CN103421803A - Use of OsABH1 gene in control of drought resistance of paddy rice - Google Patents

Abstract

The invention belongs to the technical field of paddy rice gene engineering and concretely relates to a use of an OsABH1 gene capable of improving drought resistance of paddy rice in paddy rice genetic improvement, wherein the OsABH1 gene is obtained by separation and cloning and is subjected to functional verification. Through a candidate gene screening method, the OsABH1 gene capable of controlling drought resistance of paddy rice is cloned. Through excessive expression of the OsABH1 gene, drought resistance of transgenic paddy rice can be improved. The function and the use of the OsABH1 gene are verified in the invention. The nucleotide sequence of the OsABH1 gene is shown in the formula of SEQ ID NO: 1 in the sequence table and the sequence of the protein coded by the OsABH1 gene is shown in the formula of SEQ ID NO: 2 in the sequence table.

Description

The application of OsABH1 gene in controlling paddy drought resistance

Technical field

The invention belongs to technical field of rice gene engineering.Be specifically related to separate, clone and obtain a kind ofly can improving the OsABH1 gene application in rice genetic improvement of paddy rice to arid tolerance by functional verification.The present invention adopts the candidate gene screening method, is cloned into and controls Rice Drought Resistence gene OsABH1, by overexpression OsABH1 gene, can improve transgenic paddy rice to drought-resistant ability, has confirmed the function and application approach of this gene.

Background technology

Plant can be subject to the impact of many environmental factorss in the process of growth, arid, damages to plants caused by sudden drop in temperature the extensive underproduction that can cause farm crop with high temperature, in many areas, is bottlenecks of agricultural development.The crop varieties of cultivating resistance of reverse is one of major objective of agricultural cience and farming techniques research always.In order to resist or to adapt to these disadvantageous factors, the variation of plant materials recipient cell external environment condition also is delivered to it in cell by number of ways, some response genes of meeting abduction delivering, producing some makes cell avoid arid, high salt, the functional protein of the stress damages such as low temperature, the transcription factor of osmotic adjustment and transmission of signal and regulate gene expression, thereby corresponding reaction (Xiong etc. are made in variation to external world, Cell signaling during cold, drought and salt stress.Plant Cell.2002.14 (suppl), S165 – S183).Refer in particular to plant for plant in the osmoregulation under environment stress and reduce the effect of osmotic potential by increasing solute.Prevent that by osmoregulation moisture is excessively lost, maintain cell turgor, the Metabolic activity of protective plant, make it can recover rapidly growth after adverse environment is eliminated.Therefore, osmoregulation is considered to plant and adapts to one of significant process of the environment stresses such as arid.Plant can increase solute by synthesized micromolecule Organic Osmotic Adjustment in cell by the ion in absorbing environmental and active, yet the ion pair cell of hyperabsorption is disadvantageous, the ion absorbed is enriched in vacuole mostly, and still mainly by synthetic saturating Auto-regulator, carries out osmoregulation in tenuigenin.Osmotic adjustment mainly comprises that amino acid is (as proline(Pro), aspartic acid and L-glutamic acid), methylated quaternary ammonium compound (as glycinebetaine and L-Ala trimethyl-glycine), hydrophilic protein (as the late embryo stage Abundant protein), sugar (as Polylevulosan and sucrose) and cyclitol (as N.F,USP MANNITOL) (Chaves etc., Understanding plant responses to drought-from genes to the whole plant.Functional Plant Biology.2003.30 (3), 239-264).By genetically engineered, part osmotic adjustment gene or synthesis related gene have been successfully applied to the paddy rice anti contravariance genetic breeding.As derived from the E.C. 1.1.99.1 Introduced into Rice of Arthrobacter globiformis, the render transgenic paddy rice can synthesizing betaine.Significantly improved transgenic paddy rice to arid; the resistance of high salt and low temperature (Sakamoto etc., Metabolic engineering of rice leading to biosynthesis of glycinebetaine and tolerance to salt and cold.Plant Mol Biol.1998.38 (6): 1011-1019; Kathuria etc., Glycinebetaine-induced water-stress tolerance in codA-expressing transgenic indica rice is associated with up-regulation of several stress responsive genes.Plant Biotechnol is (6) J.2009.7: 512-526).Overexpression late embryo stage Abundant protein gene LEA3 improved equally paddy rice in the environment of land for growing field crops to arid resistance (Xiao etc., Over-expression of a LEA gene in rice improves drought resistance under the field conditions.Theor Appl Genet.2007.115 (1): 35-46).

Arabidopis thaliana ABH1 (ABA Hypersensitive 1) is the gene of a coding mRNA cap binding protein subunit.ABH1 plays an important role in processing and the montage process of mRNA.ABH1 can connect the early signal conduction of mRNA metabolism and ABA.Arabidopsis Mutants abh1 is very responsive to ABA.By the DNA chip analysis, learn, it is synthetic that ABH1 regulates and controls the mRNA of a few and ABA signal conduction genes involved, comprising the sub-phosphoprotein phosphatase PP2Cs of ABA signal negative regulation.With respect to wild-type WT, Exogenous ABA makes the intracytoplasmic Ca of abh1 mutant ²⁺Ionic concn significantly raises, and makes the signal of ABA be exaggerated.Empirical tests shows, ABH1 can regulate and control the seed germination stage to the susceptibility of ABA, induce the guard cell stomatal closure, increase cell cytoplasm Ca ²⁺Concentration, withered (Hugouvieux et al., 2002) of reducing the drought condition lower blade.The albumen homology of the albumen of ABH1 coding and the coding of the gene C BP80 in yeast (Saccharomyces cerevisiae) and people (Homo sapiens).In Arabidopis thaliana, ABH1 plays an important role to the synthetic of early stage mRNA of ABA signal conduction.CBP80 has the conservative property of height in a lot of species (as people, mouse, nematode, fruit bat, paddy rice etc.).Therefore infer that the homologous gene of ABH also has similar function in paddy rice.

Paddy rice is important food crop and model plant, and the today taken place frequently at extreme weather conditions, the paddy rice of cultivating the resistance enhancing has great importance.Therefore, separate the OsABH1 gene from paddy rice, and identify that it is in the function of bringing into play aspect the raising paddy rice anti contravariance, will have very important significance for cultivating degeneration-resistant new rice variety.

Summary of the invention

Purpose of the present invention relates to the application of Gene A BH1 (ABA Hypersensitive 1) in the adjusting and controlling rice drought resistance that connects the early signal conduction of mRNA metabolism and ABA.The present invention separates and applies a kind of DNA fragmentation of the OsABH1 of comprising gene, and this fragment is given the drought-resistant ability of paddy rice under drought condition and strengthened.Wherein, the nucleotide sequence of the present invention's separation and clone's OsABH1 gene is as shown in sequence table SEQ ID NO:1, its sequence length is 2992bp, the aminoacid sequence of its correspondence is as shown in SEQ ID NO:1, the aminoacid sequence that this gene pairs is answered is 743, and the sequence of the protein of its coding is as shown in SEQ ID NO:2.

The expression vector that carries OsABH1 gene of the present invention can be by being used Ti-plasmids; plant viral vector; directly delivered DNA; microinjection, the conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998; Method for Plant Molecular Biology VIII; Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

Can use the expression vector that comprises OsABH1 gene of the present invention to transform the host and comprise the paddy rice various plants, cultivate drought resistant plant variety.

Below in conjunction with drawings and Examples, the present invention will be further described.

The accompanying drawing explanation

Sequence table SEQ ID NO:1 is the nucleotide sequence that includes the OsABH1 gene of separating clone of the present invention, and sequence length is 2992bp, from the 60-2291 position, is its coding region, 743 amino acid of encoding altogether.

Sequence table SEQ ID NO:2 is the sequence of the protein of OsABH1 gene.

Fig. 1: be that gene OsABH1 overexpression vector builds schematic diagram and the expression amount detected result of OsABH1 in the blade of rice transformation.In figure, A is that the OsABH1 overexpression vector builds schematic diagram; B is the expression amount detected result of OsABH1 in the blade of rice transformation, and 1-17 represents the transgenosis family; 18 represent in wild-type ZH11(spend 11).The OsABH1 expression amount of transgenosis family 3,5,6,16,17 (OsABH1-OE-1 ,-2 ,-3 ,-4 ,-5) is respectively 30,13,21,15,14 times of ZH11, is the overexpression family.

Fig. 2: the ABA(dormin while being the germination of OsABH1 overexpression family) sensitivity experiments.In figure: the phenotype of A for germinateing on the 1/2MS substratum that contains 0,1,3,6 μ mol/L concentration ABA.OsABH1-OE-3 is overexpression transgenosis family, and OsABH1-NOE-6 is non-overexpression transgenosis family, flower 11(ZH11 in rice varieties) be the wild-type family.B is the percentage of germination statistics after germinateing 10 days on the 1/2MS substratum that contains 0,1,3,6 μ mol/L ABA respectively.OsABH1-OE-1 ,-2 ,-3 ,-4 ,-5 is 5 independent overexpression transgenosis familys, OsABH1-NOE-6 is non-overexpression transgenosis family, flower 11(ZH11 in rice varieties) be the wild-type family.

Fig. 3: be the ABA sensitivity phenotype evaluation in seedling stage of OsABH1 overexpression family.In figure, A is that OsABH1 overexpression family OsABH1-OE-4, wild-type ZH11 are at the ABA that contains 3 μ mol/L with not containing the growing state on the MS substratum of ABA; After B and C are respectively and grow 10 days, each family plant is not long with the root length and the stem that contain 3 μ mol/L ABA containing ABA.

Fig. 4: the Drought Resistance Analysis that is OsABH1 overexpression transfer-gen plant.OsABH1-OE-1 ,-5, be 2 independent overexpression transgenosis familys, OsABH1-NOE-6 is non-overexpression transgenosis family, flower 11(ZH11 in rice varieties) be the wild-type family.In figure, A is the performance of OsABH1 overexpression family before and after Drought at seedling stage is coerced; B be OsABH1 overexpression family under planting conditions between isolation field, drought stress recovers to irrigate to the full volume of blade boot stage, investigate the result (each strain is investigated 16 strains, repeats for three times) of setting percentage (seed setting) after ripe.*, and compare difference extremely significantly (T-test, P<0.01) to super (WT).

Fig. 5: be the expression analysis of gene in OsABH1 overexpression plant that participates in the ABA signal transduction path.

Fig. 6: the assay that is Proline in OsABH1 overexpression plant body.OsABH1-OE-1 ,-2 is 2 independent overexpression transgenosis familys, middle colored 11(ZH11) be the wild-type family.

Fig. 7: be pCB2004H carrier figure.

Embodiment

Following examples have defined the present invention, and have described the present invention and include the DNA fragmentation of OsABH1 gene complete coding section the clone, and the method for checking OsABH1 gene function.According to following description and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and, in the situation that do not depart from spirit and scope of the invention, can make various changes and modification to the present invention, so that its applicable different purposes and condition.

1, structure and the genetic transformation of embodiment 1 OsABH1 gene overexpression carrier

In order to analyze the function of OsABH1 gene, the applicant is by its overexpression in paddy rice.Study the function of this gene from the phenotype of transfer-gen plant.

The overexpression carrier construction method is as follows: at first by searching rice genome annotation website RGAP(http: //rice.plantbiology.msu.edu/) OsABH1 gene annotation number: LOC_Os03g22570, with KOME (http://cdna01.dna.affrc.go.jp/cDNA/) OsABH1 annotation number: AK102852, be predicted as a mRNA cap binding protein subunit gene, as the reference design primer.Full length cDNA clone (the accession number: AK102852) be template that the KOME of take obtains, with primer OsABH1FLF(5 ' GGGGACAAGTTTGTACAAAAAAGCAGGCTACTCTCTCTCTCTCTCTACTCT3 ', the additional joint attB1 of sequence specific primer) and OsABH1FLR(5 ' GGGGACCACTTTGTACAAGAAAGCTGGGTTCCATCAGCAGAAATAGG3 ', the additional joint attB2 of sequence specific primer), amplify the cDNA segment that comprises OsABH1 gene complete coding region, amplified production is exactly the nucleotide sequence (1-2992bp) shown in SEQ ID NO:1 of the present invention.The PCR reaction conditions is: 94 ℃ of denaturation 5min; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 120sec, 30 circulations; 72 ℃ are extended 5min.The PCR product that amplification is obtained is connected into pDONR207 intermediate carrier (purchased from Invitrogen company) by the BP recombining reaction, and screening positive clone order-checking, obtain required full-length gene.The applicant is by this clone's called after OsABH1-OE-pDONR207.Positive colony OsABH1-OE-pDONR207 plasmid imports to final carrier pCB2004H by the LR recombining reaction by the OsABH1 gene again and (is transformed by State Key Laboratory of Crop Genetic Improvent, carry the agriculture bacillus mediated genetic transformation carrier of the CaMV 35S promoter with overexpression feature, see Fig. 7), be built into the overexpression carrier and transform intestinal bacteria DH10 β (intestinal bacteria DH10 β bacterial strain, pDONR207 carrier and BP and LR recombinase are purchased from Invitrogen company).By the PCR screening positive clone, by the OsABH1 gene order on the recombinant plasmid vector called after OsABH1-OE-pCB2004H(carrier of acquisition, be exactly the nucleotide sequence shown in SEQ ID NO:1, its sequence length is 2992bp, sees Figure 1A).

By agriculture bacillus mediated rice transformation method (its concrete steps are as described below), above-mentioned overexpression vector OsABH1-OE-pCB2004H is transferred in rice varieties " in spend 11 " (the open rice varieties used that Institute of Crop Science, Chinese Academy of Agricultural Science cultivates), through preculture, infect, cultivate altogether, callus that screening has hygromycin resistance, break up, take root, practice seedling, transplanting, obtain transfer-gen plant.Above-mentioned agriculture bacillus mediated paddy rice (in spend 11 claim again ZH11) genetic transforming method (system) is at the method (Hiei etc. of the people such as Hiei report, Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.Plant is J.1994.6:271-282) improve on basis and carry out.

The concrete genetic transformation step of the present embodiment is as follows:

(1) electricity transforms: final overexpression destination carrier OsABH1-OE-pCB2004H(plasmid map is shown in to Fig. 7), use 1800v voltage, electricity is transformed into Agrobacterium EHA105 bacterial strain, is coated onto on the LA substratum commonly used of selecting with corresponding resistance, filter out positive colony, for following conversion callus.

(2) callus induction: will in ripe rice paddy seed, spend 11 to shell, then use successively 70% Ethanol Treatment 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes; Wash seed 4-5 time with sterilizing; This sterile seed is placed on to (composition sees below) on inducing culture; Postvaccinal callus inducing medium (composition sees below) is placed in to dark place and cultivates 4 weeks, 25 ± 1 ℃ of temperature.

(3) callus subculture: select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in upper dark lower the cultivation 2 weeks of subculture medium (composition sees below), 25 ± 1 ℃ of culture temperature.

(4) preculture: select the embryo callus subculture of consolidation and relatively dry, be put in upper dark lower the cultivation 2 weeks of pre-culture medium (composition sees below), 25 ± 1 ℃ of culture temperature.

(5) Agrobacterium is cultivated: on the LA substratum of selecting with corresponding resistance, (composition sees below) preculture Agrobacterium EHA105(derives from the commercial bacterial strain in Australian CAMBIA laboratory, carry overexpression vector OsABH1-OE-pCB2004H of the present invention) two days, 28 ℃ of culture temperature; Described Agrobacterium is transferred to suspension medium (composition sees below) inner, cultivates 2-3 hour on 28 ℃ of shaking tables.

(6) Agrobacterium is infected: pre-incubated callus is transferred in the bottle that sterilizing is good; Regulate the suspension of Agrobacterium to OD ₆₀₀0.8-1.0; Callus is soaked 30 minutes in agrobacterium suspension; Shift callus blots to the good filter paper of sterilizing; Then be placed on the upper cultivation of common substratum (composition sees below) 3 days, culture temperature 19-20 ℃.

(7) callus washing and selection are cultivated: aqua sterilisa washing callus is to cannot see Agrobacterium; Be immersed in containing in the aqua sterilisa of 400ppm Pyocianil (CN) 30 minutes; Shift callus blots to the good filter paper of sterilizing; Substratum (composition sees below) is upper to be selected 2-3 time to selecting to shift callus, each 2 weeks (the Pyocianil concentration of screening for the first time use is 400ppm, after reaching for the second time, is 250ppm, and Totomycin concentration is 250ppm).

(8) differentiation: kanamycin-resistant callus tissue is transferred to the upper dark place of pre-division culture medium (composition sees below) and cultivates 5-7 week; Shift the callus (composition sees below) to division culture medium of pre-differentiation culture, illumination (cultivate the conventional illumination condition of seedling according to rice tissue, there is no particular requirement) is lower cultivates, 26 ℃ of temperature.

(9) take root: cut the root that differentiation phase produces; Then transfer them to lower 2-3 week, 26 ℃ of the temperature of cultivating of illumination in root media (cultivate the conventional illumination condition of seedling according to rice tissue, there is no particular requirement).

(10) transplant: wash the residual substratum on root off, the seedling that will have good root system proceeds to greenhouse, at initial several days, keeps moisture moistening simultaneously.

Nutrient media components and formula thereof: (1) reagent and solution abbreviation: in the present invention, the abbreviation of substratum plant hormone used is expressed as follows: 6-BA(6-BenzylaminoPurine, 6-benzyladenine); CN(Carbenicillin, Pyocianil); KT(Kinetin, kinetin); NAA(Napthalene acetic acid, naphthylacetic acid); IAA(Indole-3-acetic acid, indolylacetic acid); 2,4-D(2,4-Dichlorophenoxyacetic acid, 2,4 dichlorphenoxyacetic acids); AS(Acetosringone, Syringylethanone); CH(Casein Enzymatic Hydrolysate, caseinhydrolysate); HN(Hygromycin B, Totomycin); DMSO(Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); The a large amount of composition solution of N6max(N6); N6mix(N6 trace ingredients solution); The a large amount of composition solution of MSmax(MS); MSmix(MS trace ingredients solution).(2) main solution formula:

1) preparation of N6 substratum macroelement mother liquor [10 times of concentrated solutions (10X)]:

Dissolve one by one, then under room temperature, with distilled water, be settled to 1000ml.

2) preparation of N6 substratum trace element mother liquor [100 times of concentrated solutions (100X)]

Dissolve with distilled water under room temperature and be settled to 1000ml.

3) molysite (Fe ₂EDTA) preparation of stock solution (100X)

Prepare the 800ml distilled water and be heated to 70 ℃, adding b diammonium disodium edta (Na ₂EDTA2H ₂O) 3.73 grams keep 2 hours after fully dissolving in 70 ℃ of water-baths, with distilled water, are settled to 1000ml, and 4 ℃ save backup.

4) VITAMIN stock solution (100X) preparation

Be settled to 1000ml with distilled water, 4 ℃ save backup.

5) preparation of MS substratum macroelement mother liquor (10X)

Dissolve with distilled water under room temperature and be settled to 1000ml.

6) preparation of MS substratum trace element mother liquor (100X)

Dissolve with distilled water under room temperature and be settled to 1000ml.

7) 2, the 4-D stock solution, the 6-BA stock solution, naphthylacetic acid (NAA) stock solution, indolylacetic acid (IAA) stock solution: 1 is mg/ml.

8) glucose stock solution: 0.5g/ml.

9) preparation of AS stock solution: weigh AS 0.392g, DMSO 10ml.

(3) for the culture medium prescription of rice transformation

1) callus inducing medium

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000ml, divides and installs to 50ml triangular flask (25ml/ bottle), the sealing sterilizing.

2) subculture medium

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000ml, divides and installs to 50ml triangular flask (25ml/ bottle), the sealing sterilizing.

3) pre-culture medium

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, the sealing sterilizing.Use front heating for dissolving substratum and add 5ml glucose stock solution and 250 μ l AS stock solutions, (25ml/ ware) in culture dish poured in packing into.

4) be total to substratum

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, the sealing sterilizing.Use front heating for dissolving substratum and add 5ml glucose stock solution and 250 μ l AS stock solutions, (the every ware of 25ml/) in culture dish poured in packing into.

5) suspension medium

Adding distil water, to 100ml, is regulated pH value to 5.4, divides and installs in the triangular flask of two 100ml, the sealing sterilizing.Add 1ml glucose stock solution and 100 μ l AS stock solutions before use.

6) select substratum

Adding distil water, to 250ml, is regulated pH value to 6.0, the sealing sterilizing.Dissolve substratum before using, add 250 μ l HN and 400ppmCN, (25ml/ ware) in culture dish poured in packing into.

7) pre-division culture medium

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.9, the sealing sterilizing.Dissolve substratum before using, add 250 μ lHN and 200ppm CN, (25ml/ ware) in culture dish poured in packing into.

8) division culture medium

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 6.0.Boil and be settled to 1000ml, dividing and install to 50ml triangular flask (50ml/ bottle), the sealing sterilizing.

9) root media

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.8.Boil and be settled to 1000ml, dividing and install to (25ml/ pipe) in the pipe of taking root, the sealing sterilizing.

2, OsABH1 overexpression transgenosis family seed germination ABA sensitivity experiments

The method that the present invention adopts fluorescence real-time quantitative is detected the expression of OsABH1 gene in the part transgenic rice plant.The extraction of total RNA adopts TRIZOL reagent (purchased from Invitrogen company) to extract, extracting method is operated according to the specification sheets of above-mentioned TRIZOL reagent, utilize ThermoScript II SSIII(purchased from Invitrogen company) the synthetic cDNA(method of its reverse transcription is operated according to the specification sheets of Invitrogen company ThermoScript II reagent), reaction conditions is: 65 ℃ of 5min, 50 ℃ of 120min, 70 ℃ of 10min.The synthetic cDNA of the above-mentioned reverse transcription of take is template, with the primer (OsABH1F:5 '-CCTGATGGCTGAGACCATATTTT-3 ' and OsABH1R:5 '-TGCCTTGCAAAGGTCGATAAT-3 ') of design, the OsABH1 gene is carried out to special pcr amplification.Utilize primer (AF:5 '-TGGCATCTCTCAGCACATTCC-3 ' and AR:5 '-TGCACAATGGATGGGTCAGA-3 ') to do specific amplified (the long 76bp of amplified production) to paddy rice Actin1 gene simultaneously, using and carry out quantitative analysis as internal reference.Reaction conditions is: 95 ℃ of 30sec; 95 ℃ of 5sec, 60 ℃ of 34sec, 40 circulations.Carry out the fluoroscopic examination real-time quantitative analysis in reaction process.Fig. 1 is the expression amount detected result, has obtained the transfer-gen plant that the expression amount of OsABH1 gene significantly improves with respect to wild-type.

5 familys that the present embodiment has been chosen the overexpression that turns OsABH1 gene (sequence is shown in sequence table SEQ NO:1) (are numbered OsABH1-OE-3, OsABH1-OE-1, OsABH1-OE-2, OsABH1-OE-4, OsABH1-OE-5) and 1 family (being numbered OsABH1-NOE-6) of non-overexpression carried out seed germination ABA sensitivity experiments.Concrete steps are as follows: by overexpression transgenosis family (OsABH1-OE-3, OsABH1-OE-1, OsABH1-OE-2, OsABH1-OE-4, OsABH1-OE-5) flower 11(ZH11 and in non-overexpression transgenosis family (OsABH1-NOE-6) and wild-type) family seed sterilization (the alcohol processing 1min that is 70% by concentration that shells, process 10min with 0.15% mercury chloride again, sterile water wash for several times), selecting state consistency and good seed transfers to and contains respectively 0 μ mol/L, 1 μ mol/L, on the 1/2MS substratum of the ABA of 3 μ mol/L and 6 μ mol/L isoconcentration gradients, in culturing room's lucifuge growth, growth starts to observe every day and add up the percentage of germination of each family seed in three days later.Susceptibility to ABA when overexpression OsABH1 causes transfer-gen plant to germinate as a result strengthens, and to the percentage of germination under normal condition also exert a certain influence (Fig. 2).

3, OsABH1 overexpression transgenosis family ABA in seedling stage sensitivity analysis

The present embodiment has been chosen 1 family (being numbered OsABH1-OE-4) of the overexpression that turns OsABH1 gene (sequence is shown in sequence table SEQ NO:1) and has been carried out seed germination dormin (ABA) sensitivity experiments.Concrete steps are as follows: by flower 11(ZH11 in overexpression transgenosis family (OsABH1-OE-4) and wild-type) the family seed shells, and (alcohol that is 70% by concentration is processed 1min in sterilization, process 10min with 0.15% mercury chloride again, sterile water wash for several times), overexpression transgenosis family is germinateed on the 1/2MS of the Totomycin that contains 50mg/L substratum, will be in wild-type flower 11(ZH11) seed of family is sowed at not containing on the 1/2MS substratum of Totomycin evening in one day, selecting the good and consistent seed of growing way of germinateing after 2-3 days transfers to and contains or not containing continued growth in the 1/2MS substratum of the ABA of 3 μ mol/L.Take pictures after 7 days and investigate the plant height (seeing A in Fig. 3) of plant.Significantly lower than wild-type ZH11 family, and containing on the ABA substratum, there is no significant difference (B in seeing Fig. 3) at the plant height containing overexpression transgenosis ZH11 plant on the ABA substratum.Illustrate that overexpression OsABH1 gene improves the susceptibility of transfer-gen plant to ABA really.

4, OsABH1 overexpression transgenosis family drought stress phenotypic evaluation

The present embodiment will be transplanted in catridge after germinateing through 2 positive OsABH1 overexpression transgenosis familys (OsABH1-OE-1, OsABH1-OE-5) of hygromycin selection and 1 non-overexpression transgenosis family (OsABH1-NOE-6) and ZH11 wild-type family.The rice soil that the soil of test use is the southern china routine and rough sand are by volume for 2:3 mixes, and the even sandy soil of every drum equivalent add equal-volume water, and water seepage voluntarily guarantees that the degree of packing of soil is consistent.Plant to 4 leaf phases of healthy growth is cut off the water supply drought stress 6-10 days (specifically according to weather condition, determining), and then rehydration is recovered 7 days, takes pictures and investigates the survival rate of plant.Result shows that OsABH1 overexpression family more non-overexpression transgenosis family (OsABH1-NOE-6) and wild-type family (being the non-transgenic plant) have stronger resistance (seeing Fig. 4 A) to arid.This test is established 3 secondary pollutants and is learned repetition, and result is consistent.Illustrate that overexpression OsABH1 gene has the transfer-gen plant of raising drought-resistant ability of coercing in seedling stage really.Same two OsABH1 overexpression familys are contrasted and are planted between isolation field with wild-type, carry out drought stress in boot stage and recover to irrigate after full the volume to blade, the ripe rear setting percentage (seed setting) of investigating.Result shows that the overexpression family setting percentage utmost point is significantly higher than contrast (seeing Fig. 4 B), and in the normal growth situation difference with insignificance.Illustrate that overexpression OsABH1 gene also has the drought-resistant ability of coercing of transfer-gen plant strain phase of raising.

5, the expression amount of OsABH1 overexpression plant native gene detects

2 OsABH1 overexpression family (OsABH1-OE-1 that the present embodiment will be grown on the 1/2MS substratum that contains 3 μ mol/L ABA, OsABH1-OE-3) and contrast (transgenosis negative OsABH1-NOE-6 and wild-type ZH11) family, extract total RNA of rice leaf.The extraction of RNA, the concrete steps of reverse transcription are with embodiment 2.The present embodiment is used the expression amount of a plurality of native genes of real-time fluorescence quantitative PCR (Real-Time PCR) reaction detection plant, and primer sequence used is as shown in table 1.The paddy gene Actin76 (LOC_Os07g22650) of take is internal reference, and each template respectively arranges 3 repetitions with corresponding primer.Use CFX ConnectTM Real-Time PCR Systems (BIO-RAD) amplification instrument to carry out amplified reaction.Each reaction system is 10ul, contains 2ul cDNA (5ng/ul) template, each 0.2ul of 10mM primer, and SYBR Green Supermix5ul, finally with the ddH that adds DEPC ₂O complements to 10ul.Pcr amplification reaction adopts two-step approach: 95 ℃ of 30s; 95 ℃ of 5s, 60 ℃ of 10s; A next step repeats 45 circulations, and collects fluorescent signal in the time of 60 ℃.Draw solubility curve, analyze different native genes and change and difference with the expression amount contrasted between family at transfer-gen plant.The present embodiment has detected 16 genes at OsABH1 overexpression plant (OsABH1-OE-1, OsABH1-OE-3) expression amounts (comprising under normal condition and ABA disposition) in and 2 contrasts familys (OsABH1-NOE-6 and ZH11), the expression amount that result shows to have 6 genes the overexpression plant with contrast between present difference (Fig. 5).Negative and the wild-type contrast with respect to transgenosis, in the normal growth situation, the expression contents of OsP5CS in OsABH1 overexpression family raises; OsPP2C49, the expression contents of OsVPI in the overexpression family reduces; Under Exogenous ABA is coerced, the expression contents of OsBKI1 in OsABH1 overexpression family raises, and ABA2 and the OsMYB3R expression contents in the overexpression family reduces (Fig. 5).

Table 1 the present invention is for the primer of Real-Time pcr amplification

6, the free proline content in OsABH1 overexpression plant body is measured

The measuring method employing sulphosalicylic acid extraction method of Free Proline Content of the present invention (Xu is same, Chen Cuilian. contrary property mensuration (proline(Pro) Fast Measurement) method in plant hole. and Central China agricultural college journal .1983,2:94-95).Get respectively the fresh rice leaf of 0.5g, the sulphosalicylic acid that adds 5ml 3% grinds, and extracts 10min in boiling water bath.In leaching process, need often to shake, cooling after with the centrifugal 10min of 3000rpm, get supernatant liquor to be measured.Get the 2ml supernatant liquor, add the 2ml glacial acetic acid, the 2ml triketohydrindene hydrate, mix rear boiling water colour developing 60min, takes out the extraction of the cooling rear 4ml of using toluene, in standing a moment, gets toluene phase (pink) in centrifuge tube.Then the centrifugal 5min of 3000rpm, measure the OD value at 520nm wavelength place.Take toluene as blank, in 1-6 μ g/ml scope, make typical curve.Find from typical curve or go out the content that 2ml measures proline(Pro) in liquid, the then percentage ratio of proline content in calculation sample by regression equation calculation.

The present embodiment is got OsABH1 overexpression family (OsABH1-OE-1, OsABH1-OE-2, OsABH1-OE-3, OsABH1-OE-5) the fresh blade that contrasts with wild-type, extract the Proline in rice leaf with sulfosalicylic acid method, and measure respectively its content (Fig. 6).OX-1 means mixing of overexpression family OsABH1-OE-1 and OsABH1-OE-2, OX-2 means mixing of overexpression family OsABH1-OE-3 and OsABH1-OE-5, result shows, in OsABH1 overexpression plant, the content of Proline is higher than wild-type family.

Claims (2)

1. the application of OsABH1 gene in the adjusting and controlling rice drought resisting of a separation, is characterized in that the nucleotide sequence of this gene is as shown in sequence table SEQ ID NO:1.

2. the application of OsABH1 gene in the adjusting and controlling rice drought resisting of a separation, is characterized in that the sequence of protein of this genes encoding is as shown in sequence table SEQ ID NO:2.

Images