CN105420270A - Application of AtMAPKKK18 genes to improvements in drought resistance of plants - Google Patents

Abstract

The invention discloses application of AtMAPKKK18 genes to improvements in drought resistance of plants. The AtMAPKKK18 genes are cloned from arabidopsis thaliana through a PCR method and inserted in the downstream part of a CaMV35S promoter in a plant expression vector pBI121, a target plant is transformed to obtain an overexpression transgenic plant, and then drought resistance is greatly improved. The genes and encoding protein thereof have important theoretical and practical significance in research of a plant stress tolerance mechanism and improvements in stress tolerance including drought resistance and correlated characters of plants, will play an important role in stress tolerance genetic engineering improvements in plants and have a broad application prospect.

Description

AtMAPKKK18 gene improves the application of plant drought resistance

Technical field

The invention belongs to molecular biology and biological technical field, be specifically related to the application that AtMAPKKK18 gene improves plant drought resistance.

Background technology

Plant materials, in its growth and development process, can be subject to the impact of various external environment, comprises biotic or abiotic stress, and drought stress is wherein one of most important abiotic stress.In recent years, along with the acute variation of global climate, arid has become a global problem, the impact of drought stress on plant materials is mainly manifested in three aspects: one is destroy plant membrane system, destroy the compartmentation of endomembrane system, make some membrane-bound enzyme loss of activity simultaneously, thus the eubolism of cell is got muddled; Two is the photosynthesis affecting plant, and drought and water shortage can cause stomatal closure, makes CO ₂absorbed dose reduce, photosynthetic rate decline; Three is suppress growing of plant, because the water content of vegetable cell is up to 80%, and moisture is the medium of all enzymatic reactions, therefore moisture reduces the Metabolic activity that will inevitably reduce plant, moisture reduces the respiration that also can strengthen plant simultaneously, material decomposition in acceleration bodies, thus cause crop failure.Therefore, the drought resistance mechanism of research plant, excavate gene related to drought tolerance in plant materials for improve plant drought resistance, improve crop yield and cultivate drought-resistant crops new variety etc. and all there is important Theory and applications be worth.

The present inventor is separated to the cDNA sequence of mitogen activated protein kinase Gene A tMAPKKK18 from Arabidopis thaliana.The plant expression vector of the AtMAPKKK18 of further structure CaMV35S promoters driven, arabidopsis thaliana transformation.The overexpression transgenic arabidopsis drought-resistant ability compared with wildtype Arabidopsis thaliana obtained obviously promotes; And the drought-resistant ability of mutant weakens compared with wild-type.It is minimum for carrying out detecting the percentage of water loss finding transgenic arabidopsis to the percentage of water loss of transgenic arabidopsis, wild-type and mutant, and the percentage of water loss of mutant is maximum.After dormin (ABA) process, the stomatal aperture of transgenic arabidopsis is also minimum.Therefore AtMAPKKK18 gene can be used for plant stress-resistance genetically engineered, improves the drought-resistant ability of plant.

Summary of the invention

The object of the present invention is to provide a kind of arabidopsis gene AtMAPKKK18, be connected on the plant expression vector of CaMV35S promoters driven, the inflorescence dip method arabidopsis thaliana transformation utilizing purulence bacillus to mediate, the transfer-gen plant drought-resistant ability of acquisition obtains and greatly promotes.

The present invention realizes especially by following technical scheme:

The method clone of the present invention by PCR from Arabidopis thaliana obtains AtMAPKKK18 gene, is inserted into the downstream of CaMV35S promotor in plant expression vector pBI121, transformed plant, obtains overexpression transfer-gen plant.

PCR primer described above is:

5’：TCTAGAGTATCATTCTCCAAATGAATTGG

3’：GAGCTCCTAATTCCGTCGAACCGTG

Reaction system is:

PCR amplification system is 25 μ L, and concrete composition is as follows.

Reactions steps is: denaturation: 94 DEG C of 5min;

Cycling condition: 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min;

Circulate 35 times;

Rear extension: 72 DEG C of 10min.

The nucleotide sequence of described AtMAPKKK18 gene is as shown in SEQIDNO.1.

The aminoacid sequence of the proteins encoded of described AtMAPKKK18 gene is as shown in SEQIDNO.2.

The expression vector that a kind of recombinant vectors containing AtMAPKKK18 gene obtains for the downstream that described AtMAPKKK18 gene is inserted CaMV35S promotor in plant expression vector pBI121.

AtMAPKKK18 gene of the present invention is imported in object plant by the described recombinant vectors containing AtMAPKKK18 gene.

The invention provides the application of AtMAPKKK18 gene in transfer-gen plant drought resisting, the transgenic line drought-resistant ability obtained obviously strengthens.

Present invention also offers the application of recombinant vectors in transfer-gen plant drought resisting containing AtMAPKKK18 gene.

The transgenic experiments of arabis protein AtMAPKKK18 gene of the present invention proves, this gene participates in growing of regulating plant and the process such as stress response, thus provides a Fineness gene for the improvement of plant variety.The AtMAPKKK18 gene of expressing in Arabidopis thaliana can improve the drought-resistant ability of plant.

Accompanying drawing explanation

Fig. 1 is the amplified production electrophorogram of AtMAPKKK18 gene;

Fig. 2 is AtMAPKKK18 gene clone carrier electrophorogram; 1,2, No. 3 swimming lane bacterial plaques are positive colony, and No. 4 swimming lanes are PCR positive control;

Fig. 3 is the restriction enzyme digestion and electrophoresis of AtMAPKKK18 gene clone carrier and pBI121 carrier;

Fig. 4 transforms the expression vector having the positive bacterial plaque of AtMAPKKK18; 1, No. 3 swimming lanes are positive colony, and No. 4 swimming lanes are positive control;

Fig. 5 is double digestion expression vector plasmid electrophoresis;

Fig. 6 is that AtMAPKKK18 expression vector transformation Agrobacterium GV3101 bacterium liquid PCR detects electrophoresis; 2,7, No. 8 swimming lanes are positive colony, and No. 9 swimming lanes are positive control;

Fig. 7 is the qualification of AtMAPKKK18 overexpression transgenic positive seedling; 1,2,4,5,6,7,8,9 is positive seedling;

Fig. 8 is the qualification of AtMAPKKK18 overexpression transgenic homozygous body strain expression amount;

Fig. 9 is that T-DNA inserts schematic diagram;

Figure 10 is the qualification of AtMAPKKK18T-DNA insertion mutation body;

Figure 11 is the qualification of mutant expression amount;

Figure 12 is the survival rate statistical graph of wild-type, overexpression strain and mutant;

Figure 13 is the percentage of water loss statistics broken line graph of AtMAPKKK18 overexpression strain and mutant.

Embodiment

Below in conjunction with embodiment, the present invention is described further, the following stated, only to preferred embodiment of the present invention, not do other forms of restriction to the present invention, any those skilled in the art may utilize the technology contents of above-mentioned announcement to be changed to the Equivalent embodiments of equal change.Everyly do not depart from the present invention program's content, any simple modification done following examples according to technical spirit of the present invention or equivalent variations, all drop in protection scope of the present invention.

The isolation identification of embodiment 1AtMAPKKK18 gene

1, TRIZOL method extracts Arabidopis thaliana total serum IgE, and method is as follows:

(1) in 1.5mL centrifuge tube, 1mLTrizol extracting solution is added;

(2) material of 0.1g liquid nitrogen grinding is added, mixing, after room temperature places 5min, 4 DEG C, the centrifugal 10min of 12000g;

(3) get supernatant, add 0.2mL chloroform, acutely shake 15s, room temperature places 2-3min, 4 DEG C, the centrifugal 15min of 12000g;

(4) water intaking phase, adds 0.5mL Virahol, and room temperature places 10min, and 4 DEG C, the centrifugal 10min of 12000g, gets precipitation;

(5) by 75% cold washing with alcohol precipitation, 4 DEG C, the centrifugal 5min of 7500g;

(6) supernatant is removed, with 50 μ LDEPC-H after precipitation is dry ₂o dissolves, electrophoresis or mensuration absorbance detection RNA quality ,-80 DEG C of preservations.

2, the removal of genomic dna in total serum IgE

42 DEG C of reaction 2min.

3, the reverse transcription of RNA

37 DEG C of reaction 15min, 85 DEG C of reaction 5sec, obtain reverse transcription cDNA.

Genome removal and RNA Reverse Transcription are all purchased from TAKARA company.

4, the amplification of AtMAPKKK18 gene

(1) amplimer is:

3K18-5’：TCTAGAATGAATTGGACTAGAGGAAAAACTTTAG

3K18-3’：GAGCTCCTAATTCCGTCGAACCGTG

Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

(2) amplification system is:

R-Taq enzyme, dNTP is purchased from TAKARA company.

(3) amplification condition is:

Denaturation: 94 DEG C of 5min;

Cycling condition: 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min; Circulate 35 times;

Rear extension: 72 DEG C of 10min.

(4) after reaction terminates, carry out agarose gel electrophoresis, testing goal band, and cut the AtMAPKKK18 full length sequence (Fig. 1) that glue reclaims the 1020bp obtained that increases, for subsequent experimental.

The acquisition of embodiment 2 transgenic line

1, the structure of AtMAPKKK18 cloning vector

(1) the AtMAPKKK18 sequence fragment reclaimed is connected pMD19-Tsimple carrier, the mole ratio of Insert Fragment and carrier is 3:1.Ligation system is:

Reaction system mixed, 16 DEG C connect 3 hours.PMD19-Tsimple carrier and Solution I are all purchased from TAKARA company.

(2) product conversion intestinal bacteria are connected.Method for transformation is:

1. 50 μ L competent cells are got, ice bath melted.

2. add 5 μ L and connect product, mix gently, leave standstill 20min on ice.

3., in 42 DEG C of water-baths after heat shock 90s, 2min is placed on ice.

4. 900 μ LLB liquid nutrient mediums are added, 37 DEG C, 200-250rpm shaking culture 1h.

5. room temperature, the centrifugal 1min of 8000rpm, abandons 850 μ L supernatants, residue supernatant suspension cell.

6. 50 μ L suspension cells are coated on containing on the antibiotic LB solid medium of ammonia benzyl, are inverted for 37 DEG C and cultivate 12h.

(3) qualification of positive colony.

1. single bacterium colony to the 500 μ L choosing cultured on solid medium contains in the antibiotic LB liquid nutrient medium of ammonia benzyl, 37 DEG C, 200-250rpm shaking culture 2h.

2. bacterium liquid PCR identifies, reaction system is:

Reaction conditions is:

Denaturation: 94 DEG C of 5min;

Cycling condition: 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min; Circulate 35 times;

Rear extension: 72 DEG C of 10min.

3. after reaction terminates, carry out agarose gel electrophoresis, select the positive bacterial plaque transforming and have AtMAPKKK18, result is as Fig. 2, and 1,2, No. 3 swimming lane bacterial plaque is positive colony, and No. 4 swimming lanes are PCR positive control.Select No. 1 positive colony order-checking, comparison result is consistent with the full length sequence of the ATMAPKKK18 that TAIR website (https: //www.arabidopsis.org/) provides, and cloned sequence can be used.

2, the structure of AtMAPKKK18 expression vector

(1) from intestinal bacteria No. 1 positive colony, cloning vector plasmids and pBI121 plasmid is extracted.Plasmid extraction uses the little extraction reagent kit of OMEGA plasmid (PlasmidMiniKit I), and leaching process refers to specification sheets.

(2) double digestion cloning vector plasmids and pBI121 plasmid.The enzyme system of cutting is:

After mixing, under 37 DEG C of conditions, react 20min.

(3), after reaction terminates, carry out agarose gel electrophoresis, all successful enzyme of result two plasmids is cut, as Fig. 3.Cut glue recovery enzyme and cut the AtMAPKKK18 full length fragment and pBI121 carrier segments that obtain, for subsequent experimental.

(4) connection of expression vector

The mole ratio of Insert Fragment and carrier is 2 ~ 10:1.Ligation system sees the following form.

(5) product conversion intestinal bacteria are connected.Method for transformation builds with cloning vector.

(6) qualification of positive colony.

1. single bacterium colony to the 500 μ L choosing cultured on solid medium contains in that antibiotic LB liquid nutrient medium of card, 37 DEG C, 200-250rpm shaking culture 2h.

2. bacterium liquid PCR identifies, reaction system and reaction conditions are identified with cloning vector bacterium liquid PCR.

3. after reaction terminates, carry out agarose gel electrophoresis, select the positive bacterial plaque transforming and have AtMAPKKK18, result is as Fig. 4, and 1, No. 3 swimming lane is positive colony, and No. 4 swimming lanes are positive control.

(7) from No. 1 intestinal bacteria, expression vector plasmid is extracted.Plasmid extraction uses the little extraction reagent kit of OMEGA plasmid (PlasmidMiniKit I), and leaching process refers to specification sheets.

(8) double digestion expression vector plasmid.Enzyme cuts system and reaction conditions with cloning vector building process.

(9) after reaction terminates, carry out agarose gel electrophoresis, results expression vector plasmid success enzyme is cut, as Fig. 5.Be successfully completed expression vector establishment.

3, AtMAPKKK18 expression vector transformation Agrobacterium GV3101

(1) expression vector successfully constructed is utilized freeze-thaw method transformation Agrobacterium GV3101, method for transformation is as follows:

1. ice bath melted Agrobacterium GV3101 competent cell;

2. add 3 μ L expression vector plasmids, ice bath 30min, freezes 1min in liquid nitrogen, then at 37 DEG C of water-bath 5min;

3. 900 μ L are added not containing antibiotic YEP substratum, 28 DEG C, 200rpm, shaking culture 4h;

4. room temperature, the centrifugal 1min of 8000rpm, with concentrated bacterium liquid, abandons after supernatant with 100 μ LYEP liquid nutrient medium back dissolving thalline;

5. the thalline after back dissolving is applied on the solid YEP substratum of additional 50mg/L kantlex and 100mg/L Rifampin, cultivates 36h for 28 DEG C.

(2) bacterium liquid PCR detects positive colony, and PCR system and reaction conditions are identified with cloning vector bacterium liquid PCR, and result is as Fig. 6, and 2,7, No. 8 swimming lanes are positive colony, and No. 9 swimming lanes are positive control.Select No. 2 to clone and preserve bacterial classifications for subsequent experimental.

4, the acquisition of AtMAPKKK18 overexpression transgenic line

(1) utilize agriculture bacillus mediated inflorescence dip method arabidopsis thaliana transformation, method for transformation is as follows:

1. the positive bacterial classification of No. 2 Agrobacteriums previous step identified, ruling containing on the LB solid medium of 50 μ g/mL, is put in 28 DEG C of incubators, and lucifuge is inverted and is cultivated 36h to growing single bacterium colony;

2. the single bacterium colony of picking Agrobacterium, add 6mL and contain in the LB liquid nutrient medium of 50 μ g/mL, 28 DEG C of incubated overnight are 0.6-0.8 to OD600;

3., under room temperature, 6000rpm, centrifugal 5min, collect thalline;

4. 6mL dip-dyeing solution (5% sucrose, 0.03-0.05%silwetL-77) suspension thalline is used, mixing;

5. the inflorescence of Arabidopis thaliana is dipped in dip-dyeing solution, contaminate 10-15s, then by Arabidopis thaliana take out put into camera bellows, above overlay film, dark culturing 1d;

6. Arabidopis thaliana is taken out, normally cultivate under the long day, contaminated once every 5-7 days, general dip-dye 3-4 time;

7. results contaminate the Arabidopis thaliana seed of after ripening, are labeled as T ₀in generation, store after dry.

(2) qualification of transgenic positive seedling

1. by the Arabidopis thaliana T of results ₀for program request after seed disinfection on the 1/2MS substratum containing 40 μ g/mL kantlex;

2. culture dish to be put in 22 DEG C of illumination boxs germination and growth 7 days;

3. select and normal growth, cotyledon can normally turn green seedling replanting in soil containing on the substratum of kantlex, result transplants 10 strain seedling altogether, carries out 1-10 numbering to seedling, puts in 22 DEG C of long day constant temperature culture rooms and grows;

4., when Arabidopis thaliana growth 20-30 days, extract the full-length genome of 1-10 strain respectively, extracting method is as follows:

I. get the plant leaf that 0.1g is fresh, pulverize in liquid nitrogen;

II. powder is forwarded in the 1.5mL centrifuge tube of precooling, adds 2 × CTAB Extraction buffer of 500 μ L65 DEG C preheatings immediately, fully mix, 65 DEG C of insulation 30min, shake therebetween frequently;

III. add isopyknic chloroform, concuss centrifuge tube mixing 15s, under room temperature, 12000rpm, centrifugal 10min, proceed to supernatant liquor in new 1.5mL centrifuge tube, repeat this step once;

IV. add 2 times of volume dehydrated alcohols, mix ,-20 DEG C of standing 1h;

V. under room temperature, 12000rpm, centrifugal 10min, thoroughly removes supernatant liquor, and drying at room temperature precipitates;

VI. with the aseptic ddH of 50 μ L ₂o back dissolving precipitates.

5. by the method qualification transgenic positive seedling of PCR,

I. in order to get rid of the impact of the AtMAPKKK18 gene of Arabidopis thaliana self, select the full length sequence 1660bp altogether of amplification 35s+AtMAPKKK18, PCR primer is:

35s-5’：CCAGTATGGACGATTCAAGGCT

3K18-3’：GAGCTCCTAATTCCGTCGAACCGTG

Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..

II. amplification system is:

Reaction conditions is with the amplification condition of AtMAPKKK18 gene.

III. after reaction terminates, carry out agarose gel electrophoresis, testing goal band, detected result is as Fig. 7, and the seedling that wherein 1,2,4,5,6,7,8, No. 9 swimming lane is corresponding is positive seedling.Can be used for follow-up breeding, obtain homozygote.

5, the acquisition of AtMAPKKK18 overexpression transgenic homozygous body strain

(1) above PCR identifies the transgenic positive seedling obtained, and after seed maturity, gathers in the crops and is labeled as T ₁generation;

(2) T ₁for program request after seed disinfection on the 1/2MS substratum containing 40 μ g/mL kantlex;

(3) culture dish to be put in 22 DEG C of illumination boxs germination and growth 7 days;

(4) select and normal growth, cotyledon can normally turn green seedling replanting in soil containing on the substratum of kantlex, each strain transplants 40-50, and single numbering after transplanting, puts 22 DEG C of long day illumination cultivation room incubation growth by seedling;

(5) single results after seed maturity, and be labeled as T ₂generation;

(6) each T ₂after getting the seed disinfection of 100-200 grain for strain, program request is on the 1/2MS solid medium containing 40 μ g/mL kantlex;

(7) culture dish to be put in 22 DEG C of illumination boxs germination and growth 7 days;

(8) each T is added up ₂for the growing state of strain on substratum, if all seedling all can normal growth and cotyledon normally turns green, then this strain is T ₂for transgenic homozygous body strain;

(9) by T ₂be transplanted in soil for transgenic homozygous body strain, breed a large amount of T ₃for transgenic homozygous body seed, belong to identical T ₀seed for strain mixes, and uses in order to subsequent experimental.

6, the qualification of AtMAPKKK18 overexpression transgenic homozygous body strain expression amount

(1) by T ₃for program request after the seed disinfection of transgenic homozygous body on 1/2MS substratum;

(2) culture dish is put germination and growth 7-10 days in 22 DEG C of illumination boxs;

(3) extract seedling total serum IgE, reverse transcription becomes cDNA;

(4) carry out RT-PCR with the special primer of AtMAPKKK18 gene internal, detect the expression amount of AtMAPKKK18 in different transgenic line.

I. internal reference primer sequence is:

EF1-α5’：GTATGGTTGTTACCTTTGCTCCCACAG

EF1-α3’：CATCATTTGGCACCCTTCTTCACTGC

II .AtMAPKKK18 specific amplified fragment total length 468bp, primer sequence is:

RT-5’：GGAGAGAGACAAGGGAAAGAGAG

RT-3’：CCAATCCTCACCGTCCAAGTC

III .RT-PCR detects overexpression strain expression amount:

Extract the total serum IgE of each overexpression strain and wild-type (WT) strain respectively and reverse transcription cDNA, extracting method and reverse transcription method are as previously mentioned.Consistent by PCR method adjustment reference gene EF1-α brightness afterwards, then adding in the reaction system of same template amount with reference gene the AtMAPKKK18 gene that increases, by the bright weak height judging overexpression strain expression amount of electrophoretic band.Result as shown in Figure 8, selects expression amount relatively high No. 1 and No. 6 strains for subsequent experimental analysis.

The screening of embodiment 3AtMAPKKK18T-DNA insertion mutation body

1, T-DNA insertion mutation body is bought

Buy the T-DNA insertion mutation body of AtMAPKKK18 from Arabidopis thaliana TAIR website, mutant number is GK-244G02, and insertion point is 678 Nucleotide places in AtMAPKKK18 gene extron subarea, this mutant called after 3k18, T-DNA is inserted schematic diagram as Fig. 9:

2, three-primer method qualification T-DNA inserts

(1) from the mutant seeds bought, random choose 20 program requests, in soil, to put in 22 DEG C/16h long day culturing room incubation growth 30 days;

(2) 20 strain Arabidopis thaliana seedling individual plants to be screened numbered and extracted genome, extracting wild type gene group simultaneously;

(3) with the genome extracted for template, the right arm primer (RP) of the primer on T-DNA (BP) and T-DNA insertion point is utilized to increase, if electrophoresis can detect the amplified fragments of 832bp, then illustrating has T-DNA to insert, if can't detect the amplified fragments of correct size, illustrate that this strain does not have T-DNA to insert, the detected result of 3k18 as shown in Figure 10;

(4) with the genome extracted for template, the right arm primer (RP) of T-DNA insertion point and left arm primer (LP) is utilized to increase, if electrophoresis can not detect the amplified fragments of 1251bp, then illustrate that this strain is that T-DNA inserts homozygote strain, if the amplified fragments of 1251bp can be detected, illustrate that this strain is that wild-type or T-DNA insert heterozygote strain (the detected result comprehensive descision that combination walks), the detected result of 3k18 as shown in Figure 10;

Amplimer is:

BP：GGGCTACACTGAATTGGTAGCTC

RP：CAACAACGGAGAAGCTACGAC

LP：GCCTTCATTTCTCACTTTCCC

PCR reaction system and reaction conditions identical with reaction conditions with the amplification system of AtMAPKKK18.

Three-primer method PCR result shows that 3,11, No. 19 strains are heterozygote, and 1,2,4,5,6,7,8,9,10,12,13,14,15,16,17,18, No. 20 strain is homozygote.WT is as reaction system and reaction conditions contrast.

3, RT-PCR detects mutant expression amount

Detection primer and detection method are identified identical with overexpression strain expression amount, detected result is as shown in figure 11: cannot increase in 3k18 mutant and obtain AtMAPKKK18 gene fragment, therefore judge the afunction mutant of 3k18 mutant as AtMAPKKK18 gene.

The drought-resistant ability analysis of embodiment 4AtMAPKKK18 overexpression strain and mutant

1,1, No. 6 overexpression plant of wild-type, AtMAPKKK18 and 3k18 mutant are seeded in same seedling pan, cultivate 5 weeks under 22 DEG C of short day conditions.

2,5 weeks aftertreatment groups stop watering, and control group normally waters, and continue to cultivate two weeks under 22 DEG C of short day conditions.

3, after process in two weeks terminates, recover normally to water to Osmotic treatment group, control group normally waters, then cultivates two weeks under 22 DEG C of short day conditions.

4, the survival rate of wild-type, overexpression strain and mutant is finally added up respectively, process picture and survival rate statistics are as shown in figure 12, the survival rate of survival rate statistical result showed overexpression transgenic line after Osmotic treatment will apparently higher than wild-type and 3k18 mutant, and this shows that the overexpression of AtMAPKKK18 gene can significantly improve the drought-resistant ability of Arabidopis thaliana strain.

The percentage of water loss statistics of embodiment 5AtMAPKKK18 overexpression strain and mutant

1,1, No. 6 overexpression plant of wild-type, AtMAPKKK18 and 3k18 mutant are seeded in same seedling pan, cultivate 5 weeks under 22 DEG C of short day conditions.

2, after 5 weeks, random choose is divided into one group with 5 young plants trying altogether strain, and wild-type, mutant and two overexpression strains respectively get 5 groups.

3, in units of group, take gross weight, be designated as M ₀, then place and make its dehydration at ambient temperature; Weigh once every 30min, weight is recorded as M successively ₁, M ₂m ₁₀, until little the stopping constantly of dehydration 5 weighs, weighing result is in table 1 ~ 4:

Table 1

OE1	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0.2508g	0.2376g	0.322g	0.276g	0.302g
M 1(0.5h)	0.2298g	0.2143g	0.2906g	0.2502g	0.2716g
						M 2(1h)	0.2208g	0.2027g	0.2739g	0.2401g	0.2577g
M 3(1.5h)	0.2132g	0.1874g	0.2546g	0.2318g	0.2446g

M 4(2h)	0.2084g	0.1796g	0.2435g	0.2218g	0.2325g
						M 5(2.5h)	0.2016g	0.1704g	0.2318g	0.2133g	0.2215g
M 6(3h)	0.1964g	0.1604g	0.2192g	0.2015g	0.2134g
						M 7(3.5h)	0.1912g	0.1512g	0.2086g	0.1942g	0.1993g
M 8(4h)	0.1848g	0.1422g	0.1978g	0.1877g	0.1903g
						M 9(4.5h)	0.178g	0.1353g	0.1886g	0.1784g	0.1822g
M 10(5h)	0.171g	0.1297g	0.1795g	0.1711g	0.1752g

Table 2

OE6	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0.266g	0.2928g	0.2164g	0.2512g	0.3159g
M 1(0.5h)	0.2448g	0.2676g	0.1996g	0.2302g	0.2889g
						M 2(1h)	0.234g	0.2528g	0.1884g	0.2188g	0.2734g
M 3(1.5h)	0.224g	0.2424g	0.1796g	0.21g	0.2615g
						M 4(2h)	0.2164g	0.2308g	0.1736g	0.2013g	0.2504g
M 5(2.5h)	0.2068g	0.2204g	0.166g	0.1925g	0.2394g
						M 6(3h)	0.2g	0.21g	0.158g	0.185g	0.2284g
M 7(3.5h)	0.1932g	0.2008g	0.1516g	0.1775g	0.2205g
						M 8(4h)	0.1852g	0.1904g	0.1452g	0.1701g	0.2079g
M 9(4.5h)	0.1768g	0.1816g	0.1428g	0.1625g	0.1983g
						M 10(5h)	0.168g	0.1732g	0.1348g	0.1548g	0.189g

Table 3

WT	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0.4175g	0.316g	0.3405g	0.3852g	0.3293g
M 1(0.5h)	0.378g	0.2855g	0.306g	0.3476g	0.2973g
						M 2(1h)	0.3465g	0.266g	0.2845g	0.3243g	0.2743g
M 3(1.5h)	0.32g	0.2505g	0.2685g	0.3052g	0.2544g
						M 4(2h)	0.3g	0.239g	0.2565g	0.2896g	0.2412g
M 5(2.5h)	0.2815g	0.228g	0.2435g	0.2742g	0.2313g
						M 6(3h)	0.263g	0.2175g	0.23g	0.2587g	0.2181g
M 7(3.5h)	0.248g	0.208g	0.2185g	0.2471g	0.2048g
						M 8(4h)	0.2315g	0.1965g	0.22102g	0.2355g	0.1916g
M 9(4.5h)	0.2185g	0.1873g	0.194g	0.2224g	0.1817g
						M 10(5h)	0.2028g	0.1702g	0.1821g	0.2062g	0.1685g

Table 4

3k18	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0.3075g	0.3955g	0.351g	0.3692g	0.3116g
M 1(0.5h)	0.2747g	0.3555g	0.3115g	0.3294g	0.2788g
						M 2(1h)	0.253g	0.3202g	0.2815g	0.296g	0.2523g
M 3(1.5h)	0.234g	0.2925g	0.2575g	0.2738g	0.2336g
						M 4(2h)	0.2201g	0.2725g	0.2388g	0.2554g	0.2212g
M 5(2.5h)	0.2035g	0.2508g	0.2209g	0.2295g	0.2056g
						M 6(3h)	0.1903g	0.2306g	0.2038g	0.2219g	0.1931g
M 7(3.5h)	0.1788g	0.2155g	0.188g	0.1998g	0.1807g

M 8(4h)	0.1654g	0.2001g	0.1765g	0.1889g	0.1712g
						M 9(4.5h)	0.1555g	0.187g	0.1661g	0.1776g	0.1619g
M 10(5h)	0.1432g	0.1731g	0.1533g	0.1628g	0.1495g

4, according to formulae discovery, often group is in the percentage of water loss of each time point, and calculation formula is (M ₀-M _x)/M ₀× 100%, calculation result is in table 5 ~ 8 (it is significant figure that calculation result gets 2 significant digits):

Table 5

OE1	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0％	0％	0％	0％	0％
M 1(0.5h)	8.37％	9.81％	9.75％	9.35％	10.07％
						M 2(1h)	11.96％	14.69％	14.94％	13.01％	14.67％
M 3(1.5h)	14.99％	21.13％	20.93％	16.01％	19.01％
						M 4(2h)	16.91％	24.41％	24.38％	19.64％	23.01％
M 5(2.5h)	19.62％	28.28％	28.01％	22.72％	26.66％
						M 6(3h)	21.69％	32.49％	31.93％	26.99％	29.34％
M 7(3.5h)	23.76％	36.36％	35.22％	29.64％	34.01％
						M 8(4h)	26.32％	40.15％	38.57％	31.99％	36.99％
M 9(4.5h)	29.03％	43.06％	41.43％	35.36％	39.67％
						M 10(5h)	31.82％	45.41％	44.25％	38.01％	41.99％

Table 6

OE6	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0％	0％	0％	0％	0％
M 1(0.5h)	7.97％	8.61％	7.76％	8.36％	8.55％
						M 2(1h)	12.03％	13.66％	12.94％	12.90％	13.45％
M 3(1.5h)	15.79％	17.21％	17.01％	16.40％	17.22％
						M 4(2h)	18.65％	21.17％	19.78％	19.86％	20.73％
M 5(2.5h)	22.26％	24.73％	23.29％	23.37％	24.22％
						M 6(3h)	24.81％	28.28％	26.99％	26.35％	27.70％
M 7(3.5h)	27.37％	31.42％	29.94％	29.34％	30.20％
						M 8(4h)	30.38％	34.97％	32.90％	32.29％	34.19％
M 9(4.5h)	33.53％	37.98％	34.01％	35.31％	37.23％
						M 10(5h)	36.84％	40.85％	37.71％	38.38％	40.17％

Table 7

WT	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0％	0％	0％	0％	0％
M 1(0.5h)	9.46％	9.65％	10.13％	9.76％	9.72％
						M 2(1h)	17.01％	15.82％	16.45％	15.81％	16.70％
M 3(1.5h)	23.35％	20.73％	21.15％	20.77％	22.75％
						M 4(2h)	28.14％	24.37％	24.67％	24.82％	26.75％
M 5(2.5h)	32.57％	27.85％	28.49％	28.82％	29.76％

M 6(3h)	37.01％	31.17％	32.45％	32.84％	33.77％
						M 7(3.5h)	40.60％	34.18％	35.83％	35.85％	37.81％
M 8(4h)	44.55％	37.82％	38.27％	38.86％	41.82％
						M 9(4.5h)	47.66％	40.73％	43.02％	42.26％	44.82％
M 10(5h)	51.43％	46.14％	46.52％	46.47％	48.83％

Table 8

3k18	One group	Two groups	Three groups	Four groups	Five groups
						M 0(0h)	0％	0％	0％	0％	0％
M 1(0.5h)	10.67％	10.11％	11.25％	10.78％	10.53％
						M 2(1h)	17.72％	19.04％	19.80％	19.83％	19.03％
M 3(1.5h)	23.90％	26.04％	26.64％	25.84％	25.03％
						M 4(2h)	28.42％	31.10％	31.97％	30.82％	29.01％
M 5(2.5h)	33.82％	36.59％	37.07％	37.84％	34.02％
						M 6(3h)	38.11％	41.69％	41.94％	39.90％	38.03％
M 7(3.5h)	41.85％	45.51％	46.44％	45.88％	42.01％
						M 8(4h)	46.21％	49.41％	49.72％	48.84％	45.06％
M 9(4.5h)	49.43％	52.72％	52.68％	51.90％	48.04％
						M 10(5h)	53.43％	56.23％	56.32％	55.90％	52.02％

5, calculate mean value and standard deviation that 4 are tried strain 5 groups of experimental group altogether, draw percentage of water loss broken line graph, as shown in figure 13.Significantly can find out that the percentage of water loss of two overexpression strains of AtMAPKKK18 in each monitoring point is all obvious lower than wild-type by percentage of water loss statistics, and the percentage of water loss of 3k18 mutant is higher than wild-type and overexpression transgenic line, illustrate that overexpression AtMAPKKK18 gene effectively can reduce the rate-of-loss of coolant of excised leaf thus.

Claims (6)

1.AtMAPKKK18 gene improves the application of plant drought resistance.

2. application according to claim 1, is characterized in that: the nucleotide sequence of described AtMAPKKK18 gene is as shown in SEQIDNO.1.

3. application according to claim 2, is characterized in that: the aminoacid sequence of the proteins encoded of described AtMAPKKK18 gene is as shown in SEQIDNO.2.

4. application according to claim 1, is characterized in that: described AtMAPKKK18 gene is imported in object plant by the described recombinant vectors containing AtMAPKKK18 gene.

5. the recombinant vectors containing AtMAPKKK18 gene described in claim 1, is characterized in that: the expression vector obtained for the downstream that described AtMAPKKK18 gene is inserted CaMV35S promotor in plant expression vector pBI121.

6. the application of recombinant vectors in transfer-gen plant drought resisting containing AtMAPKKK18 gene according to claim 5.