CN101705234A

CN101705234A - Application of DSM1gene of MAPKKK family genes in controlling rice drought resistance

Info

Publication number: CN101705234A
Application number: CN200910272694A
Authority: CN
Inventors: 熊立仲; 宁婧
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2009-11-10
Filing date: 2009-11-10
Publication date: 2010-05-12

Abstract

The invention relates to the field of plant genetic engineering, in particular to application of a DSM1gene of MAPKKK family genes in controlling rice drought resistance. A key gene DSM1 controlling the rice drought resistance is obtained through function analysis and identification, and the application of the gene in the anti-adversity genetic improvement of the rice drought resistance is verified. The DSM1gene is one of the following nucleotide sequences: a nucleotide sequence of 159-3494th nucleotides in a sequence list SEQ NO:1, or a nucleotide sequence which codes the same protein as that coded by the SEQ NO:1. The function of the rice endogenous DSM1gene is lost or the expression level of the rice endogenous DSM1 gene is reduced, the rice drought resistance is obviously reduced; and the nucleotide sequence containing the DSM1 gene is connected with an exogenous promoter and then is transferred in rice, the drought resistance of the transgenetic rice is obviously improved.

Description

The application of MAPKKK family gene DSM1 gene in the control paddy drought resistance

Technical field

The present invention relates to paddy gene engineering field.Be specifically related to separate, clone and obtain a kind of application of paddy rice DSM1 gene in the improvement of paddy rice anti contravariance sex-controlled inheritance that can improve the N.F,USP MANNITOL tolerance by functional verification.The present invention adopts screening T-DNA to insert the method in rice mutant storehouse, be cloned into control paddy rice anti-drought gene DSM1, show that by being divided into this mutant and arid responsive phenotype are closely linked from detection, and by overexpression DSM1 gene, render transgenic paddy rice N.F,USP MANNITOL tolerance improves, and has confirmed the function of this gene.

Background technology

The growth of plant is subjected to many Effect of Environmental toward the contact meeting except its inherent hereditary basis is arranged.Arid, high salt, low temperature are the most common abiotic stresses, have had a strong impact on the growth of plant, have limited the distribution of plant.Abiotic stress can cause the decline of crop yield and quality, is bottlenecks of agricultural development in many areas.Therefore, cultivate the resistance crop varieties is one of major objective of agricultural cience and farming techniques research always.In order to adapt to or to resist these adverse environmental factors, plant has formed the self-protective mechanism of environment stresses such as a cover defence arid, high salt, low temperature after through secular biological domestication.Arid, high salt and low temperature stress, all destroyed the ionic equilibrium of vegetable cell, cause cell dehydration, make vegetable cell be subjected to ion and water stress, cause that plant materials is in genetic expression, metabolic and modal variation, these variations comprise that some genetic expressions raise or reduce, the slowing down even stop the instantaneous rising of hormone in vivo (as ABA) of growth, regulate (the Seki M such as gathering of the material of osmotic pressure in the body, Umezawa T, Urano K, Shinozaki K.Regulatory metabolic networks in drought stress responses.Curr Opin Plant Biol, 2007,10:296-302).And plant has also formed a series of signal transduction path during evolution and has mediated reaction to coercing, thus the growing of controlling plant.

The understanding in plant signal transduction path only was confined to the induction or the receptor protein of direct perceptual signal in the past, or the transcription factor and the target gene of direct regulation and control reaction.And it is very limited to the understanding that is in the gene between the two.In recent years, scientists has been identified many bars transductions path, as the Salt-Overly-Sensitive relevant (SOS) path with salt stress, the CDPK signal path relevant with multiple adverse circumstance, with cold relevant ICE1 (Inducer of CBF Expression 1)-CBF (the C-Repeat Binding Protein) path of coercing, the ABA dependent form relevant and the signal transduction path of non-ABA dependent form and split former activated protein kinase (mitogen activated protein kinase with osmotic pressure, MAPK) cascade signal path, wherein MAPK cascade signal path is in various physiological responses such as the cell fission of plant, hormone response, all play a part and important (Jonak C in abiotic stress and biological the coercing, Kiegerl S, Ligterink W, Barker P J, Huskisson N S, Hirt H.Stresssignaling in plants:a mitogen-activated protein kinase pathway is activated by cold and drought.Proc Natl AcadSci U S A, 1996,93:11274-11279).MAPK cascade signal path is a high conservative, he is by three grades of kinase cascade reactions, be MAPKKK (MAP Kinase Kinase Kinase) → MAPKK (MAP Kinase Kinase) → MAPK, but, all the time, people only know that MAPK cascade approach is made up of these 3 kinds of kinases, but also know little about it with regard to situations such as the composition of concrete MAPK cascade path, physiological function, target genes, particularly participate in the complete MAPK cascade path that abiotic stress replys and yet there are no report.Therefore the MAPK cascade path research that abiotic stress is replied (the Tena G that has very important significance, Asai T, Chiu W L, Sheen J.Plant mitogen-activated protein kinasesignaling cascades.Curr Opin Plant Biol, 2001,4:392-400).

Paddy rice is important crops and model plant, and studying some by rice mutant has become a kind of important function of gene functional study means with plant-growth, gene that growth is relevant with other proterties.Be separated to a paddy rice T-DNA mutant that arid is responsive in our early-stage Study, it inserts gene is a MAPKKK gene.Whether can improve the resistance of plant in view of MAPKKK in the paddy rice and still not have relevant report at present.Therefore, from paddy rice, isolate the MAPKKK gene, and identify it, will have very important significance for cultivating degeneration-resistant new rice variety in the function of being brought into play aspect the raising paddy rice anti contravariance.

Summary of the invention

Purpose of the present invention relates to the application of a MAPKKK family gene DSM1 gene in the improvement of control paddy drought resistance.From paddy rice T-DNA mutant library, separate and obtain a paddy rice T-DNA mutant that arid is responsive, it inserts gene is a MAPKKK gene, based on the phenotype of this mutant, the applicant is DSM1 (drought-sensitive mutant 1) with this unnamed gene.The present invention separates and uses a kind of dna fragmentation of the DSM1 of comprising gene, and this fragment is given paddy rice resistance enhanced ability under adverse environmental factor.Wherein, described DSM1 gene is one of following nucleotide sequences:

1) dna sequence dna shown in the 159-3494 position among the sequence table SEQ NO:1; Or

2) the protein DNA sequence that coding and 1) encoded protein matter is identical; Or

3) 1) and 2) subfragment that comprised.

Carrying DSM1 expression carrier of the present invention can be by using Ti-plasmids, plant viral vector, directly DNA transforms, microinjection, conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

Can use to comprise that DSM1 expression carrier of the present invention transforms the host and comprises the paddy rice various plants, cultivate drought resisting, anti-salt or cold-resistant plant variety.

Gene of the present invention is subjected to the adverse circumstance abduction delivering, therefore can with gene of the present invention be connected into suitable expression vector after any interested adverse circumstance evoked promoter combines, and the conversion plant host, but under adverse environmental factor the abduction delivering gene, improve the speed of growth of plant under adverse environmental factor.

The present invention will be further described below in conjunction with drawings and Examples.

Description of drawings

What sequence table SEQ ID NO:1 showed is the nucleotide sequence that includes the DSM1 gene coding region of separating clone of the present invention.

Fig. 1. be divided into from synoptic diagram according to inserting the checking of site design primer.A is illustrated in the primer that inserts the site upstream design, and B is illustrated in the primer that inserts the design of downstream, site, and C represents the primer according to the design of T-DNA internal sequence.T1 for plant in, the homozygous mutation body has only going out that A and C pairing can increase, because have T-DNA insertion A and B paired product can't obtain amplified fragments too greatly, the plant of wild-type is not owing to there is the insertion of T-DNA, have only A and B pairing can obtain product, heterozygous plant then can be increased when A and C pairing and A and B pairing and be obtained product.

Fig. 2. according to inserting site design primer checking isolating PCR result altogether.Lastrow primer: A+B, next line primer: C+B, wherein

swimming lane

2,5, and 13,16,17,18,19,20,21,22,23,24 isozygoty for T-DNA; 1,3,6,8,14,15 is the T-DNA heterozygosis; 4,7,9,10,12 is the T-DNA feminine gender.

Fig. 3. the rice mutant phenotype.On: before the drought stress.Down: behind the drought stress.ZH11 is the wild-type contrast, and dsm1-1 is a DSM1 T-DNA mutant.

Fig. 4 .DSM1 can be by multiple adverse circumstance (arid, high salt, low temperature, ABA etc.) abduction delivering.

Fig. 5. normal growth and 120mmol/L N.F,USP MANNITOL are coerced down, the comparison of 3 DSM1 overexpression transgenosis familys (T1) and contrast upgrowth situation.

Fig. 6. N.F,USP MANNITOL menacingly top statistics.

Fig. 7. overexpression is tested used pU1301 carrier figure.

Fig. 8 .DSM1 gene inhibition express transgenic family drought stress phenotype.

Embodiment

Following examples have defined the present invention, and have described the present invention and separated the DSM1T-DNA mutant, and the clone includes the dna fragmentation of the promotor section of DSM1 gene complete coding section and gene, and the method for checking DSM1 gene function.According to following description and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and under the situation that does not depart from spirit and scope of the invention, can make various changes and modification to the present invention, so that it is suitable for different purposes and conditions.

Embodiment 1: separate DSM1 T-DNA mutant

Set up hidden Markov model (HMMs:Hidden Markovmodel profiles) then with the full genome of HMMER scanning paddy rice based on the plant MAPK/MAPKK/MAPKKK protein sequence of having reported, obtain all possible MAPKKK gene in the rice genome.The corresponding T-DNA mutant of picking from rice mutant storehouse (http://rmd.ncpgr.cn/) then.Sequence involved in the present invention derives from NCBI (http://www.ncbi.nlm.nih.gov/), TIGR (http://www.tigr.org), KOME (http://cdna01.dna.affrc.go.jp/cDNA/), the positional information of localized gene is as the criterion with " TIGR Rice Annotation Release 4 ".

Wherein the flanking sequence of DSM1 T-DNA mutant is:

TAAAAACGTCCGCAATGTGTTATTAAGTTTCGCAATCGTCGCCTTGATATTCCAGTATAACACTGATCCCGCCATTGCAGAAATAATAGCAAAATGCTGGCAGACGTTAGTGTGCCTAACTCACTTTGTCGCTCATCTGCATTCTTCCGGACGCACTAAAACCTGCATTCCATTTTCGGAATACACAACCATTTTCTCAGTGTTGCTTCCTGTATTTGGTGTAGGGACCCAAAATTGCGGCCATCATTTGCAGATATCATGGCCTCATTGAAACCACTGCTGAAAAACATGACCGCTCAAGCGCCAAGGCAGAGAGTACAACAAACCGACGAGTAAGAAAAAAGAGGATGTTACCAGCTGCCCGAAGGCCTAAGTATAGCATTTTTTTTTGTTTTTTGTTTAGTAACACCAATTGTGTGTTCGAGATTGGAAAGCGTGATGATGTTAGTGTGCTGGGTATCCATCTGGGAAGACCAGCGCTGCCAAACCCGTCCACGATGGAGGAAAATTGAACAGGGGCAAGAAACTGTGCAAACGCGAATCAAATGTTTAGCACAGTTCTTCCCCAAAAACACCAGTCTCAGGAAATCACATGGCGGGCGGAAGTTACACATGCTTTTTTCATACCATCTCTCTTTTCCTTTATCTCGTGTTCTCCACCAAATGGTAGTATTTGTGTAATATGGCAAGTAAAAAGAACAGAAAATGATTTGCTGTCCATCATGAAAAATGAAAAAGGAGAAAACGGTTGTTCAATCGTGCTCAGTGCTTCCCTAAACCCTACTGTGACAGGTGATTAGTGATGTTTAGAAATAACAAAATGTTATGAAAGACAGAAGAGCTGGTGATATGGGATAGTGTTCACCTTGTTACACCGTTTTCCATGAGCAACTGAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTCCGCCAGTCTTACACATTATTCCCAGGATGTGGCGTCATCGGCGACTAGGCGTGCCCTTGCCTATCTACTCGTTCTGGGAATTGGCATAGTTAATCTATACACAACTTCTCC

Match condition according to flanking sequence and rice genome, can determine to insert the site, design a pair of primer A and B on the both sides of inserting the site, and T-DNA goes up primer C of design, as Fig. 1, A is illustrated in the primer that inserts the site upstream design, B is illustrated in the primer that inserts the design of downstream, site, C represents the primer according to T-DNA internal sequence design. T1 for plant in, the T-DNA homozygous plants has only going out that A and C pairing can increase, because have T-DNA insertion A and B paired product can't obtain amplified fragments too greatly, the plant of wild-type is not owing to there is the insertion of T-DNA, have only A and B pairing can obtain product, heterozygous plant then can be increased when A and C pairing and A and B pairing and be obtained product. and according to the primer sequence that inserts the site design is A (primer): 5 ' CACCGTCCTCGGGTTTATC3 ' B (primer): 5 ' AGTTTCTTGCCGCTGTTCA, 3 ' C (primer): 5 ' AATCCAGATCCCCCGAATTA3 '.The cumulative volume of PCR reaction system is 20 μ l, dna profiling 1ul (about 50ng), 1 * Taq enzyme reaction buffer solution, 25mM MgCL ₂1.2ul, 2mM dNTP 1.5ul, 10uM primer 0.2ul, 0.3 Taq of unit enzyme, add water to 20 μ l.Response procedures is: 94 ℃ of sex change 5min, and 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1min 30cycles, 72 ℃ are extended 5min.PCR result, as Fig. 1,2,5,13,16,17,18,19,20,21,22,23,24 isozygoty for T-DNA; 1,3,6,8,14,15 is the T-DNA heterozygosis; 4,7,9,10,12 is the T-DNA feminine gender.The result shows that this T-DNA is inserted in the 12nd EXON, according to ATG 7174bp place.

Embodiment 2: identify mutant drought stress phenotype

To identify genotypic isozygoty and the vernalization of wild-type family after live in catridge.The soil of test usefulness is that south rice soil mixes by 2: 3 with rough sand, and the even sandy soil of every drum equivalent add equal-volume water, and water seepage is voluntarily guaranteed the degree of packing unanimity of soil, and 3 repetitions are established in test.To cut off the water supply drought stress 12 days of the plant of 4 leaf phases of healthy growth, rehydration is 7 days then, takes pictures and investigates the survival rate of plant.Compare with the wild-type contrast, the T-DNA homozygous plants shows as arid responsive phenotype, and after moderate was coerced rehydration, homozygous plants was basic all dead, and wild-type still has the survival rate more than 60%.This experiment is through having gone 3 secondary pollutants repetition, unanimity as a result.Illustrate that this mutant phenotype is that the T-DNA insertion causes really.

For genetic stability and the further checking of verifying this mutant is divided into from situation, having bred a generation again is T2 generation.T1 is withheld the planting seed that obtains obtain T2 for isozygotying heterozygosis and wild type seeds.Equally through above-mentioned experiment, the unanimity as a result of coercing of row.

Embodiment 3: detect the endogenous DSM1 expression of gene of paddy rice level

We select material when spending No. 11 (Oryza sativa L.subsp.japonica cv.Zhonghua 11) as expression pattern analysis in the rice variety for use.After the presprouting of seeds, under the normal growth condition, cultivated 18-20 days, carry out the processing of various adverse circumstances and hormone during the phase to four leaves.It is seedling directly to be taken out be exposed in the air from water planting liquid that arid is handled, respectively coerce preceding, coerce sampling in back 6 hours, 24 hours, 36 hours; High-salt stress is seedling to be moved into by water planting liquid contain in the water planting liquid of 200mmol/LNaCl, before coercing, takes a sample in 2 hours, 6 hours, 12 hours respectively; Low temperature stress is that rice seedling is put into 4 ℃ of phytotrons, and is preceding respectively at coercing, coerce sampling in back 3 hours, 7 hours, 12 o'clock.HORMONE TREATMENT is with 100 μ M dormins (ABA) uniformly behind the spray water rice plants surface, respectively coerce preceding, coerce sampling in back 3 hours, 6 hours, 12 hours.All processing and sampling process all are to carry out under the condition of continuous light.Total RNA adopts TRIZOL reagent (available from Invitrogen company) to extract (extracting method is according to above-mentioned TRIZOL reagent specification sheets), utilize ThermoScript II SSII (available from Invitrogen company) with the synthetic cDNA (method is according to Invitrogen company ThermoScript II reagent specification sheets) of its reverse transcription, reaction conditions is: 65 ℃ of 5min, 42 ℃ of 120min, 70 ℃ of 10min.With above-mentioned reverse transcription synthetic cDNA is template, with primer (5 '-GTGGTCATGGTCCATTATTGCC-3 ' and 5 '-CCCAAACCCTCAACTGGCTTA-3 ') the DSM1 gene is carried out special pcr amplification (the long 72bp of amplified production).Use primer (AF:5 '-TGGCATCTCTCAGCACATTCC-3 ' and AR:5 '-TGCACAAT GGATGGGTCAGA-3 ') that paddy rice Actinl gene is done specific amplified (the long 76bp of amplified production) simultaneously, to carry out quantitative analysis as internal reference. reaction conditions is: 95 ℃ of 5min; 95 ℃ of 10sec, 60 ℃ of 5sec, 72 ℃ of 34sec, 40 circulations. carry out the fluoroscopic examination real-time quantitative analysis in the reaction process. the result shows, the DSM1 gene is induced to rise after high salt, ABA and arid are handled and is expressed, and also having in low temperature stress descends slightly expresses (see figure 3).

The structure and the genetic transformation of embodiment 4:DSM1 gene overexpression, inhibition expression vector

In order to analyze the function of DSM1 gene, the applicant is with its overexpression and inhibition expression in paddy rice.Study the function of this gene from the phenotype of transfer-gen plant.

The overexpression carrier construction method is as follows: at first by searching Japanese paddy rice total length database Knowledge-based Oryza Molecularbiological Encyclopedia (http://cdna01.dna.affrc.go.jp), find its pairing cDNA clone J033107F14 (accession number: AK102767), and buy its full-length cDNA.This full-length cDNA is a template, with primer DSMFLF (5 '-CCAGGTACCCAACAGTGGGCAATAGG-3 ') and DSMFLR (5 '-CCAGGATCCTGGTTTCAATGAGGCCATG-3 '), amplify the dna segment that comprises the DSM1 total length, reaction conditions is: 94 ℃ of pre-sex change 3min; 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 3min, 30 circulations; 72 ℃ are extended 10min.With BamHI and KpnI double digestion, reclaim time PCR fragment; Simultaneously, the enzyme that uses the same method is cut the genetic transformation carrier pCAMBIA1301U enzyme that carries the Ubiquitin promotor and is cut completely, and use chloroform: primary isoamyl alcohol (volume ratio is 24: 1) extracting, purifying enzyme is cut product.Carrier after cutting with endonuclease bamhi that comprises the DSM1 total length and enzyme is done ligation, transformed into escherichia coli DH10 β (intestinal bacteria DH10 β bacterial strain is available from Invitrogen company).Cut screening positive clone by enzyme, obtain conversion carrier.The carrier pCAMBIA1301U (see figure 7) of genetic transformation is on plant genetic conversion carrier pCAMBIA1301 commonly used in the world (carrier pCAMBIA1301 is from Australian CAMBIA[Center for the Application of MolecularBiology to International Agriculture] laboratory) basis, the Ubiquitin promotor of introducing widely used constitutive expression at restriction enzyme site EcoRI and SacI place is (referring to Toki S, Takamatsu S, Nojiri C, Ooba S, Anzai H, Iwata M, Christensen A H, QuailP H, Uchimiya H.Expression of a Maize Ubiquitin Gene Promoter-bar Chimeric Gene in Transgenic Rice Plants.Plant Physiol, 1992,100:1503-1507) the (see figure 7) that obtains is named as the carrier pCAMBIA1301U of genetic transformation.

It is as follows to suppress the expression vector establishment method: at first by searching Japanese paddy rice total length database Knowledge-based Oryza Molecularbiological Encyclopedia (http://cdna01.dna.affrc.go.jp), find its pairing cDNA clone J033107F14, and buy its full-length cDNA.With this full-length cDNA is template, with primer uz41maif (5 ' cca actagt ggtacc TTGTAGCACCACCTGACT3 ') and uz41mair (5 ' cca gagctc ggatcc ATTGAAGACGCAACCACT3 '), amplify the 400bp segment that comprises the DSM1 total length, reaction conditions is: 94 ℃ of pre-sex change 3min; 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 1min, 30 circulations; 72 ℃ are extended 10min.With BamHI and KpnI double digestion or SpeI and SacI double digestion, reclaim this PCR fragment; Simultaneously, the enzyme that uses the same method is cut the genetic transformation carrier pds1301 (see figure 7) enzyme that carries the Ubiquitin promotor and is cut completely, and use chloroform: primary isoamyl alcohol (volume ratio is 24: 1) extracting, purifying enzyme is cut product.Carrier pds1301 (see figure 7) after cutting with endonuclease bamhi that comprises DSM1400bp and enzyme is done ligation, transformed into escherichia coli DH10 β (intestinal bacteria DH10 β bacterial strain is available from Invitrogen company).Cut screening by enzyme and obtain positive colony.

By agriculture bacillus mediated rice genetic method for transformation (as following concrete steps) above carrier (pCAMBIA1301U and pds1301) is imported to and to spend in the rice varieties in 11 (rice varieties of the public use that China Paddy Rice Inst provides), through the callus of cultivating in advance, infecting, cultivating altogether, screening having hygromycin resistance, break up, take root, practice seedling, transplanting, obtain transfer-gen plant.Agriculture bacillus mediated paddy rice (in spend 11) genetic transforming method (system) is at people's reported method such as Hiei (Hiei etc., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282,1994) improve on the basis and carry out (as following concrete steps).

Concrete genetic transformation step is as follows:

(1) callus induction: will spend 11 (rice varieties of the public use that China Paddy Rice Inst provides) to shell in the sophisticated rice paddy seed, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes; Wash seed 4-5 time with sterilization; Should be placed on (composition is seen below) on the inducing culture by sterile seed; Place dark place to cultivate 4 weeks, 25 ± 1 ℃ of temperature postvaccinal callus inducing medium.

(2) callus subculture: select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in subculture medium (composition is seen below) and go up dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down.

(3) the pre-cultivation: select the embryo callus subculture of consolidation and relatively dry, be put in pre-culture medium (composition is seen below) and go up dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down.

(4) Agrobacterium is cultivated: (composition is seen below) cultivated Agrobacterium EHA105 (deriving from CAMBIA, commercial bacterial strain) two days, 28 ℃ of culture temperature in advance on the LA substratum that has corresponding resistance selection; Described Agrobacterium is transferred to suspension culture base (composition is seen below) lining, cultivated 2-3 hour on 28 ℃ of shaking tables.

(5) Agrobacterium is infected: pre-incubated callus is transferred in the good bottle of sterilization; The suspension of regulating Agrobacterium is to OD ₆₀₀0.8-1.0; Callus was soaked in agrobacterium suspension 30 minutes; Shifting callus blots to the good filter paper of sterilization; Be placed on common substratum (composition is seen below) then and go up cultivation 3 days, culture temperature 19-20 ℃.

(6) callus washing and selection are cultivated: aqua sterilisa washing callus is to cannot see Agrobacterium; Be immersed in the aqua sterilisa that contains 400ppm Pyocianil (CN) 30 minutes; Shifting callus blots to the good filter paper of sterilization; Shift callus and select 2-3 time, each 2 weeks (screening Pyocianil concentration for the first time is 400ppm, and be 250ppm later the second time, Totomycin concentration 250ppm) to selecting substratum (composition is seen below) to go up.

(7) differentiation: kanamycin-resistant callus tissue is transferred to pre-differentiation substratum (composition is seen below) goes up dark place cultivation 5-7 week; Shift the callus (composition is seen below) to division culture medium that pre-differentiation is cultivated, illumination is cultivated 26 ℃ of temperature down.

(8) take root: cut the root that differentiation phase produces; Then it is transferred to and cultivates 2-3 week, 26 ℃ of temperature in the root media under the illumination.

(9) transplant: wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.

Nutrient media components and prescription thereof: (1) reagent and solution abbreviation: the abbreviation of the used plant hormone of substratum is expressed as follows among the present invention: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid) IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (CaseinEnzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N6max (a large amount of composition solution of N6); N6mix (N6 trace ingredients solution); MSmax (a large amount of composition solution of MS); MSmix (MS trace ingredients solution).(2) main solution formula:

1) preparation of N6 substratum macroelement mother liquor [10 times of concentrated solutions (10X)]:

Saltpetre (KNO ₃) 28.3g

Potassium primary phosphate (KH ₂PO ₄) 4.0g

Ammonium sulfate ((NH ₄) ₂SO ₄) 4.63g

Sal epsom (MgSO ₄7H ₂O) 1.85g

Calcium chloride (CaCl ₂2H ₂O) 1.66g

Dissolving is settled to 1000ml under the room temperature then one by one.

2) preparation of N6 substratum trace element mother liquor [100 times of concentrated solutions (100X)]

Potassiumiodide (KI) 0.08g

Boric acid (H ₃BO ₃) 0.16g

Manganous sulfate (MnSO ₄4H ₂O) 0.44g

Zinc sulfate (ZnSO ₄7H ₂O) 0.15g

Dissolving and be settled to 1000ml under the room temperature.

3) molysite (Fe ₂EDTA) preparation of stock solution (100X)

Prepare the 800ml distilled water and be heated to 70 ℃, add b diammonium disodium edta (Na ₂EDTA2H ₂O) 3.73 grams, fully the dissolving back kept 2 hours in 70 ℃ of water-baths, was settled to 1000ml, and 4 ℃ of preservations are standby.

4) VITAMIN stock solution (100X) preparation

Nicotinic acid (Nicotinic acid) 0.1g

VITMAIN B1 (Thiamine HCl) 0.1g

Vitamin B6 (Pyridoxine HCl) 0.1g

Glycine (Glycine) 0.2g

Inositol (Inositol) 10g

Add water and be settled to 1000ml, 4 ℃ of preservations are standby.

5) preparation of MS substratum macroelement mother liquor (10X)

Ammonium nitrate (NH ₄NO ₃) 16.5g

Saltpetre 19.0g

Potassium primary phosphate 1.7g

Sal epsom 3.7g

Calcium chloride 4.4g

Dissolving and be settled to 1000ml under the room temperature.

6) preparation of MS substratum trace element mother liquor (100X)

Potassiumiodide 0.083g

Boric acid 0.62g

Manganous sulfate 0.86g

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.025g

Copper sulfate (CuSO ₄5H ₂O) 0.0025g

Dissolving and be settled to 1000ml under the room temperature.

7) 2, the 4-D stock solution, the 6-BA stock solution, naphthylacetic acid (NAA) stock solution, indolylacetic acid (IAA) stock solution: 1 is mg/ml.

8) glucose stock solution: 0.5g/ml.

9) preparation of AS stock solution: weigh AS 0.392g, DMSO 10ml.

(3) be used for the culture medium prescription that rice genetic transforms

1) callus inducing medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

2,4-D stock solution 2.5ml

Proline(Pro) (Proline) 0.3g

CH 0.6g

Sucrose (Sucrose) 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000ml, divides to install to 50ml triangular flask (25ml/ bottle), seals sterilization.

2) subculture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

2,4-D stock solution 2.0ml

Proline(Pro) 0.5g

CH 0.6g

Sucrose 30g

Phytagel 3g

3) pre-culture medium

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.15g

Sucrose 5g

Agar powder (Agarose) 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, seals sterilization.Use preceding heating for dissolving substratum and add 5ml glucose stock solution and 250 μ l AS stock solutions, (25ml/ ware) in the culture dish poured in packing into.

4) be total to substratum

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.2g

Sucrose 5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, seals sterilization.Use preceding heating for dissolving substratum and add 5ml glucose stock solution and 250 μ l AS stock solutions, (the every ware of 25ml/) in the culture dish poured in packing into.

5) suspension culture base

N6max mother liquor (10X) 5ml

N6mix mother liquor (100X) 0.5ml

Fe ²⁺EDTA stock solution (100X) 0.5ml

VITAMIN stock solution (100X) 1ml

2,4-D stock solution 0.2ml

CH 0.08g

Sucrose 2g

Adding distil water is regulated pH value to 5.4 to 100ml, divides to install in the triangular flask of two 100ml, seals sterilization.Add 1ml glucose stock solution and 100 μ l AS stock solutions before using.

6) select substratum

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.625ml

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is regulated pH value to 6.0 to 250ml, seals sterilization.The dissolving substratum adds 250 μ l HN and 400ppmCN before using, and (25ml/ ware) in the culture dish poured in packing into.

7) break up substratum in advance

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

6-BA stock solution 0.5ml

KT stock solution 0.5ml

NAA stock solution 50 μ l

IAA stock solution 50 μ l

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.9, seals sterilization.The dissolving substratum adds 250 μ l HN and 200ppm CN before using, and (25ml/ ware) in the culture dish poured in packing into.

8) division culture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

6-BA stock solution 2ml

KT stock solution 2ml

NAA stock solution 0.2ml

IAA stock solution 0.2ml

CH 1g

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 6.0.Boil and be settled to 1000ml, divide to install to 50ml triangular flask (50ml/ bottle), seal sterilization.

9) root media

MSmax mother liquor (10X) 50ml

MSmix mother liquor (100X) 5ml

Fe ²⁺EDTA stock solution (100X) 5ml

VITAMIN stock solution (100X) 5ml

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.8.Boil and be settled to 1000ml, divide to install to (25ml/ pipe) in the pipe of taking root, seal sterilization.

Embodiment 5:DSM1 overexpression transgenosis T ₁For the upgrowth situation of family under N.F,USP MANNITOL is coerced

Present embodiment has been chosen 3 DSM1 overexpression T ₁Family has been carried out N.F,USP MANNITOL and has been coerced experiment.Concrete steps are as follows: overexpression transgenosis family seed is shelled, and (75% alcohol is handled 3min in sterilization, 0.15% mercury chloride is handled 30min, sterile water wash for several times), germinate containing on the 1/2MS substratum of 50mg/L Totomycin, wild-type contrast family is sowed on the 1/2MS substratum that does not contain Totomycin one day evening, select after 2-3 days and germinate good and the consistent seed of growing way is transferred on the 1/2MS substratum of the N.F,USP MANNITOL that contains 0mmol/L and 120mmol/L, observe phenotype after 10 days and measure the plant height of plant in the growth of illumination cultivation chamber.Every kind of processing of each family is no less than 15 plant, and experiment is provided with 3 repetitions.The result shows: the growth of the transfer-gen plant of DSM1 overexpression slightly is worse than contrast under normal operation, but handling the back growth at environment stress wants remarkable (t tests P＜0.01) to be better than contrast, illustrate that DSM1 expression of gene of the present invention can alleviate N.F,USP MANNITOL and coerce the plant strain growth that causes and be obstructed, strengthen the resistance (see Fig. 5, Fig. 6) of transgenic plant abiotic stress.

Embodiment 6:DSM1 suppresses express transgenic T ₁For the upgrowth situation of family under drought stress

The present invention has chosen 3 DSM1 and has suppressed to express the T1 familys and carried out N.F,USP MANNITOL and coerce experiment. and concrete steps are as follows: will suppress express transgenic family seed sterilization (the 75% alcohol processing 3min that shells, 0.15% mercury chloride is handled 30min, sterile water wash for several times), germinate containing on the 1/2MS substratum of 50mg/L Totomycin, wild-type contrast family is sowed on the 1/2MS substratum that does not contain Totomycin one day evening, selecting after 2-3 days and germinateing good and the consistent seed of growing way is transferred on the normal 1/2MS substratum, after growing 10 days in the illumination cultivation chamber, the seedling immigration is equipped with in the catridge of sandy soil. the sandy soil of test usefulness are that south rice soil mixed with rough sand in 2: 3 by weight, the even sandy soil of every drum equivalent add equal-volume water, water seepage is voluntarily guaranteed the degree of packing unanimity of soil, 3 repetitions are established in test. wait growth of seedling to 4 leaf after date, to cut off the water supply drought stress 12 days of plant, rehydration is 7 days then, to take pictures and investigate the survival rate of plant. test shows, present embodiment is compared with the wild-type contrast, suppresses to express plant and shows as arid responsive phenotype (Fig. 8).

Sequence table

＜110〉Hua Zhong Agriculture University

＜120〉application of MAPKKK family gene DSM1 gene in the control paddy drought resistance

<130>

<141>2009-11-10

<160>2

<170>PatentIn?version?3.1

<210>1

<211>3845

<212>DNA

＜213〉paddy rice (Oryza sativa

<220>

<221>gene

<222>(1)..(3845)

<223>

<220>

<221>CDS

<222>(159)..(3494)

<223>

<400>1

ggagtcaata?cctgcctaaa?gttgagttac?cccttccgcc?tcagcgtcag?tggccatgtc 60

ggatccaccc?acccaccacc?agcaacagtg?ggcaataggc?caatagctgc?tgctgcgacg 120

gcgacctcgg?cggcggcggc?ggcggcggtg?gcgacggc?atg?aag?aac?ttc?ttc?agg 176

Met?Lys?Asn?Phe?Phe?Arg

1 5

g?ctc?cac?atc?ggg?gag?ggg?tcg?ggc?gac?ggc?gcc?tcc?tcg?tct?ccc 224

Lys?Leu?His?Ile?Gly?Glu?Gly?Ser?Gly?Asp?Gly?Ala?Ser?Ser?Ser?Pro

10 15 20

cct?cca?ccg?ccc?tcc?tcg?agg?aag?ggg?agc?ggc?ggg?gtg?ggg?ggt?aat 272

Pro?Pro?Pro?Pro?Ser?Ser?Arg?Lys?Gly?Ser?Gly?Gly?Val?Gly?Gly?Asn

25 30 35

cat?cac?ctg?cac?gcc?gag?cag?agg?cag?cca?tcg?gcg?tcg?gcg?gtg?tcg 320

His?His?Leu?His?Ala?Glu?Gln?Arg?Gln?Pro?Ser?Ala?Ser?Ala?Val?Ser

40 45 50

agc?tgg?ctt?gat tcc?gtc?cca?ggt?cgg?cct?cag?ccc?cct?acg?ccg?tcg 368

Ser?Trp?Leu?Asp?Ser?Val?Pro?Gly?Arg?Pro?Gln?Pro?Pro?Thr?Pro?Ser

55 60 65 70

acg?ccg?tcg?gag?gcg?gag?ggg?tcg?ccg?ttc?tcg?tcg?tcg?gta?ggg?tcg 416

Thr?Pro?Ser?Glu?Ala?Glu?Gly?Ser?Pro?Phe?Ser?Ser?Ser?Val?Gly?Ser

75 80 85

ggg?gcg?gag?gag?agg?agg?caa?tcc?gtg?gcg?gct?gag?agg?agg?aga?tcg 464

Gly?Ala?Glu?Glu?Arg?Arg?Gln?Ser?Val?Ala?Ala?Glu?Arg?Arg?Arg?Ser

90 95 100

cag?gag?gag?gag?tgg?gag?agg?agg?cgg?tcg?cag?gag?gaa?gag?gcc?gtg 512

Gln?Glu?Glu?Glu?Trp?Glu?Arg?Arg?Arg?Ser?Gln?Glu?Glu?Glu?Ala?Val

105 110 115

agg?gag?atg?agg?cgg?tcg?cag?gag?gag?gac?gag?gtg?gag?gag?cga?gtg 560

Arg?Glu?Met?Arg?Arg?Ser?Gln?Glu?Glu?Asp?Glu?Val?Glu?Glu?Arg?Val

120 125 130

ata?agg?gag?tcg?tcg?gag?gcg?gag?gag?agg?aag?cgg?gtc?agg?gag?aag 608

Ile?Arg?Glu?Ser?Ser?Glu?Ala?Glu?Glu?Arg?Lys?Arg?Val?Arg?Glu?Lys

135 140 145 150

gag?gac?gac?gac?ctt?gag?gag?ttc?cag?ctg?cag?ctt?gtg?ctt?gag?atg 656

Glu?Asp?Asp?Asp?Leu?Glu?Glu?Phe?Gln?Leu?Gln?Leu?Val?Leu?Glu?Met

155 160 165

agc?gcg?cgg?gac?aat?cct?gaa?gag?atg?gag?att?gaa?gtt?gcc?aag?cag 704

Ser?Ala?Arg?Asp?Asn?Pro?Glu?Glu?Met?Glu?Ile?Glu?Val?Ala?Lys?Gln

170 175 180

atc?agc?ctg?ggc?ttc?tgc?ccg?cct?cag?agc?tct?act?gca?gag?gcc?ctc 752

Ile?Ser?Leu?Gly?Phe?Cys?Pro?Pro?Gln?Ser?Ser?Thr?Ala?Glu?Ala?Leu

185 190 195

gcg?gcc?cga?tac?tgg?aat?ttc?aac?gcc?ctt?ggc?tat?gat?gac?aga?ata 800

Ala?Ala?Arg?Tyr?Trp?Asn?Phe?Asn?Ala?Leu?Gly?Tyr?Asp?Asp?Arg?Ile

200 205 210

tca?gat?ggg?ttt?tat?gat?ctc?tat?gtg?act?ggg?aat?ggc?ccg?gct?tca 848

Ser?Asp?Gly?Phe?Tyr?Asp?Leu?Tyr?Val?Thr?Gly?Asn?Gly?Pro?Ala?Ser

215 220 225 230

ata?acc?atg?ccc?tct?ctt?aaa?gat?ttg?cga?gcg?cag?tca?cta?tca?cat 896

Ile?Thr?Met?Pro?Ser?Leu?Lys?Asp?Leu?Arg?Ala?Gln?Ser?Leu?Ser?His

235 240 245

agg?gtc?aac?tgg?gaa?gct?gta?ttg?gta?cac?aga?ggt?gaa?gat?cct?gag 944

Arg?Val?Asn?Trp?Glu?Ala?Val?Leu?Val?His?Arg?Gly?Glu?Asp?Pro?Glu

250 255 260

ctt?atg?aaa?ctt?gac?cag?acg?gct?cta?atc?atg?agc?ctt?gaa?ctc?cgt 992

Leu?Met?Lys?Leu?Asp?Gln?Thr?Ala?Leu?Ile?Met?Ser?Leu?Glu?Leu?Arg

265 270 275

gaa?tct?aaa?cct?tca?gaa?ttt?gtt?gga?aat?gat?ttg?gtt?cag?aaa?ctt 1040

Glu?Ser?Lys?Pro?Ser?Glu?Phe?Val?Gly?Asn?Asp?Leu?Val?Gln?Lys?Leu

280 285 290

gct?ggc?cta?gta?gcc?aga?cac?atg?ggt?gga?act?ttt?ttt?gat?tct?gag 1088

Ala?Gly?Leu?Val?Ala?Arg?His?Met?Gly?Gly?Thr?Phe?Phe?Asp?Ser?Glu

295 300 305 310

ggc?atg?ttg?gtg?aaa?tac?cag?aaa?atg?atg?aga?tac?ctg?aga?acc?agt 1136

Gly?Met?Leu?Val?Lys?Tyr?Gln?Lys?Met?Met?Arg?Tyr?Leu?Arg?Thr?Ser

315 320 325

att?gga?agt?gta?gtt?gtt?cct?ctt?ggc?caa?tta?aaa?att?ggt?ctg?gca 1184

Ile?Gly?Ser?Val?Val?Val?Pro?Leu?Gly?Gln?Leu?Lys?Ile?Gly?Leu?Ala

330 335 340

cgt?cat?cgt?gca?ctg?cta?ttt?aag?gtt?ttg?gcc?gat?aac?att?ggt?atc 1232

Arg?His?Arg?Ala?Leu?Leu?Phe?Lys?Val?Leu?Ala?Asp?Asn?Ile?Gly?Ile

345 350 355

ccc?tgt?cga?ctc?ctg?aaa?gga?agg?cag?tac?act?gga?tcg?gac?gat?ggg 1280

Pro?Cys?Arg?Leu?Leu?Lys?Gly?Arg?Gln?Tyr?Thr?Gly?Ser?Asp?Asp?Gly

360 365 370

gct?ttg?aat?att?gtg?aaa?ttt?gat?gat?gga?agg?gag?ttc?att?gtt?gat 1328

Ala?Leu?Asn?Ile?Val?Lys?Phe?Asp?Asp?Gly?Arg?Glu?Phe?Ile?Val?Asp

375 380 385 390

ctt?gtc?gca?gat?cct?ggt?aca?ctt?att?cct?tca?gat?ggt?gct?gtt?ttg 1376

Leu?Val?Ala?Asp?Pro?Gly?Thr?Leu?Ile?Pro?Ser?Asp?Gly?Ala?Val?Leu

395 400 405

tct?aca?gaa?ttt?gaa?gaa?agt?tcc?ttc?tca?aat?aat?cat?cat?ttt?aac 1424

Ser?Thr?Glu?Phe?Glu?Glu?Ser?Ser?Phe?Ser?Asn?Asn?His?His?Phe?Asn

410 415 420

aaa?gat?aat?gac?atc?agg?cag?ttg?gga?tct?tca?aat?agt?tta?tcg?aat 1472

Lys?Asp?Asn?Asp?Ile?Arg?Gln?Leu?Gly?Ser?Ser?Asn?Ser?Leu?Ser?Asn

425 430 435

tct?gca?tgt?agt?tct?ttt?gag?tgt?gag?tta?ctt?gac?aga?aga?tct?aca 1520

Ser?Ala?Cys?Ser?Ser?Phe?Glu?Cys?Glu?Leu?Leu?Asp?Arg?Arg?Ser?Thr

440 445 450

tgg?atc?aac?gtt?ggt?cct?tct?gat?agt?gat?gga?gct?aca?acg?agc?cag 1568

Trp?Ile?Asn?Val?Gly?Pro?Ser?Asp?Ser?Asp?Gly?Ala?Thr?Thr?Ser?Gln

455 460 465 470

aca?agt?aaa?aac?aat?caa?caa?aat?aca?cta?tca?gat?tca?ttc?ggg?att 1616

Thr?Ser?Lys?Asn?Asn?Gln?Gln?Asn?Thr?Leu?Ser?Asp?Ser?Phe?Gly?Ile

475 480 485

tta?tct?gtt?agc?aca?ttc?act?agt?gaa?aat?agg?cct?att?aca?aat?gaa 1664

Leu?Ser?Val?Ser?Thr?Phe?Thr?Ser?Glu?Asn?Arg?Pro?Ile?Thr?Asn?Glu

490 495 500

tca?aga?agt?aca?gac?gac?att?gct?gcc?gca?aag?aac?aaa?gaa?aga?tca 1712

Ser?Arg?Ser?Thr?Asp?Asp?Ile?Ala?Ala?Ala?Lys?Asn?Lys?Glu?Arg?Ser

505 510 515

agt?gta?aca?att?aat?tct?tcg?tca?act?tca?cct?tca?cct?tct?tcc?cca 1760

Ser?Val?Thr?Ile?Asn?Ser?Ser?Ser?Thr?Ser?Pro?Ser?Pro?Ser?Ser?Pro

520 525 530

gaa?gta?ggc?agt?act?cca?gct?gtc?cgg?agg?atg?aaa?gta?aag?gat?att 1808

Glu?Val?Gly?Ser?Thr?Pro?Ala?Val?Arg?Arg?Met?Lys?Val?Lys?Asp?Ile

535 540 545 550

tcg?gag?tac?atg?att?aat?gct?gcc?aaa?gag?aat?cca?caa?cta?gct?cag 1856

Ser?Glu?Tyr?Met?Ile?Asn?Ala?Ala?Lys?Glu?Asn?Pro?Gln?Leu?Ala?Gln

555 560 565

aag?atc?cat?gag?gtt?tta?ctt?gaa?aat?gga?gtt?gta?gca?cca?cct?gac 1904

Lys?Ile?His?Glu?Val?Leu?Leu?Glu?Asn?Gly?Val?Val?Ala?Pro?Pro?Asp

570 575 580

ttg?ttt?tca?gaa?gat?tcc?atg?gaa?gag?cca?aag?gac?ctc?atc?gtg?tat 1952

Leu?Phe?Ser?Glu?Asp?Ser?Met?Glu?Glu?Pro?Lys?Asp?Leu?Ile?Val?Tyr

585 590 595

gac?acc?acc?ctt?ttt?caa?agc?aag?gat?gaa?atg?aaa?aag?agg?atg?aat 2000

Asp?Thr?Thr?Leu?Phe?Gln?Ser?Lys?Asp?Glu?Met?Lys?Lys?Arg?Met?Asn

600 605 610

gaa?ctt?ggg?tcg?agg?gaa?tat?gct?gat?cgt?ggt?cat?ggt?cca?tta?ttg 2048

Glu?Leu?Gly?Ser?Arg?Glu?Tyr?Ala?Asp?Arg?Gly?His?Gly?Pro?Leu?Leu

615 620 625 630

cct?cat?cat?cct?gga?cat?gaa?ctc?cca?tca?aaa?gtt?cct?cac?cgg?gca 2096

Pro?His?His?Pro?Gly?His?Glu?Leu?Pro?Ser?Lys?Val?Pro?His?Arg?Ala

635 640 645

cct?cta?gac?tca?ctt?aag?cca?gtt?gag?ggt?ttg?ggc?att?gac?cac?ccc 2144

Pro?Leu?Asp?Ser?Leu?Lys?Pro?Val?Glu?Gly?Leu?Gly?Ile?Asp?His?Pro

650 655 660

cct?gac?atc?caa?gat?aac?aca?tct?ttt?att?tct?cag?tat?gaa?cct?tct 2192

Pro?Asp?Ile?Gln?Asp?Asn?Thr?Ser?Phe?Ile?Ser?Gln?Tyr?Glu?Pro?Ser

665 670 675

gca?cct?ccc?cag?gaa?gct?tca?tcg?cag?ctt?aca?aag?caa?ttg?cct?gtt 2240

Ala?Pro?Pro?Gln?Glu?Ala?Ser?Ser?Gln?Leu?Thr?Lys?Gln?Leu?Pro?Val

680 685 690

acg?gct?gct?gct?gtt?gca?act?gct?gca?gtg?gtt?gcg?tct?tca?atg?gtt 2288

Thr?Ala?Ala?Ala?Val?Ala?Thr?Ala?Ala?Val?Val?Ala?Ser?Ser?Met?Val

695 700 705 710

gtt?gct?gct?gct?aaa?tca?aac?aat?gat?gtg?aac?ttt?gac?gtg?cct?gtt 2336

Val?Ala?Ala?Ala?Lys?Ser?Asn?Asn?Asp?Val?Asn?Phe?Asp?Val?Pro?Val

715 720 725

gca?gct?gct?gca?aca?gtc?act?gca?gct?gca?gtt?gtt?gcc?aca?act?gct 2384

Ala?Ala?Ala?Ala?Thr?Val?Thr?Ala?Ala?Ala?Val?Val?Ala?Thr?Thr?Ala

730 735 740

gct?gtt?agc?aag?caa?tat?gaa?cac?ttg?gag?cct?ggt?aat?cag?ctg?cat 2432

Ala?Val?Ser?Lys?Gln?Tyr?Glu?His?Leu?Glu?Pro?Gly?Asn?Gln?Leu?His

745 750 755

agt?tta?cca?agt?ccc?tcc?gaa?ggg?aat?gaa?tca?atc?gag?aaa?agt?gca 2480

Ser?Leu?Pro?Ser?Pro?Ser?Glu?Gly?Asn?Glu?Ser?Ile?Glu?Lys?Ser?Ala

760 765 770

gat?gag?ttt?tgg?gat?aaa?cag?aat?ttt?gaa?att?gat?cat?ggt?caa?gat 2528

Asp?Glu?Phe?Trp?Asp?Lys?Gln?Asn?Phe?Glu?Ile?Asp?His?Gly?Gln?Asp

775 780 785 790

aat?act?ttg?gat?caa?gaa?aaa?gat?tca?gct?gaa?gtt?cgc?cag?gat?gct 2576

Asn?Thr?Leu?Asp?Gln?Glu?Lys?Asp?Ser?Ala?Glu?Val?Arg?Gln?Asp?Ala

795 800 805

gaa?aga?acc?tca?gat?aag?tca?agc?gga?aca?gag?agt?gca?aaa?tct?gaa 2624

Glu?Arg?Thr?Ser?Asp?Lys?Ser?Ser?Gly?Thr?Glu?Ser?Ala?Lys?Ser?Glu

810 815 820

atc?act?ctg?gat?gat?gtt?gcg?gag?ttt?gaa?atc?caa?tgg?gaa?gaa?att 2672

Ile?Thr?Leu?Asp?Asp?Val?Ala?Glu?Phe?Glu?Ile?Gln?Trp?Glu?Glu?Ile

825 830 835

act?att?ggg?gaa?cgc?att?ggt?ctt?gga?tca?ttt?gga?gaa?gtt?tat?aga 2720

Thr?Ile?Gly?Glu?Arg?Ile?Gly?Leu?Gly?Ser?Phe?Gly?Glu?Val?Tyr?Arg

840 845 850

gga?gag?tgg?cat?gga?aca?gaa?gtt?gct?gta?aag?aag?ttt?ctg?caa?caa 2768

Gly?Glu?Trp?His?Gly?Thr?Glu?Val?Ala?Val?Lys?Lys?Phe?Leu?Gln?Gln

855 860 865 870

gat?att?tca?agt?gat?gct?ctg?gaa?gaa?ttt?aga?act?gag?gtg?cga?ata 2816

Asp?Ile?Ser?Ser?Asp?Ala?Leu?Glu?Glu?Phe?Arg?Thr?Glu?Val?Arg?Ile

875 880 885

atc?aag?agg?ttg?cgg?cat?ccg?aat?gtt?gtt?ctc?ttc?atg?ggt?gct?att 2864

Ile?Lys?Arg?Leu?Arg?His?Pro?Asn?Val?Val?Leu?Phe?Met?Gly?Ala?Ile

890 895 900

act?cgt?gta?ccc?aat?ctt?tct?att?gtc?aca?gaa?ttt?ctt?cca?aga?ggt 2912

Thr?Arg?Val?Pro?Asn?Leu?Ser?Ile?Val?Thr?Glu?Phe?Leu?Pro?Arg?Gly

905 910 915

agc?tta?ttt?cgg?tta?att?cat?cgt?ccc?aac?aac?cag?ttg?gat?gaa?aga 2960

Ser?Leu?Phe?Arg?Leu?Ile?His?Arg?Pro?Asn?Asn?Gln?Leu?Asp?Glu?Arg

920 925 930

aag?cgc?tta?aga?atg?gca?ctt?gat?gtg?gca?cgt?ggt?atg?aat?tat?cta 3008

Lys?Arg?Leu?Arg?Met?Ala?Leu?Asp?Val?Ala?Arg?Gly?Met?Asn?Tyr?Leu

935 940 945 950

cat?aac?tgc?aca?ccg?gtg?ata?gtc?cat?cga?gat?ctg?aag?tct?cca?aac 3056

His?Asn?Cys?Thr?Pro?Val?Ile?Val?His?Arg?Asp?Leu?Lys?Ser?Pro?Asn

955 960 965

cta?ctg?gtt?gac?aag?aat?tgg?gtt?gtg?aag?gtt?tgc?gac?ttt?ggt?tta 3104

Leu?Leu?Val?Asp?Lys?Asn?Trp?Val?Val?Lys?Val?Cys?Asp?Phe?Gly?Leu

970 975 980

tct?aaa?atg?aag?aac?aag?acc?ttc?ttg?tca?tca?aga?tca?aca?gct?gga 3152

Ser?Lys?Met?Lys?Asn?Lys?Thr?Phe?Leu?Ser?Ser?Arg?Ser?Thr?Ala?Gly

985 990 995

aca?gcg gag?tgg?atg?gca?cct gaa?gta?ctt?cgt?aat gaa?cca?tca 3197

Thr?Ala Glu?Trp?Met?Ala?Pro Glu?Val?Leu?Arg?Asn Glu?Pro?Ser

1000 1005 1010

gac?gag aaa?tgc?gat?gtt?ttt agc?tat?ggg?gtc?ata ctg?tgg?gaa 3242

Asp?Glu Lys?Cys?Asp?Val?Phe Ser?Tyr?Gly?Val?Ile Leu?Trp?Glu

1015 1020 1025

ctt?tgt aca?tta?ctg?caa?cct tgg?gga?ggc?atg?aac gcc?atg?caa 3287

Leu?Cys Thr?Leu?Leu?Gln?Pro Trp?Gly?Gly?Met?Asn Ala?Met?Gln

1030 1035 1040

gtc?gtc gga?gct?gtt?ggg?ttt cag?aat?cgt?cgc?ctt gat?att?cca 3332

Val?Val Gly?Ala?Val?Gly?Phe Gln?Asn?Arg?Arg?Leu Asp?Ile?Pro

1045 1050 1055

gat?aac act?gat?ccc?gcc?att gca?gaa?ata?ata?gca aaa?tgc?tgg 3377

Asp?Asn Thr?Asp?Pro?Ala?Ile Ala?Glu?Ile?Ile?Ala Lys?Cys?Trp

1060 1065 1070

cag?acg gac?cca?aaa?ttg?cgg cca?tca?ttt?gca?gat atc?atg?gcc 3422

Gln?Thr Asp?Pro?Lys?Leu?Arg Pro?Ser?Phe?Ala?Asp Ile?Met?Ala

1075 1080 1085

tca?ttg aaa?cca?ctg?ctg?aaa aac?atg?acc?gct?caa gcg?cca?agg 3467

Ser?Leu Lys?Pro?Leu?Leu?Lys Asn?Met?Thr?Ala?Gln Ala?Pro?Arg

1090 1095 1100

cag?aga gta?caa?caa?acc?gac gag?taa?gaaaaaagag?gatgttacca 3514

Gln?Arg Val?Gln?Gln?Thr?Asp Glu

1105 1110

gctgcccgaa?ggcctaagta?tagcattttt?ttttgttttt?tgtatagtaa?caccaattgt 3574

gtgttcgaga?ttggaaagcg?tgatgatgtt?agtgtgctgg?gtatccatct?gtgaagacca 3634

gcgctgccaa?acccgtccac?gatggaggaa?aattgaacag?cggcaagaaa?ctgtgcaaac 3694

gcgaatcaaa?tgtttagcac?agttcttccc?caaaaacacc?agtctcagga?aatcacatgg 3754

cgggcggaag?ttacacatgc?ttttttcata?ccatctctct?tttcctttat?ctcgtgttct 3814

ccaccaaatg?gtggtatttg?tgtaatatgg?c 3845

<210>2

<211>1111

<212>PRT

＜213〉paddy rice (Oryza sativa

<400>2

Met?Lys?Asn?Phe?Phe?Arg?Lys?Leu?His?Ile?Gly?Glu?Gly?Ser?Gly?Asp

1 5 10 15

Gly?Ala?Ser?Ser?Ser?Pro?Pro?Pro?Pro?Pro?Ser?Ser?Arg?Lys?Gly?Ser

20 25 30

Gly?Gly?Val?Gly?Gly?Asn?His?His?Leu?His?Ala?Glu?Gln?Arg?Gln?Pro

35 40 45

Ser?Ala?Ser?Ala?Val?Ser?Ser?Trp?Leu?Asp?Ser?Val?Pro?Gly?Arg?Pro

50 55 60

Gln?Pro?Pro?Thr?Pro?Ser?Thr?Pro?Ser?Glu?Ala?Glu?Gly?Ser?Pro?Phe

65 70 75 80

Ser?Ser?Ser?Val?Gly?Ser?Gly?Ala?Glu?Glu?Arg?Arg?Gln?Ser?Val?Ala

85 90 95

Ala?Glu?Arg?Arg?Arg?Ser?Gln?Glu?Glu?Glu?Trp?Glu?Arg?Arg?Arg?Ser

100 105 110

Gln?Glu?Glu?Glu?Ala?Val?Arg?Glu?Met?Arg?Arg?Ser?Gln?Glu?Glu?Asp

115 120 125

Glu?Val?Glu?Glu?Arg?Val?Ile?Arg?Glu?Ser?Ser?Glu?Ala?Glu?Glu?Arg

130 135 140

Lys?Arg?Val?Arg?Glu?Lys?Glu?Asp?Asp?Asp?Leu?Glu?Glu?Phe?Gln?Leu

145 150 155 160

Gln?Leu?Val?Leu?Glu?Met?Ser?Ala?Arg?Asp?Asn?Pro?Glu?Glu?Met?Glu

165 170 175

Ile?Glu?Val?Ala?Lys?Gln?Ile?Ser?Leu?Gly?Phe?Cys?Pro?Pro?Gln?Ser

180 185 190

Ser?Thr?Ala?Glu?Ala?Leu?Ala?Ala?Arg?Tyr?Trp?Asn?Phe?Asn?Ala?Leu

195 200 205

Gly?Tyr?Asp?Asp?Arg?Ile?Ser?Asp?Gly?Phe?Tyr?Asp?Leu?Tyr?Val?Thr

210 215 220

Gly?Asn?Gly?Pro?Ala?Ser?Ile?Thr?Met?Pro?Ser?Leu?Lys?Asp?Leu?Arg

225 230 235 240

Ala?Gln?Ser?Leu?Ser?His?Arg?Val?Asn?Trp?Glu?Ala?Val?Leu?Val?His

245 250 255

Arg?Gly?Glu?Asp?Pro?Glu?Leu?Met?Lys?Leu?Asp?Gln?Thr?Ala?Leu?Ile

260 265 270

Met?Ser?Leu?Glu?Leu?Arg?Glu?Ser?Lys?Pro?Ser?Glu?Phe?Val?Gly?Asn

275 280 285

Asp?Leu?Val?Gln?Lys?Leu?Ala?Gly?Leu?Val?Ala?Arg?His?Met?Gly?Gly

290 295 300

Thr?Phe?Phe?Asp?Ser?Glu?Gly?Met?Leu?Val?Lys?Tyr?Gln?Lys?Met?Met

305 310 315 320

Arg?Tyr?Leu?Arg?Thr?Ser?Ile?Gly?Ser?Val?Val?Val?Pro?Leu?Gly?Gln

325 330 335

Leu?Lys?Ile?Gly?Leu?Ala?Arg?His?Arg?Ala?Leu?Leu?Phe?Lys?Val?Leu

340 345 350

Ala?Asp?Asn?Ile?Gly?Ile?Pro?Cys?Arg?Leu?Leu?Lys?Gly?Arg?Gln?Tyr

355 360 365

Thr?Gly?Ser?Asp?Asp?Gly?Ala?Leu?Asn?Ile?Val?Lys?Phe?Asp?Asp?Gly

370 375 380

Arg?Glu?Phe?Ile?Val?Asp?Leu?Val?Ala?Asp?Pro?Gly?Thr?Leu?Ile?Pro

385 390 395 400

Ser?Asp?Gly?Ala?Val?Leu?Ser?Thr?Glu?Phe?Glu?Glu?Ser?Ser?Phe?Ser

405 410 415

Asn?Asn?His?His?Phe?Asn?Lys?Asp?Asn?Asp?Ile?Arg?Gln?Leu?Gly?Ser

420 425 430

Ser?Asn?Ser?Leu?Ser?Asn?Ser?Ala?Cys?Ser?Ser?Phe?Glu?Cys?Glu?Leu

435 440 445

Leu?Asp?Arg?Arg?Ser?Thr?Trp?Ile?Asn?Val?Gly?Pro?Ser?Asp?Ser?Asp

450 455 460

Gly?Ala?Thr?Thr?Ser?Gln?Thr?Ser?Lys?Asn?Asn?Gln?Gln?Asn?Thr?Leu

465 470 475 480

Ser?Asp?Ser?Phe?Gly?Ile?Leu?Ser?Val?Ser?Thr?Phe?Thr?Ser?Glu?Asn

485 490 495

Arg?Pro?Ile?Thr?Asn?Glu?Ser?Arg?Ser?Thr?Asp?Asp?Ile?Ala?Ala?Ala

500 505 510

Lys?Asn?Lys?Glu?Arg?Ser?Ser?Val?Thr?Ile?Asn?Ser?Ser?Ser?Thr?Ser

515 520 525

Pro?Ser?Pro?Ser?Ser?Pro?Glu?Val?Gly?Ser?Thr?Pro?Ala?Val?Arg?Arg

530 535 540

Met?Lys?Val?Lys?Asp?Ile?Ser?Glu?Tyr?Met?Ile?Asn?Ala?Ala?Lys?Glu

545 550 555 560

Asn?Pro?Gln?Leu?Ala?Gln?Lys?Ile?His?Glu?Val?Leu?Leu?Glu?Asn?Gly

565 570 575

Val?Val?Ala?Pro?Pro?Asp?Leu?Phe?Ser?Glu?Asp?Ser?Met?Glu?Glu?Pro

580 585 590

Lys?Asp?Leu?Ile?Val?Tyr?Asp?Thr?Thr?Leu?Phe?Gln?Ser?Lys?Asp?Glu

595 600 605

Met?Lys?Lys?Arg?Met?Asn?Glu?Leu?Gly?Ser?Arg?Glu?Tyr?Ala?Asp?Arg

610 615 620

Gly?His?Gly?Pro?Leu?Leu?Pro?His?His?Pro?Gly?His?Glu?Leu?Pro?Ser

625 630 635 640

Lys?Val?Pro?His?Arg?Ala?Pro?Leu?Asp?Ser?Leu?Lys?Pro?Val?Glu?Gly

645 650 655

Leu?Gly?Ile?Asp?His?Pro?Pro?Asp?Ile?Gln?Asp?Asn?Thr?Ser?Phe?Ile

660 665 670

Ser?Gln?Tyr?Glu?Pro?Ser?Ala?Pro?Pro?Gln?Glu?Ala?Ser?Ser?Gln?Leu

675 680 685

Thr?Lys?Gln?Leu?Pro?Val?Thr?Ala?Ala?Ala?Val?Ala?Thr?Ala?Ala?Val

690 695 700

Val?Ala?Ser?Ser?Met?Val?Val?Ala?Ala?Ala?Lys?Ser?Asn?Asn?Asp?Val

705 710 715 720

Asn?Phe?Asp?Val?Pro?Val?Ala?Ala?Ala?Ala?Thr?Val?Thr?Ala?Ala?Ala

725 730 735

Val?Val?Ala?Thr?Thr?Ala?Ala?Val?Ser?Lys?Gln?Tyr?Glu?His?Leu?Glu

740 745 750

Pro?Gly?Asn?Gln?Leu?His?Ser?Leu?Pro?Ser?Pro?Ser?Glu?Gly?Asn?Glu

755 760 765

Ser?Ile?Glu?Lys?Ser?Ala?Asp?Glu?Phe?Trp?Asp?Lys?Gln?Asn?Phe?Glu

770 775 780

Ile?Asp?His?Gly?Gln?Asp?Asn?Thr?Leu?Asp?Gln?Glu?Lys?Asp?Ser?Ala

785 790 795 800

Glu?Val?Arg?Gln?Asp?Ala?Glu?Arg?Thr?Ser?Asp?Lys?Ser?Ser?Gly?Thr

805 810 815

Glu?Ser?Ala?Lys?Ser?Glu?Ile?Thr?Leu?Asp?Asp?Val?Ala?Glu?Phe?Glu

820 825 830

Ile?Gln?Trp?Glu?Glu?Ile?Thr?Ile?Gly?Glu?Arg?Ile?Gly?Leu?Gly?Ser

835 840 845

Phe?Gly?Glu?Val?Tyr?Arg?Gly?Glu?Trp?His?Gly?Thr?Glu?Val?Ala?Val

850 855 860

Lys?Lys?Phe?Leu?Gln?Gln?Asp?Ile?Ser?Ser?Asp?Ala?Leu?Glu?Glu?Phe

865 870 875 880

Arg?Thr?Glu?Val?Arg?Ile?Ile?Lys?Arg?Leu?Arg?His?Pro?Asn?Val?Val

885 890 895

Leu?Phe?Met?Gly?Ala?Ile?Thr?Arg?Val?Pro?Asn?Leu?Ser?Ile?Val?Thr

900 905 910

Glu?Phe?Leu?Pro?Arg?Gly?Ser?Leu?Phe?Arg?Leu?Ile?His?Arg?Pro?Asn

915 920 925

Asn?Gln?Leu?Asp?Glu?Arg?Lys?Arg?Leu?Arg?Met?Ala?Leu?Asp?Val?Ala

930 935 940

Arg?Gly?Met?Asn?Tyr?Leu?His?Asn?Cys?Thr?Pro?Val?Ile?Val?His?Arg

945 950 955 960

Asp?Leu?Lys?Ser?Pro?Asn?Leu?Leu?Val?Asp?Lys?Asn?Trp?Val?Val?Lys

965 970 975

Val?Cys?Asp?Phe?Gly?Leu?Ser?Lys?Met?Lys?Asn?Lys?Thr?Phe?Leu?Ser

980 985 990

Ser?Arg?Ser?Thr?Ala?Gly?Thr?Ala Glu?Trp?Met?Ala?Pro Glu?Val?Leu

995 1000 1005

Arg?Asn Glu?Pro?Ser?Asp?Glu Lys?Cys?Asp?Val?Phe Ser?Tyr?Gly

1010 1015 1020

Val?Ile Leu?Trp?Glu?Leu?Cys Thr?Leu?Leu?Gln?Pro Trp?Gly?Gly

1025 1030 1035

Met?Asn Ala?Met?Gln?Val?Val Gly?Ala?Val?Gly?Phe Gln?Asn?Arg

1040 1045 1050

Arg?Leu Asp?Ile?Pro?Asp?Asn Thr?Asp?Pro?Ala?Ile Ala?Glu?Ile

1055 1060 1065

Ile?Ala Lys?Cys?Trp?Gln?Thr Asp?Pro?Lys?Leu?Arg Pro?Ser?Phe

1070 1075 1080

Ala?Asp Ile?Met?Ala?Ser?Leu Lys?Pro?Leu?Leu?Lys Asn?Met?Thr

1085 1090 1095

Ala?Gln Ala?Pro?Arg?Gln?Arg Val?Gln?Gln?Thr?Asp Glu

1100 1105 1110

Claims

1. the application of gene DSM1 in the paddy drought resistance genetic improvement of controlling paddy drought resistance is characterized in that this gene is one of following nucleotide sequences:

2) the identical protein DNA sequence of 4 encoded protein matter of 159-349 coding and 1).