 5.6 grams, be settled to 100 milliliters with dissolved in distilled water, room temperature preservation is standby.

(3) be used for the culture medium prescription that rice genetic transforms

1) inducing culture

100 milliliters in N6max mother liquor (getting the 10X concentrated solution that has prepared, down together)

10 milliliters in N6mix mother liquor (getting the 100X concentrated solution that has prepared, down together)

Fe ²⁺10 milliliters of EDTA stock solutions (getting the 100X concentrated solution that has prepared, down together)

10 milliliters of VITAMIN stock solutions (getting the 100X concentrated solution that has prepared, down together)

2,2.5 milliliters of 4-D stock solutions (get above-mentioned prepare)

Proline(Pro) (Proline) 0.3 gram

CH 0.6 gram

Sucrose 30 grams

Phytagel 3 gram adding distil waters to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boil and be settled to 1000 milliliters, divide and install to 50 milliliters of triangular flasks (25 milliliters/bottle), sterilization according to a conventional method after sealing (for example sterilized 25 minutes down for 121 ℃, following medium sterilization method is identical with the sterilising method of basal culture medium).

2) subculture medium

100 milliliters in N6max mother liquor (10X)

10 milliliters in N6mix mother liquor (100X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

10 milliliters of VITAMIN stock solutions (100X)

2,2.0 milliliters of 4-D stock solutions

Proline(Pro) 0.5 gram

CH 0.6 gram

Sucrose 30 grams

Phytagel 3 gram adding distil waters to 900 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000 milliliters, divides to install to 50 milliliters of triangular flasks (25 milliliters/bottle), seal, as stated above sterilization.

3) pre-culture medium

12.5 milliliters in N6max mother liquor (10X)

1.25 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.75 milliliter of 4-D stock solution

CH 0.15 gram

Sucrose 5 grams

Agar powder 1.75 gram adding distil waters to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/ware) in the culture dish are poured in packing into.

4) be total to substratum

12.5 milliliters in N6max mother liquor (10X)

1.25 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.75 milliliter of 4-D stock solution

CH 0.2 gram

Sucrose 5 grams

Agar powder 1.75 gram adding distil waters to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5 milliliters of glucose stock solutions and 250 microlitre AS stock solutions, (25 milliliters/every ware) in the culture dish are poured in packing into.

5) suspension culture base

5 milliliters in N6max mother liquor (10X)

0.5 milliliter in N6mix mother liquor (100X)

Fe ²⁺0.5 milliliter of EDTA stock solution (100X)

1 milliliter of VITAMIN stock solution (100X)

2,0.2 milliliter of 4-D stock solution

CH 0.08 gram

Sucrose 2 gram adding distil waters to 100 milliliter are regulated pH value to 5.4, divide in the triangular flask that installs to two 100 milliliters, seal, as stated above sterilization.Add 1 milliliter of aseptic glucose stock solution and 100 microlitre AS stock solutions before using.

6) select substratum

25 milliliters in N6max mother liquor (10X)

2.5 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

2,0.625 milliliter of 4-D stock solution

CH 0.15 gram

Sucrose 7.5 grams

Agar powder 1.75 gram adding distil waters to 250 milliliter are regulated pH value to 6.0, seal, as stated above sterilization.Dissolving substratum before using adds 250 microlitre HN (50 mg/ml) and (25 milliliters/ware) in the culture dish are poured in 400 microlitre CN (250 mg/ml) packing into.(annotate: selecting substratum Pyocianil concentration for the first time is 400 mg/litre, and selecting substratum Pyocianil concentration for the second time and later on is 250 mg/litre).

7) break up substratum in advance

25 milliliters in N6max mother liquor (10X)

2.5 milliliters in N6mix mother liquor (100X)

Fe ²⁺2.5 milliliters of EDTA stock solutions (100X)

2.5 milliliters of VITAMIN stock solutions (100X)

0.5 milliliter of 6-BA stock solution

0.5 milliliter of KT stock solution

NAA stock solution 50 microlitres

IAA stock solution 50 microlitres

CH 0.15 gram

Sucrose 7.5 grams

Agar powder 1.75 gram adding distil waters to 250 milliliter, 1N potassium hydroxide is regulated pH value to 5.9, seals, as stated above sterilization.Dissolving substratum before using, 250 microlitre HN (50 mg/ml), 250 microlitre CN (250 mg/ml), (25 milliliters/ware) in the culture dish are poured in packing into.

8) division culture medium

100 milliliters in N6max mother liquor (10X)

10 milliliters in N6mix mother liquor (100X)

Fe ²⁺10 milliliters of EDTA stock solutions (100X)

10 milliliters of VITAMIN stock solutions (100X)

2 milliliters of 6-BA stock solutions

2 milliliters of KT stock solutions

0.2 milliliter of NAA stock solution

0.2 milliliter of IAA stock solution

CH 1 gram

Sucrose 30 grams

Phytagel 3 gram adding distil waters to 900 milliliter, 1N potassium hydroxide is regulated pH value to 6.0.Boil and be settled to 1000 milliliters, divide to install to 50 milliliters of triangular flasks (50 milliliters/bottle), seal, as stated above sterilization with distilled water.

9) root media

50 milliliters in MSmax mother liquor (10X)

5 milliliters in MSmix mother liquor (100X)

Fe ²⁺5 milliliters of EDTA stock solutions (100X)

5 milliliters of VITAMIN stock solutions (100X)

Sucrose 20 grams

Phytagel 3 gram adding distil waters to 900 milliliter are with 1N potassium hydroxide adjusting pH value to 5.8.Boil and be settled to 1000 milliliters, divide to install to (25 milliliters/pipe) in the pipe of taking root, seal, as stated above sterilization with distilled water.

(4) agriculture bacillus mediated genetic transformation step

3.1 callus of induce

(1) will spend 11 rice paddy seeds to shell in sophisticated, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes;

(2) wash seed 4-5 time with sterilization;

(3) seed is placed on the inducing culture;

(4) postvaccinal substratum is placed dark place cultivate 4 weeks, 25 ± 1 ℃ of temperature.

3.2 callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the subculture medium.

3.3 pre-the cultivation

Select the embryo callus subculture of consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the pre-culture medium.

3.4 Agrobacterium is cultivated

1) (the LA culture medium preparation is with reference to J. Sa nurse Brooker etc. having the LA substratum that corresponding resistance selects, the molecular cloning experiment guide, the third edition, Jin Dongyan etc. (translating), Science Press, 2002, Beijing) went up the pre-Agrobacterium EHA105 of cultivation (this bacterial strain is from the agrobacterium strains of CAMBIA company public use) two days, 28 ℃ of temperature;

2) Agrobacterium is transferred in the suspension culture base, cultivated 2-3 hour on 28 ℃ of shaking tables.

3.5 Agrobacterium is infected

1) pre-incubated callus is transferred in the bottle of the bacterium of having gone out;

2) regulate the suspension of Agrobacterium to OD ₆₀₀.8-1.0;

3) callus was soaked in agrobacterium suspension 30 minutes;

4) shifting callus blots to the good filter paper of sterilization; Be placed on then on the common substratum and cultivated temperature 19-20 ℃ 3 days.

3.6 callus washing and selection are cultivated

1) aqua sterilisa washing callus is to cannot see Agrobacterium;

2) be immersed in the aqua sterilisa that contains 400 milligrams/L Pyocianil (CN) 30 minutes;

3) shifting callus blots to the good filter paper of sterilization;

4) shift callus to selecting to select on the substratum cultivation 2-3 time, each 2 weeks.

3.7 differentiation

1) kanamycin-resistant callus tissue is transferred on the pre-differentiation substratum in dark place cultivation 5-7 days;

2) callus that shifts pre-differentiation cultivation is to division culture medium, and illumination is cultivated down, 26 ℃ of temperature.

3.8 take root

1) cuts the root that differentiation phase produces;

Then it is transferred to and cultivates 2-3 week, 26 ℃ of temperature in the root media under the illumination.

3.9 transplant

Wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.

The applicant adopts pCAMBIA1391Z-CPIP carrier (Fig. 4) rice transformation of structure.The resistant plant that produces is carried out arid, high-salt stress, and the gus protein activity is estimated promotor CPIP and is subjected to environment stress to induce intensity in the plant after coercing by detection.It is with adding 200mM NaCl in the water planting liquid of cultivation paddy rice resistant plant that wherein high salt is handled; Arid is handled and sampling method carries out with reference to embodiment 2.Each concentration of element of water planting nutrient solution: N:40ppm; P:10ppm; K:40ppm; Ca:40ppm; Mg:40ppm; Mn:0.5ppm; Mo:0.05ppm; B:0.2ppm; Zn:0.01ppm; Cu:0.01ppm; Fe:2ppm.

To contrast with coercing back each time point institute sample thief of plant and in liquid nitrogen, clay into power, be divided into two pipes.(Trizol reagent, Invitrogen), change behind the film with the gus gene is that probe carries out the expression that the reporter gene of promotor CPIP control behind the environment stress is analyzed in Northern hybridization (method is with embodiment 2) to one pipe extracting RNA.Corresponding another pipe sample extracts damping fluid (50mM Na by GUS ₂HPO4, pH7.0,10mM β-mercaptoethanol, 10mM Na ₂EDTA, 0.1%Sarkosyl, 0.1%Triton-100) extracting protein is got 10 μ l and is carried out the active quantitative analysis of GUS from sample protein matter extract.Concrete operations are as follows: 10 μ l sample protein matter extracts+0.4mlGUS are extracted damping fluid+10 μ l 40mM substrate MUG, and (4-methylumbelifferyl-β-D-glucuronide) adds 1.6ml reaction terminating liquid (0.2M Na behind 37 ℃ of water-bath 20min ₂CO ₃); After the DyNA Quant 200 photofluorometers zeroings, the absorbance value that goes out of 50nM MU is decided to be 500 as reference, measure this 2ml reaction solution reaction the relative fluorescence absorption value of the 4-MU that generates (4-methylumbelifferyl); Then to the gross protein of each sample by the Bradford method (referring to A rapid and sensitive method for the quantitation of microgram quantitiesof protein utilizing the principle of protein-dye binding.1976, Anal Biochem 72:248-254) carries out measurement of concetration so that the active relative value of the GUS of each sample is compared analysis.Comprehensive above data draw the active absolute value of GUS (pmol MU/min/mg protein) of each sample.

Northern hybridization and gus protein determination of activity by GUS in the p1391Z-CPIP transformed plant find that positive and negative two directions of promotor CPIP all possess arid of being subjected to and high salt abduction delivering activity.In p1391Z-CPIP forward transformed plant, promotor presents gradient ascendant trend (accompanying drawing 5) under drought stress, and high-salt stress is after 6 hours, and the GUS activity of promotor forward control is three times (accompanying drawings 6) before coercing.Simultaneously, the GUS expression amount under promotor CPIP oppositely controls also is subjected to arid, high salt induced strong, and the gus protein activity of transformed plant reaches four times than raising before coercing under drought stress, and the amount of inducing rises nearly six times (as shown in Figure 7) behind the salt stress.

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉special evaluation and the utilization of inducing the active rice starter CPIP of two-way expression of adverse circumstance

<130>

<141>2006-01-13

<160>1

<170>PatentIn?version?3.1

<210>1

<211>1893

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>promoter

<222>(1)..(1893)

<223>

<220>

<221>CAAT_signal

<222>(1762)..(1765)

<223>

<220>

<221>CAAT_signal

<222>(1418)..(1421)

<223>

<220>

<221>CAAT_signal

<222>(639)..(642)

<223>

<220>

<221>CAAT_signal

<222>(618)..(621)

<223>

<220>

<221>CAAT_signal

<222>(562)..(565)

<223>

<220>

<221>CAAT_signal

<222>(467)..(470)

<223>

<220>

<221>CAAT_signal

<222>(312)..(315)

<223>

<220>

<221>CAAT_signal

<222>(155)..(158)

<223>

<220>

<221>TATA_signal

<222>(1483)..(1488)

<223>

<220>

<221>TATA_signal

<222>(1325)..(1331)

<223>

<220>

<221>TATA_signal

<222>(1250)..(1256)

<223>

<220>

<221>TATA_signal

<222>(985)..(990)

<223>

<220>

<221>TATA_signal

<222>(923)..(928)

<223>

<220>

<221>TATA_signal

<222>(578)..(584)

<223>

<220>

<221>TATA_signal

<222>(377)..(383)

<223>

<220>

<221>primer_bind

<222>(1874)..(1893)

<223>

<220>

<221>primer_bind

<222>(1)..(20)

<223>

<400>1

gcttgctgtc?tgatgaactc?attctggtca?cagcaaatta?atgaagcaaa?attcctgcaa 60

atatagctag?gattaatttg?ttgttgtgta?cacgcaaggc?acttaattcg?aaacactctt 120

tcatcaaatt?aagatcagaa?caggtactta?caaccaattg?aaactgcttg?ctatcgagac 180

tgaaacgggt?gttattgtcc?agcagaatga?tagatgctct?attgatcgat?tcttaagttg 240

tgtgtgcgtt?tggtgtatga?gggatggagt?tgtgtggtgt?atttataaga?tgagaaaaga 300

agcaaaacgt?gcaatttttc?ggtgccgtta?atggataggc?ttcccagttt?gctgagatga 360

gatatacttg?tagacttatt?aatccttctg?gactcagaaa?attcacggat?gtaaagggtg 420

gcacgtgtgt?gtggtggaga?ctctactagt?cagagaaaga?aagtgtcaat?ttgttaaggt 480

agtactcttc?tgcatatacc?acttggtgcc?cagatttgca?gaaaacgata?tgattaataa 540

acattttaca?ggtcaaattt?acaatgtgca?acgtggatat?aaatatgatt?cattggatca 600

tgccattgta?acttcttcaa?tactaaaata?taccactaca?atttatggaa?ttttagacat 660

gcttaattta?ataggtattt?caaatatgcc?actacatgtg?tatttcttcg?atgaaccaac 720

ttgtccatgt?cttctttttt?ttttttcatc?ccctcctcct?gttcatcttc?tgcaccatta 780

ccatcagaga?tggactcggc?cagttatcag?catggagcta?tagcttagag?cagcactgca 840

gcaggcagcc?aaatccatcc?aagcttgttg?ccgctgcctg?ttaaatgcat?cgaatagcta 900

agcactgaca?tatcactaat?gcttattttt?ggttctacca?tgattatggt?ttcatttcct 960

ctctgcgcca?catagctact?actattattt?agctcgaaat?taattaaatc?ttcctagctc 1020

caaatgcgtt?tagaagaatt?aattatactc?agctctatat?gtgcaaggtt?catcgtcaaa 1080

attcaaatct?gcaacccaca?agtagccacg?caccatatgg?ccaaatgtcc?ccatgtccaa 1140

atcgttgaat?atgcatccaa?caacccctct?acacgtgggt?gcacatgcat?gaagattgaa 1200

gcctatccac?taatgactag?tccacgtacc?ggcccgcttt?gaaacttcgt?tatttacaca 1260

cgttgctcga?tgtattggtg?tgctgtgttt?ttttttagac?caaattgctc?cgttcatatg 1320

gtcctataaa?tgcacgcata?tacgttacac?aaatccaaat?ccatatccac?acatcgcggt 1380

gcaaaaccaa?aacccactgc?agagaagaag?catcgatcaa?ttcaagttac?caagtacgta 1440

ctcctgtctc?taccgtatgt?gtctacctgt?ttaggttctt?tattatttga?atctacacat 1500

gaggagaggt?tccgtttttt?gattagtggc?gtttggagtc?atcgtttcgc?ttattcacgg 1560

catatttgta?aagaaaaata?atttatgaat?aaaactttta?tgtgtatgtt?cttagcgatt 1620

taaaagtaaa?ggctgaaaaa?taaacttcga?taaaaaaaac?cttgaaatca?gctccaaatt 1680

taaggttaaa?aatttaaatt?ttaattaata?agcataaaca?taagcgaaaa?gatgaggctc 1740

taattaaggt?cccatttgca?acaattttaa?agaacaaaat?atgattcaac?aagtaattaa 1800

catagaaagg?tgtttctttg?atgatctgaa?gatgcagtaa?tcatgaatta?accactcata 1860

atttgcaggc?aacttggatc?ttctcgattg?ttt 1893

Claims (8)

1, a kind ofly induced by arid or salt and have the active promotor CPIP of two-way abduction delivering, its nucleotide sequence is shown in SEQID NO:1.

2, the described promotor CPIP of claim 1, it is the sequence shown in the 1-1893 bit base shown in the SEQ ID NO:1.

3, the plant expression vector of all or part of sequence construct of claim 1 or 2 described promotor CPIP.

4, the described plant expression vector of claim 3 is the full sequence of promotor CPIP.

5, the described plant expression vector of claim 4, this carrier is pCAMBIA1391Z-CPIP.

6, claim 1 or the 2 described promotor CPIP application in cultivating adversity resistant plant.

7, the application of claim 6 is comprising the application in cultivating drought-enduring or salt-resistant plant.

8, claim 6 or 7 application are comprising the application in cultivating drought-enduring or anti-salt paddy rice.

Images