CN101037474A - G protein coupling receptor and abscisic acid receptor and its encoding gene and application - Google Patents

Abstract

The invention discloses a G protein-coupled receptor and abscisic acid receptor and its code gene and application. The G protein-coupled receptor and abscisic acid receptor is following (a) or (b) protein: (a) a protein composed by amino acid residue sequence in the sequence table sequence 2; (b) a protein with a amino acid sequence in the sequence table sequence 2 being one or more amino acid residue substitution and/or deletion and/or addition and can be reacted with G protein and combined with abscisic acid, deriving from (a). We changes and effects the plant reaction to the adversity such as drought, low temperature and etc. by adjusting the expression and activity of the G protein-coupled receptor and abscisic acid receptor.

Description

A kind of g protein coupled receptor and dormin acceptor and its encoding gene and application

Technical field

The present invention relates to a kind of g protein coupled receptor and dormin acceptor and its encoding gene and application.

Background technology

Dormin (Abscisic acid ABA) is a kind of important plant hormone, and its participates in the g and D process of the numerous plant of regulation and control, particularly plant to adverse circumstance, play a significant role in the reaction as arid, saline and alkaline, low temperature etc.In view of the vital role of ABA in plant, people to effect and the mechanism thereof of ABA carried out in a large number, extensive studies, at present people have had considerable understanding to the component in the ABA signal transduction pathway.Two nearest reports show that localized rna binding protein FCA of a kind of nucleus and the localized participation chlorophyll of a kind of chloroplast(id) synthetic CHLH subunit also may be the acceptors of ABA.Yet FCA does not participate in typical A BA reaction, and as seed germination, stomatal movement etc., and the insensitive mutant of ABA do not have the phenotype of FCA mutant yet, shows that FCA is not the principal recipient of ABA.Numerous results of study in the past show that the acceptor site of ABA surveys outside cytoplasmic membrane, so the ABA acceptor on other the ABA acceptor, particularly plasma membrane may be the Primary Actor who participates in the reaction of ABA adverse circumstance.

Cellular signal transduction pathways by g protein coupled receptor (GPCR) mediation is a signal transduction mechanism relatively more conservative in eukaryote.The binding mode of sort signal transduction mechanism is: GPCR is positioned on the plasma membrane, its structural domain of surveying outside plasma membrane is accepted extracellular signal, and the cell intracellular domain of GPCR and the coupling mutually of heterotrimer G albumen, thereby further signal is handed on by G albumen.The signal pathway of GPCR mediation is one of most important signal transduction pathway in zooblast, realizes by the signal pathway of GPCR mediation such as the perception of animal to vision, the sense of taste, sense of smell.GPCR and G kinds of proteins are also a lot of in the animal, nearly 1000 kinds of GPCR in the cell as the people, more than 20 kind of G α, 6 kinds of G β and 12 kinds of G γ (Morris, A.J.﹠amp; Malbon, C.C.Physiological regulation of G protein-linked signalling.Physiol.Rev.79,1373-1430 (1999); Spiegel, A.M.﹠amp; Weinstein, L.S.Inherited diseasesinvolving G proteins and G protein-coupled receptors.Annu.Rev.Med.55,27-39 (2004)).The approach of GPCR mediation changes and can cause the generation of multiple disease, and now used clinically medicine about 50% designs at GPCR.In contrast, GPCR in the higher plant and G kinds of proteins are then very limited, as having only a kind of G α (GPA1), a kind of G β (AGB1) and 2 kinds of G γ (AGG1 and AGG2) in the model animals arabidopsis gene group, and up to the present have only a kind of GPCR (GCR1) to be compared at length and studied, also do not find the aglucon of any GPCR at present in the plant.

Summary of the invention

An object of the present invention is to provide a kind of g protein coupled receptor and dormin acceptor and its encoding gene.

G protein coupled receptor provided by the present invention and dormin acceptor, name is called GCR2, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and can with the G protein-interacting and can with the dormin bonded by (a) deutero-protein.

Wherein, the sequence in the sequence table 2 is made up of 401 amino-acid residues.

Can lack from N-terminal 290-401 amino acids residue and/or add in the replacing of sequence 2 from N-terminal 1-50 amino acids residue.

For the GCR2 in (a) is convenient to purifying, proteinic N end or C end that can the amino acid residue sequence of sequence 2 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	11	EQKLISEEDL

Above-mentioned (b) but in the GCR2 synthetic, also can synthesize its encoding gene earlier, carry out biology again and express and to obtain.The encoding gene of GCR2 in above-mentioned (b) can pass through SEQ ID № in the sequence table: the codon of one or several amino-acid residue of disappearance in 1 the dna sequence dna, and/or carry out the missense mutation of one or several base pair, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

Above-mentioned g protein coupled receptor and dormin acceptor encoding gene (GCR2) also belong to protection scope of the present invention.

The encoding gene of described g protein coupled receptor and dormin acceptor, its nucleotide sequence are the proteinic polynucleotide of sequence 2 in the code sequence tabulation.

The encoding sequence of the encoding gene of described g protein coupled receptor and dormin acceptor can be the nucleotide sequence from 5 ' terminal the 1st to 1206 deoxyribonucleotides composition of sequence 1 in the sequence table.

The encoding gene of described g protein coupled receptor and dormin acceptor specifically can be following 1) or 2) gene:

1) its nucleotide sequence is the sequence 1 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of coding g protein coupled receptor and dormin acceptor.

Described stringent condition can be at 0.1 * SSPE and (or in the solution of 0.1 * SSC), 0.1% SDS, 65 ℃ of following hybridization, and washes film with this solution.

Sequence 1 in the sequence table is made up of 1206 deoxyribonucleotides.

The nucleotide sequence of the genomic gene of described g protein coupled receptor and dormin acceptor is the sequence 3 in the sequence table, is made up of 1662 deoxyribonucleotides.

The recombinant expression vector, transgenic cell line and the transformed host bacterium that contain the encoding gene of above-mentioned g protein coupled receptor and dormin acceptor all belong to protection scope of the present invention.

Can escape differently with animal immediately running into adverse environment, plant is rooted on the soil and can not moves, so adverse circumstance to external world can not be escaped, can only select to stand and resist.Plant to external world in the adverse circumstance opposing reaction, plant hormone ABA is bringing into play important effect, plant relies on ABA to a great extent to the opposing of adverse circumstance, so the research plant is accepted the molecular mechanism of ABA signal important significance for theories is arranged not only, but also has the great application prospect of potential.The following experimental result proof GCR2 of the present invention is the principal recipient of ABA and the reaction that participates in regulation and control ABA mediation: 1, the gcr2 mutant is to the institute of ABA all disappearances that responds; 2, overexpression GCR2 is to the reaction hypersensitization of ABA; 3, GCR2 can be in conjunction with ABA, and satisfies the receptor kinetics feature; 4, GCR2 is positioned on the cytoplasmic membrane; 5, GCR2 and G protein alpha subunit GPA1 interact; 6, ABA combines with GCR2 and causes the GCR2-GPA1 complex body to dissociate, and then free G α deexcitation downstream effect device.The present invention confirms that not only GCR2 is the acceptor of ABA, but also gets the signal transduction pathway of accepting and transmitting except the ABA signal clear, and has found that first the g protein coupled receptor-aglucon in the families of plant is right.In view of the above, expression that can be by regulating GCR2 and activity change and influence the reaction of plant to adverse circumstance (as arid, low temperature etc.).In addition, ABA-GCR2 is that known unique a pair of acceptor-aglucon is right in the present plant, and this acceptor-aglucon is to using in others.

Description of drawings

Fig. 1 is prediction of GCR2 membrane-spanning domain and Subcellular Localization

Fig. 2 is the interaction with surface plasma resonance checking GCR2 and GPA1

Fig. 3 is for verifying the interaction between GCR2 and the GPA1 with the yeast cracking system

Fig. 4 is for verifying that with bimolecular fluorescence and co-immunoprecipitation GCR2 and GPA1 are in the intravital interaction of plant

Fig. 5 is the evaluation of gcr2 mutant

Fig. 6 changes for the ABA reaction that the GCR2 sudden change causes

Fig. 7 is that the ABA regulate gene expression changes in the GCR2 mutant

Fig. 8 is GCR2 mutant and overexpression plant leaf rate-of-loss of coolant

Fig. 9 is GCR2 and the interaction of GPA1 in regulation and control stomatal closure process

Figure 10 is the combination of ABA and GCR2

Embodiment

The present invention confirms by experiment: 1, GCR2 is a kind of cytoplasmic membrane albumen

Do by software and to stride membrane structure prediction and find that GCR2 has the structure (A and B among Fig. 1) of striding film for seven times.GCR2 YFP mark arabidopsis thaliana transformation later on, in transgenic plant, carry out Subcellular Localization and find that GCR2 is positioned at (C among Fig. 1) on the plasma membrane, and further the membrane components of transgenic plant is extracted and find that GCR2 mainly is present in the membrane component with anti-GFP antibody test, and GCR2 still is present in the membrane component after the washing of the damping fluid of process stain remover or high pH value, shows that GCR2 is a kind of integral protein (D among Fig. 1).

2, GCR2 and heterotrimer G protein alpha subunit generation direct interaction

Above-mentioned GCR2 results of structural analysis shows that GCR2 may be a kind of new GPCR.One of characteristics of GPCR are to form a protein complexes with the G protein binding.In order to confirm the relation between GCR2 and the G α, the present invention proves their interactions in vitro and in vivo with four kinds of methods.At first, whether the method detection GCR2 with surface plasma resonance can interact with GPA1.At first in bacterium, express respectively and purifying the recombinant protein of GCR2 and GPA1, respectively GCR2 or BSA are marked at the surface of chip then, and allow the GPA1 solution stream of different concns cross the surface of chip, experimental result shows that GCR2 can interact with GPA1, and contrast BSA can not interact with GPA1.The interactional dissociation constant of GCR2 and GPA1 is 2.1 * 10 ^-9M (Fig. 2).

Because conventional yeast two-hybrid can not detect the interaction between the membranin, the present invention detects GCR2 and the possible interaction of GPA1 in yeast with division ubiquitin system (Split-Ubiquitin).The result as shown in Figure 3, the GCR2 of total length can interact with GPA1, but after the C-of GCR2 end is affected, GCR2 just can not interact with GPA1 again, further observes the C-end (C of GCR2 _290-401, comprise the interior territory of encircling of C-the 3rd born of the same parents terminal and prediction) can interact with GPA1 (Fig. 3), show GCR2 and GPA1 are interacted that the C-end of GCR2 is essential and enough.

Further use bimolecular fluorescence complementary (BiFC) and co-immunoprecipitation (Co-IP) to verify that GCR2 and GPA1 are in the intravital interaction of plant.The result shows that GCR2 and GPA1 can interact in plant materials, their interactions occur on the plasma membrane and the C-end of GCR2 is essential (Fig. 4) to interacting in their bodies.

3, GCR2 participates in the process of the regulation and control of ABA

In order to study the biological function of GCR2, three gene knockout allelic mutants of GCR2 have been identified, gcr2-1, gcr2-2, gcr2-3.The transcriptional level analysis confirms that these three mutant all do not have the transcript of GCR2 total length, but all has the part transcript to have (Fig. 5).

The seed of plant has a sleep procedure after forming in parent, thereby prevents that seed from sprouting on parent.The result shows that the seed that obtains directly is inoculated on the substratum seed and can not sprouts from fresh sophisticated wild-type Arabidopis thaliana plant, and the seed of the identical developmental stage that obtains from three allelic mutants of GCR2 can be sprouted (Fig. 6 A), and the forfeiture of gcr2 mutant seed dormancy process is described.The seed dormancy process is mainly by plant hormone ABA control, and hint gcr2 mutant may cause ABA signal pathway obstacle, and has reduced the susceptibility of plant to ABA.In order further to confirm above-mentioned hypothesis, detected of the reaction of gcr2 mutant to other process of ABA control.Compare with wild-type plant, the gcr2 mutant is insensitive to the seed germination that ABA suppresses, but the seed germination hypersensitization (B among Fig. 6) that GCR2 overexpression plant suppresses ABA, the gcr2 mutant is insensitive to the seedling development that ABA suppresses, and its overexpression plant is to the seedling development hypersensitization (C among Fig. 6) of ABA control.ABA regulates development of plants and regulates and control some expression of gene realizations by it, and relatively some typically are subjected to the expression of the gene of ABA regulation and control at wild-type and gcr2 mutant for this reason.Choose the gene of three kinds of known ABA regulation and control, comprise RD29A, KIN1 and ABI5, their promotor and gus reporter gene are merged back commentaries on classics plant, the result shows with the wild-type plant and compares, the expression level of these three genes in the GCR2 mutant significantly suppressed (Fig. 7), shows that the GCR2 sudden change has also influenced the expression that is subjected to the ABA regulatory gene.

The pore of plant is the door that plant and external environment are carried out moisture and gaseous interchange.Under normal habitat, plant passes through pore moisture exchange and gas, thereby guarantees the intravital moisture state balance of plant and carry out normal photosynthesis.Under adverse environmental factor, plant is closed pore in order to prevent moisture excessively to scatter and disappear.The major hormone of present known regulation and control stomatal movement is ABA, and the pore opening that is suppressed by ABA inductive stomatal closure and ABA is the classics reaction of ABA.The result shows under the processing of Exogenous ABA (simulation adverse environmental factor), and the pore of wild-type plant is closed very soon, and the pore of gcr2 mutant is open as usual (D among Fig. 6).The pore of gcr2 mutant is opened also insensitive (E among Fig. 6) to the pore that ABA suppresses simultaneously.The opening of ABA regulation and control pore is by the K on guard cell's plasma membrane of regulation and control plant stomata ⁺Channel activity realizes, for this reason, detected the K among the guard cell of wild-type and gcr2 mutant with patch clamp technique ⁺The activity of passage shows that Exogenous ABA can suppress the K that flows in the guard cell of wild-type plant ⁺The activity of passage, but stream K in the gcr2 mutant guard cell ⁺Channel activity shows that but to not reaction (F among Fig. 6) of exogenous aba treatment GCR2 participates in the interior stream K of regulation and control by ABA control ⁺The activity of passage.With wild-type plant pore reacting phase ratio, GCR2 overexpression plant stomatal closure is to ABA hypersensitization (G among Fig. 6), reaction as stomatal closure, gcr2 mutant blade rate-of-loss of coolant wants fast than the wild-type plant leaf, and GCR2 overexpression plant leaf rate-of-loss of coolant is than wild-type blade slow (Fig. 8).Comprehensive The above results shows that GCR2 has participated in the important reaction of all ABA.

4, GCR2 and GPA1 acting in conjunction regulation and control ABA reaction

Above-mentioned experimental result shows that the mutant of GCR2 causes ABA reaction disappearance.The mutant of GPA1 also can cause the disappearance (Wang etc. of some ABA reflections, 2001, G protein regulation of ion channels andabscisic acid signalling in Arabidopsis guard cells.Science 292,2070-2072), show that the two may acting in conjunction transmission ABA signal.The result shows that GCR2 and GPA1 have identical expression pattern (A and B among Fig. 9), so with stomatal closure as the two mutual relationship in the ABA signal transduction of index observing.The double mutant of gcr2 and gpa1 is similar to their single mutants separately to the reaction of ABA, overexpression GCR2 or GPA1 can make plant to ABA signal hypersensitization, but this effect of GCR2 depends on the existence of GPA1, the effect of GPA1 also depends on exist (C and the D among Fig. 9) of GCR2, shows it is that the ABA signal is transmitted in GCR2 and GPA1 acting in conjunction.

5, GCR2 is the plasma membrane acceptor of ABA

The above results shows that GCR2 participates in all ABA reactions of regulation and control, and GCR2 itself is a kind of membrane receptor, and hint GCR2 may be exactly the acceptor of ABA.In order to verify this point, whether the GCR2 recombinant protein that at first detects purifying can be in conjunction with ABA.The result shows that GCR2 really can be in conjunction with ABA, but the GCR2 of sex change and GPA1 and BSA can not be in conjunction with ABA (A among Figure 10).GCR2 is specific with combining of ABA, because the structure homologue of the no physiologically active of ABA can not combine (B among Figure 10) with GCR2.ABA has saturability (C among Figure 10) with combining of GCR2, and the two bonded dissociation constant is 20.1nM, and each GCR2 albumen can be in conjunction with an ABA molecule (D among Figure 10).

Further in the yeast system of reorganization, find with after handling, the quantity of GCR2-GPA1 complex body reduces, zymic growth simultaneously is suppressed (E among Figure 10), showing that ABA combines with GCR2 causes dissociating of GCR2-GPA1 complex body, thus the effector in free G α and G β γ subunit deexcitation downstream.

Illustrate above-mentioned experimental result below by specific embodiment.

Experimental technique among the following embodiment if no special instructions, is ordinary method.

Except specifying that the ecotype of the Arabidopis thaliana that all experiments are used is Columbia (Col-0) background.

The acquisition of embodiment 1, GCR2 and encoding gene thereof

For new GPCR in further research and the plant identification,, design a pair of RT-PCR special primer (upstream: 5 '-GCGGATCCATGCCGGAGTTTGTACCGGAAG-3 ' according to present known GPCR; Downstream: 5 '-CCGCTCGAGTTAGAGTTCATAACCTGGAAACAGAG-3), the first chain cDNA that obtains with the total RNA reverse transcription of the lotus throne Ye of the environmental Arabidopis thaliana of Columbia (Col-0) (ABRC) is that template is carried out PCR, the PCR product that obtains is carried out agarose electrophoresis to be separated, reclaim and be cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, sequencing result shows, this pcr amplification product has the nucleotide sequence of sequence 2 in the sequence table, be the cDNA sequence of GCR2, encoding amino acid sequence is the GCR2 of sequence 1 in the sequence table.

This PCR product after restriction enzyme BamHI and XhoI enzyme are cut, is cloned between the BamHI and XhoI site of pET28a (Novagen), obtains recombinant vectors pET28a-GCR2.The N end of the GCR2 that pET28a-GCR2 expresses has His ₆The fusion rotein His of label ₆-GCR2.PET28a-GCR2 is transformed BL21 (Novagen), select the positive transformant of kantlex (Kan) resistance, in containing Kan liquid LB substratum, cultivate, extract plasmid enzyme restriction and identify.Positive colony liquid shakes training and spends the night, the 1L that spreads cultivation at 1: 50 contains and continues to shake training in the antibiotic LB substratum of Kan and added IPTG to final concentration 0.8mM in 1.5-2 hour behind OD600=0.6, continue to cultivate after 4 hours, 12000g, 4 degree were collected thalline in centrifugal 30 minutes.The N end of the GCR2 that expresses has His ₆Label utilizes Ni-NTA agarose column operation purifying protein in the technical manual according to Qiagen company.Wherein used damping fluid is cooked following adjustment: lysis buffer (25mM HEPES, 50mM NaCl, 0.1% Triton X-100, pH8.0), lavation buffer solution (25mM HEPES, 50mM NaCl, 15mM imidazole, pH8.0), elution damping fluid (25mM HEPES, 50mM NaCl, 250mM imidazole, pH8.0).Albumen under the elution use at once anion-exchange column (Source-Q, Pharmacia) purifying, elution damping fluid be A (25mM HEPES, 3mMDTT, pH8.0) and B (25mM HEPES, 3mM DTT, 1M NaCl, pH8.0).The His of the purifying that obtains ₆-GCR2 is with His ₆His among the-GCR2 ₆Label goes by the excision of Thrombin enzyme, obtains GCR2.Protein sequence analyzer is measured the N-terminal aminoacid sequence of GCR2.The result shows that 15 amino-acid residues of N-terminal of this GCR2 are MPEFVPEDLS GEEET, and is consistent with 15 amino-acid residues of N-terminal of sequence in the sequence table 1.

CDNA sequences Design primer upstream according to GCR2:

5 '-GCTCTAGAATGCCGGAGTTTGTACCGGAAG-3 '; The downstream:

5 '-CGAGCTCTTAGAGTTCATAACCTGGAAACAGAG-3, genomic dna with the environmental Arabidopis thaliana of Columbia (Col-0) is the genomic dna that template is carried out pcr amplification GCR2, the PCR product that obtains is carried out agarose electrophoresis to be separated, reclaim and be cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, sequencing result shows, this pcr amplification product has the nucleotide sequence of sequence 3 in the sequence table, genomic dna sequence for GCR2, from 5 of sequence 3 ' terminal 1-144 position deoxyribonucleotide is first exon, 145-277 position deoxyribonucleotide is first intron, 278-456 position deoxyribonucleotide is second exon, 457-527 position deoxyribonucleotide is second intron, 528-639 position deoxyribonucleotide is the 3rd exon, 640-732 position deoxyribonucleotide is the 3rd intron, 733-849 position deoxyribonucleotide is the 4th exon, 850-931 position deoxyribonucleotide is the 4th intron, 932-1246 position deoxyribonucleotide is the 5th exon, 1247-1323 position deoxyribonucleotide is the 5th intron, and 1324-1662 position deoxyribonucleotide is the 6th exon.

Embodiment 2, GCR2 are a kind of membranins

Stride the membrane structure prediction by software DAS and TMpred GCR2, the result shows that GCR2 is seven transmembrane proteins shown in A among Fig. 1 and B.

The first chain cDNA that obtains with the total RNA reverse transcription of lotus throne Ye of the environmental Arabidopis thaliana of Columbia (Col-0) is a template, utilizes RT-PCR special primer (upstream: 5 '-CCGCTCGAGATGCCGGAGTTTGTACCGGAAG-3 '; Downstream: 5 '-CTCCTTTACTAGGCCTCATGAGTTCATAACCTGGAAACAGAGC-3, the sequence 1 of pcr amplification GCR2 from 5 ' the 1st to 1203 deoxynucleoside acid sequence of end, the primer end has part YFP pyrenoids nucleotide sequence simultaneously; Use RT-PCR special primer (upstream: 5 '-CCGCTCGAGATGAGGCCTAGTAAAGGAG-3 ' simultaneously; Downstream: 5 '-GACTAGTTTATHGTATAGTTCATCCATGC-3, the YFP on the pcr amplification pEYFP (Clontech) reclaims 2 PCR products then and is mixed and is template, with upstream 5 '-CCGCTCGAGATGCCGGAGTTTGTACCGGAAG-3 '; Downstream: 5 '-GACTAGTTTATTTGTATAGTTCATCCATGC-3, the nucleotide sequence sequence of primer amplification GCR2-YFP fusion rotein, product cloning is to pGEM-T (Promega) carrier, carry out sequencing analysis, the correct cloned plasmids of sequencing result downcuts fragment by XhoI with the SpeI enzyme and is connected between the XhoI and SpeI restriction enzyme site that enters pBI101 (Clontech) recombinant vectors called after pTA-GCR2-YFP.Simultaneously pcr amplification is reclaimed the YFP fragment cloning that gets off to pGEM-T (Promega) carrier, carry out sequencing analysis, the correct cloned plasmids of sequencing result downcuts fragment by XhoI with the SpeI enzyme and is connected between the XhoI and SpeI restriction enzyme site that enters pBI101 recombinant vectors called after pTA-YFP.

Method (the Clough-SJ that pTA-GCR2-YFP or pTA-YFP soak by flower, Bent-AF.Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsisthaiiana.Plant-Journal.1998,16:6,735-743) utilize agrobacterium tumefaciens bacterial strain GV3101 to transform the environmental Arabidopis thaliana of Columbia (Col-0), to the T that obtains ₀Transform seedling for transfer-gen plant with Totomycin (Hygromycin B is available from Roche company) screening.To commentaries on classics pTA-GCR2-YFPT through hygromycin selection ₀Carrying out PCR as follows for plant identifies: primer upstream: 5 '-GTTCACTGGTGTCACGGTGCTCCTGG-3 '; Downstream: 5 '-GACTAGTTTATTTGTATAGTTCATCCATGC-3, the plant that obtains the fragment (wherein 396bp is a GCR2 C-terminal sequence, and 723bp is the YFP sequence) of 1119bp size is the positive pTA-GCR2-YFP of commentaries on classics of PCR T ₀For plant.To through the commentaries on classics pTA-YFP of hygromycin selection T ₀Carrying out PCR as follows for plant identifies: primer upstream: 5 '-CCGCTCGAGATGAGGCCTAGTAAAGGAG-3 '; Downstream: 5 '-GACTAGTTTATTTGTATAGTTCATCCATGC-3, the segmental plant that obtains the 723bp size is the positive pTA-YFP of commentaries on classics of PCR T ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.

The result shows that GCR2 is positioned on the plasma membrane of the environmental arabidopsis cell of Columbia (Col-0) (Fig. 1 C) shown in C among Fig. 1.C among Fig. 1, YFP represent YFP fluorogram photo under the laser co-focusing, and bright field is represented transmitted light undertissue photo, and fluorogram and the transmitted light figure photo that superposes is represented in amalgamation; PTA-GCR2-YFP represents to change the root cells photo of pTA-GCR2-YFP, and pTA-YFP represents to change the root cells photo of pTA-YFP.

Further the membrane components of transgenic plant is extracted and find that GCR2 mainly is present in the membrane component with anti-GFP antibody test, and GCR2 still is present in the membrane component after the washing of the damping fluid of process stain remover or high pH value, shows that GCR2 is a kind of integral protein (D among Fig. 1).Concrete experimental technique is as follows: extract PCR and detect male commentaries on classics pTA-GCR2-YFP T ₁For plant, commentaries on classics pTA-YFP T ₁Total protein for plant, transfer to after sample fully grinds in liquid nitrogen and add 3 times of volumes extraction damping fluid (50mM Tris-HCl in the mortar of icing precooling, pH7.5 or pH10,150mM NaCl, 50mM sucrose, 1mM PMSF, 0.1% or 0.5% Triton X-100 and 1 * plant protease inhibitor cocktail) (this proteinase inhibitor is available from Roche) continuation grinding is fully.15,4 ℃ of 000g are centrifugal 20 minutes.Supernatant liquor is in 4 ℃, and 100000g separated soluble protein and membranin (precipitation) component in centrifugal 1 hour.Soluble protein and membranin component are dissolved back SDS-PAGE gel electrophoresis protein isolate with sample buffer.Protein concentration Bradford standard measure (Bio-Rad).The albumen of 20 micrograms carries out the 12%SDS-PAGE gel electrophoresis and transfers on the pvdf membrane subsequently.Carrying out Western Blot with rabbit source anti-GFP (Santa Cruz) antibody detects.

D among Fig. 1, pTA-GCR2-YFP represent to change the plant of pTA-GCR2-YFP, and pTA-YFP represents to change the pTA-YFP plant; S represents soluble protein fraction; M represents the membranin component; T represents total protein.

Embodiment 3, GCR2 and heterotrimer G protein alpha subunit generation direct interaction

Above-mentioned GCR2 results of structural analysis shows that GCR2 may be a kind of new GPCR.One of characteristics of GPCR are to form a protein complexes with the G protein binding.In order to confirm the relation between GCR2 and the G α, prove their interactions in vitro and in vivo with four kinds of methods.

One, at first, detect the interaction of GCR2 and GPA1 with the method for surface plasma resonance

1, the N of GPA1 end has His ₆The fusion rotein His of label ₆The expression of-GPA1 and purifying

The first chain cDNA that obtains with the total RNA reverse transcription of the lotus throne Ye of the environmental Arabidopis thaliana of Columbia (Col-0) (ABRC) is a template, utilizes a pair of RT-PCR special primer (upstream: 5 '-GGAATTCATGGGCTTACTCTGCAGTAGAAG-3 '; PCR carries out for downstream 5 '-CCGCTCGAGTCATAAAAGGCCAGCCTCCAGAAAATTTC-3), the PCR product that obtains is carried out agarose electrophoresis to be separated, reclaim and be cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, sequencing result shows, the nucleotide sequence of this pcr amplification product is that GenBank Accession Number is the nucleotide fragments from the GPA1 of the 1st to 1152 deoxynucleotide of 5 ' end of AT2G26300.

This PCR product after restriction enzyme EcoRI and XhoI enzyme are cut, is cloned between the EcoRI and XhoI site of pET28a, obtains recombinant vectors pET28a-GPA1.The N end of the GPA1 that pET28a-GPA1 expresses has His ₆The fusion rotein His of label ₆-GPA1.PET28a-GPA1 is transformed BL21 (Novagen), select the positive transformant of Kan resistance, in Kan liquid LB substratum, cultivate, extract plasmid enzyme restriction and identify.Positive colony liquid shakes training and spends the night, the 1L that spreads cultivation at 1: 50 contains and continues to shake training in the antibiotic LB substratum of Kan and added IPTG to final concentration 0.8mM in 1.5-2 hour behind OD600=0.6, continue to cultivate after 4 hours, 12000g, 4 degree were collected thalline in centrifugal 30 minutes.The N end of the GPA1 that expresses has His ₆Label utilizes Ni-NTA agarose column operation purifying protein in the technical manual according to Qiagen company.Wherein used damping fluid is cooked following adjustment: lysis buffer (25mM HEPES, 50mM NaCl, 0.1% Triton X-100, pH8.0), lavation buffer solution (25mM HEPES, 50mM NaCl, 15mMimidazole, pH8.0), elution damping fluid (25mM HEPES, 50mM NaCl, 250mM imidazole, pH8.0).Albumen under the elution use at once anion-exchange column (Source-Q, Pharmacia) purifying, elution damping fluid be A (25mM HEPES, 3mM DTT, pH8.0) and B (25mM HEPES, 3mM DTT, 1M NaCl, pH8.0).The His of the purifying that obtains ₆-GPA1.

2, surface plasma resonance detects the interaction of GCR2 and GPA1

The instrument of protein-protein interaction analysis usefulness is BIAcore 2000 (BIAcore) in real time.Operation is carried out according to the instrument specification sheets.The His that purifying is good ₆(200 μ g/ml, Sigma) albumen holds coupling reagent kit (BIAcore) to be separately fixed on the CM5 sensing chip with N for-GCR2 (200 μ g/ml) and BSA.The His of different concns ₆-GPA1 albumen flows through the different proteic cells of mark respectively, and wherein mark GCR2's interacts the proteic negative contrast of mark BSA for detecting GCR2-GPA1.The His of different concns ₆-GPA1 albumen (200,700,1400nM) flow through chip surface and obtain kinetic parameter.The analysis software of parameter is BIAevaluation software3.2.Selected model is 1: 1 aglucon-receptor model.

Experimental result shows that GCR2 can interact with GPA1, and contrast BSA can not interact with GPA1.The interactional dissociation constant of GCR2 and GPA1 is 2.1 * 10 ^-9M (Fig. 2).

Two, division ubiquitin system (Split-Ubiquitin) detects GCR2 and the interaction of GPA1 in yeast

Because conventional yeast two-hybrid can not detect the interaction between the membranin, the present invention detects GCR2 and the possible interaction of GPA1 in yeast with division ubiquitin system (Split-Ubiquitin).

1, pcr amplification GCR2, GCR2IL ₂(C _290-401), GCR2IL (N _1-289), GCR1 or GPA1

The GCR2 amplified production be sequence 1 from 5 ' the 1st to 1203 deoxynucleoside acid sequence of end, template is pET28a-GCR2, and primer is: GCR2SUSB1:5 '-acaagtttgtacaaaaaagcaggctctccaaccaccATGCCGGAGTTTGTACCGGA AG-3 ' GCR2SUSB2:5 '-TCCGCCACCACCAACCACTTTGTACAAGAAA

GCTGGGTA GAGTTCATAACCTGGAAACAGAG-3’。GCR2IL ₂(C _290-401) amplified production be sequence 1 from 5 ' the 868th to 1203 deoxynucleoside acid sequence of end, template is pET28a-GCR2, primer is: GCR2SUSIL ₂B1:5 '-acaagtttgtacaaaaaagcaggctctccaaccaccATGCAGGTTTATAACACTAA GGAATTTG-3 ', GCR2SUSB2:5 '-TCCGCCACCACCAACCACTTTGTACAAGAAAGCTGGGTAGAGTTCATAACCTGGAA ACAGAG-3 '.GCR2IL (N _1-289) amplified production be sequence 1 from 5 ' the 1st to 867 deoxynucleoside acid sequence of end, template is pET28a-GCR2, primer is:GCR2SUSB1:5 '-acaagtttgtacaaaaaagcaggctctccaaccaccATGCCGGAGTTTGTACCGGA AG-3 ', the nucleotide sequence of the pcr amplification product of GCR2ILSUSB2:5 '-TCCGCCACCACCAACCACCTTTGTACAAGAAAGCTGGGTACTTAGTGTTATAAACC TGAGCTGCC-3 ' .GCR1 be GenBank Accession Number be AT1g48270 from 5 ' nucleotide fragments of the GCR1 of the 1st to 978 deoxynucleotide of end; Template is that the first chain cDNA that the total RNA reverse transcription of lotus throne Ye of the environmental arabidopsis of Columbia (Col-0) obtains is template, and primer is: GCR1SUSB1:5 '-acaagtttgtacaaaaaagcaggctctccaaccaccATGTCGGCGGTTCTCACAGC CCGGC-3 ' GCR1SUSB2:5 '-TCCGCCACCACCAACCACTTTGTACAAGAAAGCTGGGTATTGCTGGTCCTCGGTCT TGAGTG-3 '. The nucleotide sequence of the pcr amplification product of GPA1 be GenBank Accession Number be AT2G26300 from 5 ' nucleotide fragments of the GPA1 of the 1st to 1152 deoxynucleotide of end, template is pET28a-GPA1, and primer is:GPA1SUSB1:5 '-GGACAAGTTTGTACAAAAAAGCAGGCTCTCCAACCACCATGGGCTTACTCTGCAGT AGA-3 ' GPA1SUSB2:5 '-TCCGCCACCACCAACCACTTTGTACAAGAAAGCTGGGTATAAAAGGCCAGCCTCCA GTAAATTTC-3 '.

2, division ubiquitin system experimentation

Zymic division ubiquitin experimental implementation and relevant vector construction carry out with reference to following document: Obrdlik etc., 2004, K ⁺Channel interactions detected by a genetic system optimized forsystematic studies of membrane protein interactions.Proc.Natl.Acad.Sci.USA.12242-12247 and Pandey and Assmann 2004, The Arabidopsis putativeG-protein-coupled receptor, GCR1, interacts with the G protein α-subunit, GPA1 and regulates abscisic acid signalling.Plant Cell 16,1616-1632.GCR2, GCR2IL ₂(C _290-401), GCR2IL (N _1-289), the PCR product of GCR1 or GPA1 and pNXgate32-3HA (cutting back to close with the EcoRI/SmaI/ enzyme in advance) carrier or and pXNgate21-3HA (cutting back to close with the EcoRI/SmaI enzyme in advance) carrier respectively cotransformation to yeast DSY2 (DUAL Systems Biotech) (MAT_ α URA3leu2 trp1 his3 loxP ∷ ade2) bacterial strain, simultaneously and pmetYCgate (cutting back to close with the HindIII/PstI enzyme in advance) carrier distinguish cotransformation in yeast DSYl (DUAL Systems Biotech) (MATa ura3 leu2lexA ∷ lacZ ∷ trpl lexA ∷ HIS3 lexA ∷ ADE2).Transformant select substratum SC (DSY1 at-Leu SC substratum (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.64g/1000ml-Leu the synthesizing amino acid mixture), DSY2 (DUAL Systems Biotech) at-Trp SC substratum (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.74g/1000ml-Trp synthesizing amino acid mixture, 20 grams per liter agar) go up the cultivation screening, the proposition plasmid is transformed in the bacterium and increases from positive bacteria, then its exactness of sequence verification.Contain-NubG or-the DSY1 bacterium of Nubwt is in-Leu SC culture medium culturing (as GPA1-NubG), simultaneously contain-the DSY2 bacterium of Cub spends the night in-Trp SC culture medium culturing (as GCR2-Cub), the 1000g room temperature was collected 1 milliliter of thalline in centrifugal 5 minutes, precipitation is resuspended among the 100 microlitre YPD, after respectively getting the mixing of 20 microlitres, one after another drop of (one of about 4 microlitre) drop in (20 grams per liter bacto peptones on the YPD flat board, 10 grams per liter yeast extracts, 2% glucose, 20 grams per liter agar), after 30 degree are cultivated 6-8 hour (yeast crossbreeding process of growth), with sterilization filter paper xerox-Trp/-Leu/-Ura disappearance substratum is (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.74g/1000ml-Trp/-Leu/-Ura synthesizing amino acid mixture, 20 grams per liter agar) on the flat board, continue the culturing yeast bacterium and spend the night, the gained yeast is diplontic yeast (representing as GPA1-NubG+GCR2-Cub with contained plasmid).

Wherein, pNXgate32-3HA, pXNgate21-3HA, pmetYCgate are available from ABRC (http://www.arabidopsis.org/abrc/catalog/vector_1.html)

The diploid yeast bacterium is cooked X-Gal colour developing experiment simultaneously and identifies protein-protein interaction selecting to do on the substratum growth experiment.

The result as shown in Figure 3, when being that bait is when detecting itself and GPA1 and interacting with GCR2, promptly scheme two flat boards of left column among the A: (I) GPA1-NubG+GCR2-Cub, (II) the NubG-GPA1+GCR2-Cub yeast can not be grown on the disappearance substratum, very low LacZ activity is arranged simultaneously, when showing with GCR2 for bait can not with the GPA1 effect, and two of right row are that bait detects itself and GCR2 and does the time spent and promptly scheme among the A: (I) GCR2-NubG+GPA1-Cub with GPA1 in figure A, (II) the NubG-GCR2+GPA1-Cub yeast can be grown on the disappearance substratum, very high LacZ activity is arranged simultaneously, when showing with GPA1 for bait can and the GCR2 effect, the binding mode of this result and GCR1 that had reported and GPA1 is identical promptly schemes among the A: (III) GPA1-NubG+GCR1-Cub, (IV) NubG-GPA1+GCR1-Cub; (III) GCR1-NubG+GPA1-Cub, (IV) NubG-GCR1+GPA1-Cub.While is as (V) GPA1-Nubwt+GCR2-Cub of positive control, (VI) Nubwt-GPA1+GCR2-Cub; (V) GCR2-Nubwt+GPA1-Cub, (VI) Nubwt-GCR2+GPA1-Cub, and (VII) NubG-KAT1+KAT1-Cub yeast of system's positive control can be grown on the disappearance substratum, very high LacZ activity is arranged simultaneously, and system's negative control (VIII) NubG-SUC2+KAT1-Cub yeast can not be grown on the disappearance substratum, and very low LacZ activity is arranged simultaneously.The experiment of scheming B simultaneously shows the C-end (C of GCR2 _290-401), can not detect interaction (two flat boards of left column) during the interior ring of the 3rd the born of the same parents territory that comprises C-end and prediction) for bait with GPA1, but with GPA1 is that bait can detect itself and the segmental effect of GCR2 C-terminal (two flat boards of right row), and C show lacked the C end GCR2 N end (1-289aa) can not with GPA1 effect (two flat boards of left column), show as yeast and can not on the disappearance substratum, very low LacZ activity be arranged growth simultaneously, the result shows that the GCR2 of total length can interact with GPA1, but after the C-of GCR2 end is affected, GCR2 just can not interact with GPA1 again, further observes the C-end (C of GCR2 _290-401, comprise the interior territory of encircling of C-the 3rd born of the same parents terminal and prediction) can interact with GPA1 (Fig. 3), show GCR2 and GPA1 are interacted that the C-end of GCR2 is essential and enough.Among Fig. 3, D is each dull and stereotyped partitioned mode.Among A, B, the C, the detected result when two flat boards of right row are and are bait with GPA1.

Wherein, LacZ activity determination method: after being diluted to OD=0.2-0.3 about the yeast OD=1.0 of incubated overnight among the YPD and continuing to be cultured to OD=0.5-0.8, the 12000g room temperature was collected thalline in centrifugal 5 minutes, and behind the absorption supernatant, precipitation is dissolved in 150 microlitre Z buffer (Na ₂HPO ₄7H ₂O 16.1g/L, NaH ₂PO ₄H ₂O 5.50g/L, KCl 0.75g/L, MgSO ₄7H ₂O 0.246g/L, pH7.0) in, after liquid nitrogen and 37 degree water-baths repeat 3 times, after adding 100 microlitre granulated glass spherees (Sigma company product) concuss, centrifugal 1 minute of 12000g 4 degree, get 10 microlitre supernatants and measure protein concentration (Bradford method), get other 100 microlitre supernatants in new EP pipe, add 0.7 milliliter of Z damping fluid and (comprise that 0.27% (v/v) β-mercaptoethanol) (4mg/ml is dissolved in the Z damping fluid with 160 microlitre ONPG, Sigma), add 0.7 milliliter of Z damping fluid in simultaneously in a control reaction pipe, (only containing 100 microlitre Z damping fluids) and (comprise that 0.27% (v/v) β-mercaptoethanol) (4mg/ml is dissolved in the Z damping fluid, and Sigma) water-bath of .30 degree is noted the accurate reaction times up to the solution flavescence with 160 microlitre ONPG.Add 0.4 milliliter of 1M Na then ₂CO ₃To reaction tubes and control tube.The 14000rpm room temperature is drawn supernatant and is measured OD after centrifugal 10 minutes ₄₂₀Reading.Enzyme work is defined as: the amount of every milligram of proteolysis of per minute 1 micromolar ONPG.

Three, further use bimolecular fluorescence complementary (BiFC) and co-immunoprecipitation (Co-IP) to verify that GCR2 and GPA1 are in the intravital interaction of plant.

1, protoplast transformation and bimolecular fluorescence complementary experiment

The GCR2 amplified production be sequence 1 from 5 ' the 1st to 1203 deoxynucleoside acid sequence of end, primer upstream: 5 '-GCTCTAGAATGCCGGAGTTTGTACCGGAAG-3 ', downstream: 5 '-TCCCCCGGGGAGTTCATAACCTGGAAACAGAG-3 '; The GCR2IL amplified production be sequence 1 from 5 ' the 1st to 867 deoxynucleoside acid sequence of end, primer upstream: 5 '-GCTCTAGAATGCCGGAGTTTGTACCGGAAG-3 ', downstream: 5 '-TCCCCCGGGGCTTAGTGTTATAAACCTGAGCTGCC-3 ', template is pET28a-GCR2.The nucleotide sequence of the pcr amplification product of GPA1 be GenBank Accession Number be AT2G26300 from 5 ' nucleotide fragments of the GPA1 of the 1st to 1152 deoxynucleotide of end, template is pET28a-GPA1, the primer upstream: 5 '-GCTCTAGA ATGGGCTTACTCTGCAGTAGAAGTC-3 '; Downstream: 5 '-TCCCCCGGGGTAAAAGGCCAGCCTCCAGTA-3 '.After GCR2 amplified production and GCR2IL amplified production carried out XbaI and SmaI double digestion respectively, be cloned into respectively between the XbaI and SmaI site of pUC-SPYCE, obtain identifying the recombinant vectors pUC-GCR2-YFP that contains GCR2 through PCR and order-checking ^C, identify the recombinant vectors pUC-GCR2IL-YFP that contains GCR2IL through PCR and order-checking ^C

After the pcr amplification product of GPA1 carried out XbaI and SmaI double digestion respectively, be cloned between the XbaI and SmaI site of pUC-SPYNE, obtain identifying the recombinant vectors called after pUC-GPA1-YFP that contains GPA1 through PCR and order-checking ^N

PUC-SPYNE and pUC-SPYCE derive from pUC19 (Promega) and pBIN121 (CLONTECH).After pBIN121 process HindIII and EcoRI enzyme are cut, reclaim fragment 35S-GUS-Nos and be connected between pUC19 HindIII and EcoRI, obtain recombinant vectors pUC35S-GUS-Nos.Be template with pLP-EYFP-C1 (Clontech) simultaneously, use upstream primer: 5 '-CCCGGGATGGAGCAAAAGTTGATTTCTGAGGAGGATCTTATGGTGAGCAAGGGCGA GGAGC-3 ' (containing the c-myc sequence label) and downstream primer: 5 '-CGAGCTCTTAGGCCATGATATAGACGTTGTG-3 ' amplification c-myc-YFP ^N(1-155aa) fragment; With pLP-EYFP-C1 (Clontech) is template, with upstream primer 5 '-CCCGGGATGTACCCATACGATGTTCCAGATTACGCTGACAAGCAGAAGAACGGCAT CAAGGTG-3 ' (containing the HA sequence label) and downstream primer: 5 '-GAGCTCTTACTTGTACAGCTCGTCCATGCCGAG-3 ' amplification HA-YFP ^C(156-239aa), the PCR product that obtains is carried out agarose electrophoresis separate, reclaim and be cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, be connected into respectively after order-checking is correct between the SmaI of pUC35S-GUS-Nos and SacI site and replace the GUS fragment, obtain containing c-myc-YFP ^NRecombinant vectors pUC-SPYNE, contain HA-YFP ^CRecombinant vectors pUC-SPYCE.

Use the upstream: 5 '-CCGCTCGAGATGCCGGAGTTTGTACCGGAAG-3 '; The downstream: the GACTAGTTTACTTGTACAGCTCGTCCATGCCGAG primer, with pUC-GCR2-YFP ^C, and pUC-GCR2IL-YFP ^CBe the template amplification GCR2-YFP that gets off ^CAnd GCR2IL-YFP ^CFragment, reclaim and be cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, the correct clone that checks order downcuts the external source fragment with restriction enzyme XhoI and SpeI and it is cloned between the XhoI and SpeI site of pBI101 again, and recombinant vectors is respectively pTA-GCR2-YFP ^CAnd pTA-GCR2IL-YFP ^C

The pUC-GPA1-YFP of 20 to 30 μ g ^NWith in following two kinds of plasmids any one according to Asai etc. 2002, MAP kinase signalling cascade in Arabidopsis innate immunity.Nature 415, the operation of 977-983 document is arrived in the environmental Arabidopis thaliana protoplastis of Columbia (Col-0) by cotransformation: pTA-GCR2-YFP ^CAnd pTA-GCR2IL-YFP ^CCultivate 24h 22 ℃ of continuous illuminations after adding 30 μ M Dex.(LSM 510 Meta Zeiss) observe the YFP fluorescent signal down to laser confocal microscope.The result is shown in A among Fig. 4 for the bimolecular fluorescence experiments, and wherein the YFP protein molecular is distributed in the specificity that does not have distribution in tenuigenin, cytolemma and the nucleus, and GPA1-YFP ^N/ GCR2-YFP ^CThe specific fluorescence that has the YFP molecule of reorganization to send on the protoplasm somatocyte film of corotation, and GPA1-YFP ^N/ GCR2IL-YFP ^CThe protoplastis of corotation is not found the YFP specific fluorescence, shows that GCR2 and GPA1 can interact in plant materials, and their interactions occur on the plasma membrane and the C-end of GCR2 is essential to interacting in their bodies.The GPA1-YFP of A among Fig. 4 ^N/ GCR2-YFP ^CExpression cotransformation pUC-GPA1-YFP ^NAnd pTA-GCR2-YFP ^CThe experimental result of protoplastis, GPA1-YFP ^N/ GCR2IL-YFP ^CExpression cotransformation pUC-GPA1-YFP ^NAnd pTA-GCR2IL-YFP ^CThe experimental result of protoplastis, YFP represents YFP specific fluorescence photo under the laser co-focusing, bright field is represented protoplastis photo under the transmitted light, synergetic fluorescence and transmitted light photo are represented in amalgamation.

2, protein expression detects

The material source that is used for Protein Detection is in GPA1-YFP above-mentioned ^N/ GCR2-YFP ^CCotransformation and GPA1-YFP ^N/ GCR2IL-YFP ^CThe protoplastis of cotransformation.Protoplastis process room temperature 100g collection material after centrifugal 2 minutes, suction goes the supernatant postprecipitation to add isopyknic 2 times of SDS electrophoresis sample-loading buffers, 95 degree boiled sample after 10 minutes, ice bath 5 minutes, run the 12%SDS-PAGE electrophoresis at last, use α-c-myc, α-HA antibody (Santa Cruz) to detect protein signal respectively behind the commentaries on classics film.The protein expression detected result is shown in B among Fig. 4, at GPA1-YFP ^N/ GCR2-YFP ^CCotransformation and GPA1-YFP ^N/ GCR2IL-YFP ^CAll can detect the differential protein band in the protoplastis of cotransformation with α-c-myc, α-HA, show that GCR2 and GPA1 can interact in plant materials, they interact and occur on the plasma membrane, and the C-end of GCR2 is essential to interacting in their bodies.α-c-myc of B represents the c-myc monoclonal antibody among Fig. 4, and α-HA represents HA monoclonal antibody, GPA1-YFP ^NGCR2-YFP ^CExpression cotransformation pUC-GPA1-YFP ^NAnd pTA-GCR2-YFP ^CThe experimental result of protoplastis, GPA1-YFP ^NGCR2IL-YFP ^CExpression cotransformation pUC-GPA1-YFP ^NAnd pTA-GCR2IL-YFP ^CThe experimental result of protoplastis.

Wherein, the environmental Arabidopis thaliana protoplastis of Columbia (Col-0) is according to the method preparation of describing in the following document: Asai, T. wait 2002, MAP kinase signalling cascade in Arabidopsis innateimmunity.Nature 415,977-983.

3, co-immunoprecipitation experiment in the plant materials

With the pET28a-GCR2 plasmid is template, upstream primer:

5 '-cctcgagatgccggagtttgtaccggaagatttata-3 ' downstream:

5 '-gactagtttactcgactttatcgtcatcgtctttgtagtccatgagttcataacct ggaaacagag-3 ' (being with a FLAG label), behind the amplification GCR2, fragment reclaims and is cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, the correct clone that checks order downcuts the external source fragment with restriction enzyme XhoI and SpeI and it is cloned between the XhoI and SpeI site of pBI101 again, and the recombinant vectors that obtains is pTA-GCR2-FLAG.

Method (the Clough-SJ that pTA-GCR2-FLAG soaks by flower, Bent-AF.Floral dip:asimplified method for Agrobacterium-mediated transformation of Arabidopsisthaliana.Plant-Journal.1998,16:6,735-743) utilize agrobacterium tumefaciens bacterial strain GV3101 to transform the environmental Arabidopis thaliana of Columbia (Col-0), to the T that obtains ₀Transform seedling for transfer-gen plant with Totomycin (Hygromycin B is available from Roche company) screening.To commentaries on classics pTA-GCR2-FLAGT through hygromycin selection ₀Carrying out PCR as follows for plant identifies: upstream primer:

5 '-cctcgagatgccggagtttgtaccggaagatttata-3 ' downstream:

The segmental plant of GCR2-FLAG that 5 '-gactagtttactcgactttatcgtcatcgtctttgtagtccatgagttcataacct ggaaacagag-3 ' obtains 1240bp is the positive pTA-GCR2-FLAG of commentaries on classics of PCR T ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.

Cultivated 14 days commentaries on classics pTA-GCR2-FLAG T on the flat board ₁Transfer on the liquid MS medium for seedling and the environmental Arabidopis thaliana seedling of wild-type Columbia (Col-0) that (pH5.8) 22 ℃ are shaken training and added simultaneously in 36 hours or do not add Dex (Sigma, 30 μ M) and induce GCR2 to express for 1 * MS, 1% sucrose.Sample is transferred in 4 ℃ of precooling mortars at the IP of 3 times of volumes damping fluid (50mM Na after grinding fully in the liquid nitrogen ₃PO ₄PH7.5,200mMNaCl, 10% glycerine, 0.1% NP40,10mM NaF, 2.5mM glycerolphosphate, 1mMNa ₃VO ₄, 0.5mM DTT, 1mM PMSF, 1 * plant protease inhibitor cocktail) and (this IP damping fluid is available from Roche company) fully grinding.Sample transfer is to EP pipe back 15, and 4 ℃ of 000g are centrifugal 15 minutes.Add 40 microlitre ANTI-FLAG in the supernatant liquor ^M2 Affinity Gel (Sigma) was hatched 4 hours for 4 ℃.4 ℃ of 6000g collected the immunoprecipitation complex bodys in centrifugal 2 minutes, and precipitation is given a baby a bath on the third day after its birth with 4.5 milliliters of IP damping fluids and time then boiled sample in the SDS sample-loading buffer and carried out 8%SDS-PAGE electrophoretic separation albumen in 10 minutes.Detect protein signal with FLAG antibody (FLAG antibody is available from Sigma company) and GPA1 antibody (self-control rabbit source polyclonal antibody).

The result is shown in C among Fig. 4, the wild-type material induce with non-inductive situation under all do not have the special signal of FLAG and GPA1 to occur, and transgenic line can access the special signal of FLAG (being GCR2) and GPA1 under the inductive situation and do not have under non-inductive condition, show that GCR2 and GPA1 can interact in plant materials, and form more stable complex body, C "+" expression has added Dex among Fig. 4, "-" expression does not add Dex, α-GPA1 represents the antibody of GPA1, α-FLAG represents the antibody of FLAG, the non-special signal that produces owing to the non-specific combination of antibody when non-specific binding is represented with the FLAG antibody test.

Embodiment 4, GCR2 participate in the regulation process of ABA

One, the evaluation of the environmental Arabidopis thaliana gcr2 of Columbia (Col-0) mutant

In order to study the biological function of GCR2, three environmental arabidopsis mutant bodies of Columbia (Col-0) that the GCR2 gene is knocked out have been identified: gcr2-1, gcr2-2, gcr2-3.Gcr2-1, gcr2-2 and gcr2-3 seed are respectively SALK_041449, SALK_073069 and SALK_134030 from Arabidopsis Biological Resource Center.

Genomic dna with gcr2-1, gcr2-2 and gcr2-3 is a template respectively, utilizes GCR2 upstream primer: 5 '-GTGTTTGCTGCTGGTGCTTCCTTTG-3 ', downstream primer:

5 '-GTTCACTGGTGTCACGGTGCTCCT-3 '; T-DNA left arm special primer

5 '-GCGTGGACCGCTTGCTGCAACTC-3 ' carries out the insertion site that pcr amplification is identified three allelic mutant T-DNA of gcr2.Wherein the upstream and downstream primer amplification is wild-type GCR2 genome sequence, and what upstream primer and T-DNA left arm special primer increased is that T-DNA left arm and GCR2 go up distinguished sequence.The result shows to have only a T-DNA to insert the site among gcr2-1, gcr2-2 and the gcr2-3.It is from 5 of sequence 3 ' end 1470-1489 position deoxyribonucleotide that the T-DNA of gcr2-1 inserts the site, it is from 5 of sequence 3 ' end 1289-1339 position deoxyribonucleotide that the T-DNA of gcr2-2 inserts the site, and it is from 5 of sequence 3 ' end 1361-1369 position deoxyribonucleotide that the T-DNA of gcr2-3 inserts the site.

The first chain cDNA that obtains with total RNA reverse transcription of gcr2-1, gcr2-2 and gcr2-3 is a template respectively, uses upstream primer p1:5 '-ATGCCGGAGTTTGTACCGG-3 ' and downstream primer p2:

5 '-TTAGAGTTCATAACCTGGAAACAGAGC-3 ' carries out PCR, detects GCR2 total length transcript (from the deoxyribonucleotide of the 1st to 1206 of 5 of sequences 1 ' end); Use upstream primer p1:

5 '-ATGCCGGAGTTTGTACCGG-3 ' and downstream primer p3:5 '-CCCTCGGAAACGGGCTAAGTAACG-3 ' carry out PCR, detect GCR2 part transcript (from the deoxyribonucleotide of the 1st to 435 of 5 of sequences 1 ' end).The transcriptional level analysis confirms that these three mutant all do not have the transcript of GCR2 total length, but all has the part transcript to have (Fig. 5).Among Fig. 5, A:GCR2 gene structure mode chart; B: wild-type and gcr2 mutant gene detection of expression; Three allelic mutant T-DNA of C:gcr2 insert the site mode chart.

Two, GCR2 participates in the process of the regulation and control of ABA

1, the acquisition of GCR2 overexpression plant

The GCR2 cDNA of total length (from 5 of sequence 1 ' the 1st to 1206 deoxyribonucleotides of end) uses special primer (upstream: 5 '-cctcgagatgccggagtttgtaccggaagatttata-3 ' by RT-PCR; Downstream: 5 '-gactagtttactcgactttatcgtcatcgtctttgtagtccatgagttcataacct ggaaacagag-3 ', have a FLAG sequence label in the primer) from the environmental Arabidopis thaliana lotus throne of Columbia (Col-0) leaf mRNA, obtain, and identify correct through order-checking, after using XhoI and SpeI double digestion at last, be cloned into the XhoI and the SpeI restriction enzyme site of pBI101 plasmid, obtain containing the recombinant vectors pTA-GCR2-FLAG of the GCR2 cDNA (from 5 of sequence 1 ' the 1st to 1206 deoxyribonucleotides of end) of total length.

Genomic dna with the environmental Arabidopis thaliana of Columbia (Col-0) is a template, utilizing primer upstream: 5 '-ACGCGTCGACACAGAAACAGAACTCAGATATAG-3 ' and downstream primer: 5 '-GCTCTAGACTCATTTCGGAAAAACCGTTCTCCC-3 ' amplification to begin a segment length upwards from the GCR2 initiator codon is that the genome sequence of 1223bp is as the GCR2 promotor, and identify correct through order-checking, behind restriction enzyme SalI and XbaI double digestion, be cloned between the SalI and XbaI enzyme cutting site of pBIN121 (CLONTECH), obtain containing the recombinant vectors pBIN-GCR2p-GUS of GCR2 promotor.Downcut GCR2 promotor-GUS-NOS fragment with SalI and EcoRI from pBIN-GCR2p-GUS, be cloned between the SalI and EcoRI restriction enzyme site of pCAMBIA1300 (CAMBIA), obtain recombinant vectors pCAMBIA-GCR2p-GUS.

Method (the Clough-SJ that pTA-GCR2-FLAG soaks by flower, Bent-AF.Floral dip:asimplified method for Agrobacterium-mediated transformation of Arabidopsisthaliana.Plant-Journal.1998,16:6,735-743) utilize agrobacterium tumefaciens bacterial strain GV3101 to transform the environmental Arabidopis thaliana of Columbia (Col-0), the T0 that obtains is transformed seedling for transfer-gen plant with Totomycin (Hygromycin B is available from Roche company) screening.To commentaries on classics pTA-GCR2-FLAGT through hygromycin selection ₀Carrying out PCR as follows for plant identifies: upstream primer:

5 '-cctcgagatgccggagtttgtaccggaagatttata-3 ' downstream: 5 '-gactagtttactcgactttatcgtcatcgtctttgtagtccatgagttcataacct ggaaacagag-3 ', the segmental plant of GCR2-FLAG that obtains 1240bp is the positive pTA-GCR2-FLAG of commentaries on classics of PCR T ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.

Results T ₁The seed (T that ties for the PCR positive plant ₂Generation), plant, individual plant is spread the hygromycin resistance plate screening after collecting seed, all is that the individual plant of resistance seedling is the transfer-gen plant (T that isozygotys ₃Cross the expression plant for GCR2).With this T ₃Carry out following seed dormancy, seed germination and growth of seedling experiment and stomatal closure experiment for plant seed.

2, seed dormancy, seed germination and growth of seedling experiment

The seed that is used for the seed dormancy experiment is from the environmental Arabidopis thaliana of wild-type Columbia (Col-0) (WT); The environmental arabidopsis mutant body of Columbia (Co1-0): gcr2-1, gcr2-2, gcr2-3; And T ₃Cross upwards third and fourth the kind pod of sophisticated silique that dewater fully on the main tongue of expression plant (GCR20E) for GCR2.Be taped against on the filter paper that soaks water in the plate in advance through disinfecting at once behind the seed collection.The artificial culture case cultivate 7 days (22 ℃, illumination 150 μ mol m fully ^-2s ^-1) after, observe seed germination and take pictures simultaneously.The sprouting of seed has been defined as the visible radicle and has stretched out kind of a skin.Test for seed germination, the seed that the same terms is cultivated the different genotype of collecting simultaneously is layered on the filter paper after sterilizing, be that 0.8% agar (Sigma) comprises 1/2MS (Sigma below, pH5.8) and 10g/1000ml sucrose add simultaneously different concns ± ABA (Sigma), 4 ℃ of subzero treatment after 48 hours in the dark, three days (150 μ mol m of 22 ℃ of following illumination cultivation ^-2s ^-1), seed germination rate is according to top canonical statistics.

Growth of seedling experiment: wild-type and gcr2 mutant, the seed of GCR2 overexpression comprises 1 * MS (Sigma through being layered on after the surface sterilization on the MS flat board, pH5.8), 30 μ M Dex (Sigma), 10g/1000ml sucrose and 0.3% agar (Sigma) add or do not add 0.3 μ M ± ABA (Sigma), 4 ℃ of subzero treatment after 48 hours in the dark.10 days (150 μ mol m are cultivated in 22 ℃ of continuous illuminations down ^-2s ^-1), the seedling phenotype is taken pictures with digital camera.

The seed of plant has a sleep procedure after forming in parent, thereby prevents that seed from sprouting on parent.Experimental result shows that the seed that obtains in the fresh sophisticated wild-type Arabidopis thaliana plant (WT) directly is inoculated on the substratum seed and can not sprouts, and from three allelic mutant gcr2-1 of GCR2, gcr2-2, the seed of the identical developmental stage that obtains on the gcr2-3 can be sprouted (A among Fig. 6), and the forfeiture of gcr2 mutant seed dormancy process is described.The seed dormancy process is mainly by plant hormone ABA control, and hint gcr2 mutant may cause ABA signal pathway obstacle, and has reduced the susceptibility of plant to ABA.In order to confirm that further above-mentioned hypothesis, the present invention have detected the reaction of gcr2 mutant to other process (seed germination, growth of seedling, stomatal aperture and blade dehydration) of ABA control.

The seed germination experimental result shows, compare with wild-type plant, gcr2 mutant gcr2-1, gcr2-2, gcr2-3 is insensitive to the seed germination that ABA suppresses, but the seed germination hypersensitization (B among Fig. 6) that GCR2 overexpression plant (GCR20E) suppresses ABA, the growth of seedling experiment shows gcr2 mutant gcr2-1, gcr2-2, gcr2-3 is insensitive to the seedling development that ABA suppresses, and its overexpression plant (GCR20E) is to the seedling development hypersensitization (C among Fig. 6) of ABA control.

3, the ABA regulate gene expression changes in the GCR2 mutant

ABA regulates development of plants and regulates and control some expression of gene realizations by it, and relatively some typically are subjected to the expression of the gene of ABA regulation and control at wild-type and gcr2 mutant for this reason.Choose the gene promoter of three kinds of known ABA regulation and control, comprise RD29A, KIN1 and ABI5 promotor are carried out expression pattern and are detected.

Genomic dna with the environmental Arabidopis thaliana of Columbia (Col-0) is a template respectively, utilize following primer PCR amplification 1526bp RD29A promotor: upstream: 5 '-ctgcagttttgcttttgaatgtttgtgtttttgtat-3 ', downstream: 5 '-tctagaattttccaaagatttttttctttccaatag-3 '; Utilize following primer PCR amplification 2184bpKIN1 promotor: upstream: 5 '-ctgcagtcaagtttttaattttcgttttcttgaataat-3 ', downstream: 5 '-tctagatttttcagatatttatttcttgtaaaatcgtt-3 '; Utilize following primer PCR amplification 3034bp ABI5 promotor: 5 '-ctgcagttaaggttggctggagtaacgc-3 ', downstream: 5 '-ggatccaccacctcctccattatgtctcg-3 '.With the PCR product of RD29A promotor, KIN1 promotor, ABI5 promotor through check order correct after, after using restriction enzyme PstI and XbaI double digestion respectively, be cloned between the PstI and XbaI enzyme cutting site of pCAMBIA-GCR2p-GUS, obtain containing the recombinant vectors pCAMBIA-RD29Ap-GUS of RD29A promotor, the recombinant vectors pCAMBIA-KIN1p-GUS that contains the KIN1 promotor contains the recombinant vectors pCAMBIA-ABI5p-GUS of ABI5 promotor.

PCAMBIA-RD29Ap-GUS, method (the Clough-SJ that pCAMB IA-KIN1p-GUS and pCAMB IA-ABI5p-GUS soak by flower respectively, Bent-AF.Floral dip:a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana.Plant-Journal.1998,16:6,735-743) utilize agrobacterium tumefaciens bacterial strain GV3101 to transform the environmental Arabidopis thaliana of Columbia (Col-0), the T0 that obtains is transformed seedling for transfer-gen plant with Totomycin (Hygromycin B is available from Roche company) screening.Positive T0 through hygromycin selection is carried out PCR as follows for plant to be identified: the primer is respectively upstream 5 '-ATGGTCCGTCCTGTAGAAACCCCAACCCG-3 ', and downstream 5 '-TCATTGTTTGCCTCCCTGCTGCGG-3 ' obtains the segmental transfer-gen plant that changes pCAMBIA-RD29Ap-GUS, pCAMBIA-KIN1p-GUS and pCAMBIA-ABI5p-GUS that is respectively of gus gene of 1811bp.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling, carry out PCR according to the method described above and identify, results T ₁The seed (T that ties for the PCR positive plant ₂Generation), plant.PCR is identified that male changes pCAMBIA-RD29Ap-GUS T ₂Hybridize, PCR is identified that male changes pCAMBIA-KIN1p-GUS T for plant and gcr2 mutant gcr2-2 ₂Hybridize, PCR is identified that male changes pCAMBIA-ABI5p-GUS T for plant and gcr2 mutant gcr2-2 ₂Hybridize for plant and gcr2 mutant gcr2-2, gather in the crops promotor PCR respectively and identify the seed bearing seed (F of positive plant ₁Generation), plants results F ₁Identify the seed (F that ties of positive plant for promotor PCR ₂Generation), plants, the promotor PCR that obtains is identified male F ₂Carry out the qualitative and detection by quantitative of gus gene for seedling and the environmental Arabidopis thaliana of Columbia (Col-0).

Wherein, used damping fluid in the GUS qualitative detection: the X-Gluc mother liquor: 100mg X-Gluc is dissolved in 5ml DMF; X-Gluc base fluid: 50mM PBS pH7.0 (NaH ₂PO ₄50mM is 0.78g/100ml, Na ₂HPO ₄50mM is 1.791g/100ml) dissolving EDTA2Na (10mM is 372mg), TritonX-100 (0.1%, 100 μ l), the iron potassium hydride KH (0.5mM, 16.5mg), (0.5mM 21.1mg) is settled to 100ml to ferrous potassium hydride KH.

X-Gluc uses liquid: 50ul mother liquor+950 μ l base fluids.The transgenosis resistance screening seedling of choosing suitable size immerses X-Gluc and uses in the liquid 37 ℃ of dyeing 1-48 hour up to dyeing ideal effect; Inhale dereaction liquid, the decolouring of 70%, 75%, 80%, 85%, 90%, 95%, 100% ethanol gradient.Microscopic examination is taken a picture.

The GUS quantitative detecting method is as follows: transfer to adding GUS detection damping fluid (50mM NaPO in the mortar of icing precooling after the Arabidopis thaliana seedling in 2 all ages is fully ground in liquid nitrogen ₄, pH7.0,5mM DTT, 1mM EDTA, 0.1% Triton X-100) and back continuation grinding is fully.Centrifugal 20 minutes of 4 degree 12000g.Protein concentration Bradford method accurate quantification.The supernatant liquor of 20 microlitres joins 100 microlitre MUG (Sigma, MUG are dissolved in GUS and detect damping fluid, and concentration is 5mM) back to be mixed with 380 microlitre GUS detection damping fluid, and 37 degree are hatched and added 500 microlitre termination reaction damping fluid (0.2M Na after 20 minutes ₂CO ₃, pH9.5).Under excitation wavelength 365 nanometers and emission wavelength 455 nanometer conditions, detect product MU fluorescent value.Make 4-MU (Sigma, 10mM mother liquor) typical curve (100nM, 250nM, 500nM, and 1 μ M).The GUS activity is defined as: nmolesMU min ^-1Mg ^-1Protein.

The result as shown in Figure 7, the result of GUS qualitative detection will be higher than the activity of GUS under the mutant background for the activity of GUS in the transfer-gen plant under the wild-type background among the A, the result of GUS quantitative analysis also has identical result among the B simultaneously.Show with the wild-type plant and compare that the expression level of these three genes in the GCR2 mutant significantly suppressed (Fig. 7), show that the GCR2 sudden change has also influenced the expression that is subjected to the ABA regulatory gene.A is the genetic expression coloration result among Fig. 7; B measures for the Gus expression activity; Wild-type among A and the B represents that respectively PCR identifies that male changes pCAMBIA-RD29Ap-GUS T ₂Identify that for plant, PCR male changes pCAMBIA-ABI5p GUS T ₂Identify that for plant or PCR male changes pCAMBIA-KIN1p-GUS T ₂For plant; Gcr2-2 represents that respectively PCR identifies that male changes pCAMBIA-RD29Ap-GUS T ₂Hybridize the promotor PCR evaluation male F that obtains for plant and gcr2-2 ₂For seedling, PCR identifies that male changes pCAMBIA-ABI5p-GUS T ₂Hybridize the promotor PCR evaluation male F that obtains for plant and gcr2-2 ₂Identify that for seedling or PCR male changes pCAMBIA-KIN1p-GUS T ₂Hybridize the promotor PCR evaluation male F that obtains for plant and gcr2-2 ₂For seedling.

4, stomatal aperture and blade dehydration experiment

The pore of plant is the door that plant and external environment are carried out moisture and gaseous interchange.Under normal habitat, plant passes through pore moisture exchange and gas, thereby guarantees the intravital moisture state balance of plant and carry out normal photosynthesis.Under adverse environmental factor, plant is closed pore in order to prevent moisture excessively to scatter and disappear.The major hormone of present known regulation and control stomatal movement is ABA, and the pore opening that is suppressed by ABA inductive stomatal closure and ABA is the classics reaction of ABA.Test the relation of studying GCR2 and ABA below by stomatal aperture and blade dehydration.

For the experiment of ABA inductive stomatal closure, the lotus throne leaf of the following plant in 5 all left and right sides places KCl-MES damping fluid (50mM KCl, 10mM MES, pH6.12) (250 μ mol m under the light ^-2s ^-1) handled 90 minutes so that pore is opened: the environmental Arabidopis thaliana of Columbia (Col-0) (WT), the environmental arabidopsis mutant body of Columbia (Col-0): gcr2-1, gcr2-2, gcr2-3, GCR2 cross expression plant (GCR20E).From the blade epidermis bar microscopy stomatal aperture of tearing, place KCl-CaCl normally ₂(50mM KCl, 1mM CaCl in the MES damping fluid ₂, 10mM MES, pH6.12,25 μ M ± ABA (Sigma) detect its ABA susceptibility, place same reaction buffer (no ABA) in contrast from the epidermis bar with a slice leaf simultaneously.(250 μ mol m under the light ^-2s ^-1) react the aperture of 2 hours posterior spiracles in microscopically measurement statistics; Open experiment for the pore that ABA suppresses, the lotus throne leaf of the following plant in 5 all left and right sides places KCl-MES damping fluid (50mM KCl, 10mM MES, pH6.12), handle in the dark and induced the environmental Arabidopis thaliana of stomatal closure: Columbia (Col-0) (WT (Col-0)), the environmental arabidopsis mutant body of Columbia (Col-0): gcr2-1, gcr2-2, gcr2-3 in 2 hours, (the environmental Arabidopis thaliana of WT (WS) expression Wassilewskija, ABRC), and gap1-2 (the gap1 mutant, ABRC).Subsequently blade is transferred to KCl-CaCl ₂(50mM KCl, 1mM CaCl in the MES damping fluid ₂, 10mM MES pH6.12) adds or does not add (in contrast) 25 μ M ± ABA (Sigma), and light continues to handle 2 hours down, and microscopically is measured the aperture of statistics pore behind the epidermis bar of the leaf of tearing.For blade dehydration experiment, the 5-6 sheet leaf of the different genotype plant in clip same culture conditions isometric growth period, be placed at once weigh on the exsiccant culture dish after, place incubator, weighed once every 30 minutes.The dehydration of blade is defined as the per-cent that the different time points dehydration accounts for fresh weight.

The result shows under the processing of Exogenous ABA (simulation adverse environmental factor), and the pore of wild-type plant is closed very soon, and gcr2 mutant gcr2-1, gcr2-2, the pore of gcr2-3 but be open as usual (D among Fig. 6).Show gcr2 mutant gcr2-1 simultaneously, gcr2-2, the pore open also insensitive (E among Fig. 6) that the pore of gcr2-3 suppresses ABA.The opening of ABA regulation and control pore is by the K on guard cell's plasma membrane of regulation and control plant stomata ⁺Channel activity realizes, for this reason, detected the K among the guard cell of wild-type and gcr2 mutant with patch clamp technique ⁺The activity of passage finds that Exogenous ABA can suppress the K that flows in the guard cell of wild-type plant ⁺The activity of passage, but gcr2 mutant gcr2-1, stream K in the gcr2-2, gcr2-3 guard cell ⁺Channel activity shows that but to not reaction (F among Fig. 6) of exogenous aba treatment GCR2 participates in the interior stream K of regulation and control by ABA control ⁺The activity of passage.The result also shows and wild-type plant pore reacting phase ratio, GCR2 overexpression plant stomatal closure is to ABA hypersensitization (G among Fig. 6), reaction as stomatal closure, gcr2 mutant gcr2-1, gcr2-2, gcr2-3 blade rate-of-loss of coolant want fast than the wild-type plant leaf, and GCR2 overexpression plant (representing with " GCR2 overexpression " among Fig. 8) blade rate-of-loss of coolant is than wild-type blade slow (Fig. 8).Comprehensive The above results shows that GCR2 has participated in the important reaction of all ABA.

Among Fig. 6, A is the seed dormancy experimental result; B is the seed germination experimental result; C is the growth of seedling experimental result; D is the stomatal closure experimental result; E is pore opening experiment result; F is interior stream K ⁺The passage experimental result; G causes the hypersensitization experimental result of pore to ABA for overexpression GCR2.

5, GCR2 and GPA1 acting in conjunction regulation and control ABA reaction

Above-mentioned result of study shows that the mutant of GCR2 causes ABA reaction disappearance.The mutant of GPA1 also can cause disappearance (Wang, X-Q., Ullah, H., Jones, the A.M.﹠amp of some ABA reflections; Assmann, S.M.G proteinregulation of ion channels and abscisic acid signalling in Arabidopsis guardcells.Science 292,2070-2072 (2001)), show that the two may acting in conjunction transmission ABA signal.Carry out the experiment of GCR2 and GPA1 expression pattern below;

(1) acquisition of plant

Genomic dna with the environmental Arabidopis thaliana of Columbia (Col-0) is a template, utilizing the amplification of primer upstream: 5 '-ACGCGTCGACACAGAAACAGAACTCAGATATAG-3 ' and downstream 5 '-GCTCTAGACTCATTTCGGAAAAACCGTTCTCCC-3 ' to begin a segment length upwards from the GCR2 initiator codon is that the genome sequence of 1223bp is as the GCR2 promotor, and identify correct through order-checking, behind restriction enzyme SalI and XbaI double digestion, be cloned between the SalI and XbaI enzyme cutting site of pBIN121 (CLONTECH), obtain containing the recombinant vectors pBIN-GCR2p-GUS of GCR2 promotor.Downcut GCR2 promotor-GUS-NOS fragment with SalI and EcoRI from pBIN-GCR2p-GUS, be cloned between the SalI and EcoRI restriction enzyme site of pCAMBIA1300 (CAMBIA), obtain recombinant vectors pCAMBIA-GCR2p-GUS.Genomic dna with the environmental Arabidopis thaliana of Columbia (Col-0) is a template, utilize the amplification of primer upstream: 5 '-AACTGCAGATGTGATGTTTTTGTAGGTTGAAG-3 ' and downstream 5 '-CGGGATCCGATTGTTTCTATATCCCCACAGG-3 ' from the GPA1 initiator codon begin a segment length upwards be 1353bp GPA1 promotor and identify correct through order-checking, be cloned into restriction enzyme PstI and BamHI and displace the GCR2 promotor on the pCAMBIA-GCR2p-GUS carrier, the gained plasmid is pCAMBIA-GPA1p-GUS.

With pET28a-GPA1 is template, uses upstream primer

5 '-CCGCTCGAGATGGGCTTACTCTGCAGTAGAAGTCG-3 ' and downstream primer:

5 '-GACTAGTTCATAAAAGGCCAGCCTCCAG-3 ' carries out pcr amplification, the PCR fragment that obtains is reclaimed and is cloned on pGEM-T (Promega) carrier, carry out sequencing analysis, the correct clone that checks order downcuts the external source fragment with restriction enzyme XhoI and SpeI and it is cloned between the XhoI and SpeI site of pBI101 again, obtains containing the recombinant vectors called after pTA-wG α OE of GPA1.

Method (the Clough-SJ that pCAMBIA-GCR2p-GUS, pCAMBIA-GPA1p-GUS or pTA-wG α OE soak by flower, Bent-AF.Floral dip:a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana.Plant-Journal.1998,16:6,735-743) utilize agrobacterium tumefaciens bacterial strain GV3101 to transform the environmental Arabidopis thaliana of Columbia (Col-0), to the T that obtains ₀Transform seedling for transfer-gen plant with Totomycin (Hygromycin B is available from Roche company) screening.Identify carrying out PCR through the commentaries on classics pTA-wG of hygromycin selection α OE T0 as follows for plant: the segmental plant of GPA1 that upstream primer 5 '-CCGCTCGAGATGGGCTTACTCTGCAGTAGAAGTCG-3 ' and downstream primer: 5 '-GACTAGTTCATAAAAGGCCAGCCTCCAG-3 ', PCR obtain 1152bp is the positive pTA-wG of commentaries on classics of PCR α OET ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.Results T ₁The seed (T that ties for the PCR positive plant ₂Generation), plant, individual plant is spread the hygromycin resistance plate screening after collecting seed, all is that the individual plant of resistance seedling is the transfer-gen plant (T that isozygotys ₃Generation), this T3 is a wG α OE plant for plant.

To through the commentaries on classics pCAMBIA-GCR2p-GUS of hygromycin selection T ₀Utilize upstream primer for plant: 5 '-ACGCGTCGACACAGAAACAGAACTCAGATATAG-3 ' and downstream primer 5 '-GCTCTAGACTCATTTCGGAAAAACCGTTCTCCC-3 ' performing PCR identifies that the plant that PCR obtains the GCR2 promoter fragment of 1223bp is the positive pCAMBIA-GCR2p-GUS of commentaries on classics of PCR T ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.Results T ₁The seed (T that ties for the PCR positive plant ₂Generation), plant, individual plant is spread the hygromycin resistance plate screening after collecting seed, all is that the individual plant of resistance seedling is the transfer-gen plant (T that isozygotys ₃Generation), this T ₃Be commentaries on classics pCAMBIA-GCR2p-GUS homozygous plants for plant.This commentaries on classics pCAMBIA-GCR2p-GUS homozygous plants is carried out GUS dyeing to be detected.

To through the commentaries on classics pCAMBIA-GPA1p-GUS of hygromycin selection T ₀Utilize upstream primer for plant: 5 '-AACTGCAGATGTGATGTTTTTGTAGGTTGAAG-3 ' and downstream primer: 5 '-CGGGATCCGATTGTTTCTATATCCCCACAGG-3 ' carries out PCR to be identified, the plant that PCR obtains the GPA1 promoter fragment of 1353bp is the positive pCAMBIA-GPA1p-GUST of commentaries on classics of PCR ₀For plant.Gather in the crops above-mentioned T ₀The seed (T that ties for the PCR positive plant ₁Generation) plants, obtain T ₁For seedling.Results T ₁The seed (T that ties for the PCR positive plant ₂Generation), plant, individual plant is spread the hygromycin resistance plate screening after collecting seed, all is that the individual plant of resistance seedling is the transfer-gen plant (T that isozygotys ₃Generation), this T3 is commentaries on classics pCAMBIA-GPA1p-GUS homozygous plants for plant.This commentaries on classics pCAMBIA-GPA1p-GUS homozygous plants is carried out GUS dyeing to be detected.

(mutant, ABRC) plant (female parent) hybridizes the F that obtains with gpa1-2 with gcr2-1 plant (male parent) ₁Double mutant gcr2-1/gpa1-2 on behalf of gcr2 and gpa1.

Gpa1-2 plant (female parent) and GCR20E plant (male parent) are hybridized the F that obtains ₁On behalf of the GCR20E/gpa1-2 plant.

Gcr2-1 plant (female parent) and wG α OE plant (male parent) are hybridized the F that obtains ₁On behalf of wG α OE/gcr2-1 plant.

The GUS dyeing of transfer-gen plant among the figure A (changeing the pCAMBIA-GCR2p-GUS homozygous plants) shows the seed that GCR2 is just sprouting, the lotus throne leaf of seedling phase, and expression arranged all in the stomatal cell, the GUS dyeing of transfer-gen plant among the figure B (changeing the pCAMBIA-GPA1p-GUS homozygous plants) shows the seed that GPA1 is just sprouting, the lotus throne leaf of seedling phase, and expression arranged all also in the stomatal cell, show that GCR2 and GPA1 have identical expression pattern (A and B among Fig. 9), so with stomatal closure as the two mutual relationship in the ABA signal transduction of index observing.Wherein, the stomatal closure experiment is carried out according to the method described above.The result shows that the double mutant (gcr2-1/gpa1-2) of gcr2 and gpa1 is similar to their single mutants (gcr2-1, gpa1-2) separately to the reaction of ABA, overexpression GCR2 (GCR20E) or GPA1 (wG α OE) can make plant to ABA signal hypersensitization, but this effect of GCR2 depends on the existence of GPA1, the effect of GPA1 also depends on exist (C and the D among Fig. 9) of GCR2, shows it is that the ABA signal is transmitted in GCR2 and GPA1 acting in conjunction.

Among Fig. 9, A is the expression pattern result of GCR2, and B is the expression pattern result of GPA1; C and D are the result of stomatal closure reaction.

6, GCR2 is the plasma membrane acceptor of ABA

The above results shows that GCR2 participates in all ABA reactions of regulation and control, and GCR2 itself is a kind of membrane receptor, and hint GCR2 may be exactly the acceptor of ABA.In order to verify this point, whether the present invention at first detects the GCR2 recombinant protein of purifying can be in conjunction with ABA.Concrete grammar is as follows:

The His of purifying ₆-GCR2 is according to the His of the preparation of the method among the embodiment 1, purifying ₆-GPA1 prepares according to the method among the embodiment 3.

FCA is prepared as follows: the first chain cDNA that obtains with the total RNA reverse transcription of the lotus throne Ye of the environmental Arabidopis thaliana of Columbia (Col-0) (ABRC) is a template, use upstream primer: 5 '-CGGGATCCATGCAACATCCTCCTTCTGAGCTAGC-3 ' and downstream primer: the encoding sequence of 5 '-CCGCTCGAGTCAAGCTTTATTCTTCCACATGAG-3 ' pcr amplification FCA from N-terminal the 500th to 747 amino acids residue, the PCR product that obtains is cloned between the BamHI and XhoI site of pGEX-6P-1 (GE Healthcare) carrier with restriction enzyme BamHI and XhoI, obtains recombinant vectors pGEX-FCA.PGEX-FCA is transformed BL21 (Novagen), select the positive transformant of penbritin (Amp) resistance, in containing Amp liquid LB substratum, cultivate, extract plasmid enzyme restriction and identify.Positive colony liquid shakes training and spends the night, the 1L that spreads cultivation at 1: 50 contains and continues to shake training in the antibiotic LB substratum of Amp and added IPTG to final concentration 0.8mM in 1.5-2 hour behind OD600=0.6, continue to cultivate after 4 hours, 12000g, 4 degree were collected thalline in centrifugal 30 minutes.Protein purification is operated to specifications with Glutathione Sepharose 4B (Amersham) and is finished.The GST label cuts with PreScission Protease (Pharmacia) enzyme and removes.

The GCR2 of sex change is by obtaining 10 minutes ice baths of GCR2 albumen 95 degree heating in 10 minutes.

Be used for the GCR2 proteic expression of ABA in conjunction with experiment, purifying and ABA external in conjunction with experiment with reference to Razem etc., 2004, Purification and characterization of a barley aleurone abscisicacid-binding protein.J.Biol.Chem.279,9922-9929 and Zhang etc., 2002, Purification and identification of a 42-kilodalton abscisicacid-specific-binding protein from epidermis of broad bean leaves.PlantPhysiol.128, the 714-725 document carries out.Step makes an amendment slightly: His ₆-GCR2, His ₆After-GPA1 albumen elutes, use HiTrap desalting column (Amersham) that elution buffer is converted to binding buffer liquid (25mMTris-HCl damping fluid, pH7.3,250mM sucrose, 5mM MgCl at once ₂, 1mM CaCl ₂).The purifying protein of 50 nanograms is according to Zhang etc., 2002, Purification and identification of a42-kilodalton abscisic acid-specific-binding protein from epidermis of broadbean leaves.Plant Physiol.128, (Dextran T70-gac, Sigma) method is carried out ABA in conjunction with experiment to DCC in the 714-725 document.Binding buffer liquid is: 25mM Tris-HCl damping fluid, pH7.3,250mM sucrose, 5mM MgCl ₂, 1mM CaCl ₂, 50nM ³H-(±) ABA (Amersham, 40Ci/mmol).0.5g/100ml DCC ice bath 10 minute after the 4 degree down 2000g centrifugal 5 minute removal of free ABA by adding 100 μ l.Supernatant liquor is transferred to liquid and is dodged and to add 2 milliliters of liquid in the pipe and dodge liquid and go up the detection of radioactive activity at MicroBeta TriLux liquid scintillation counter (PerKin Elmer), and data are by SigmaPlot 2000 and DynaFit statistical study.Simultaneously carry out identical experiment in contrast with 50 nanogram FCA with the bovine serum albumin BSA of 50 nanograms, the GCR2 of 50 nanogram sex change.

In conjunction with experiment, comprise 50ng His for specificity ₆Add 50nM in the binding buffer liquid of-GCR2 in (100 μ l) ³H-(+) ABA or other four kinds of ABA analogues ((±) ABA, (+) ABA and (-) ABA are from Sigma, and trans-ABA is from A.G.Scientific) concentration be 1 to 1000 times of 50nM [ ³H]-ABA.Carry out according to above-mentioned experimental procedure in conjunction with condition.

The result shows that GCR2 really can be in conjunction with ABA, but the GCR2 of sex change and GPA1 and BSA can not be in conjunction with ABA (A among Figure 10).GCR2 is specific with combining of ABA because the structure homologue of the no physiologically active of ABA ((-) ABA trans-ABA) can not combine (B among Figure 10) with GCR2.ABA has saturability (C among Figure 10) with combining of GCR2, and the two bonded dissociation constant is 20.1nM, and each GCR2 albumen can be in conjunction with an ABA molecule (D among Figure 10).

The yeast clone that is used for the interactional co-immunoprecipitation of GCR2-GPA1 comes the positive colony of spontaneous fission ubiquitin system experimentation.30 degree shake the GCR2-NubG+GPA1-Cub that spends the night of training or NubG-KAT1+KAT1-Cub yeast and are diluted to OD=0.2-0.3 and continue to cultivate OD ₆₀₀=0.5-0.8.Adding four kinds of ABA structure homologues ((+) ABA and (-) ABA are from Sigma for 10mM ethanol mother liquor, (±) ABA, and trans-ABA is from A.G.Scientific) final concentration behind yeast culture liquid 5 branches such as grade respectively is that 10 μ M contrast adds 0.1% ethanol.Continue to cultivate after 90 minutes centrifugal collection thalline, program detectionof to specifications.Test for co-immunoprecipitation, yeast GCR2-NubG+GPA1-Cub or NubG-KAT1+KAT1-Cub at-Leu/-Trp/-His/-Ade substratum (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.6g/1000ml-Leu/-Trp/-His/-Ade synthesizing amino acid mixture) shakes on and train OD ₆₀₀=0.8.Bacterium liquid is according to above-mentioned processing centrifugal collection thalline after 20 minutes, and precipitation is resuspended in (50mMNa in the IP damping fluid ₃PO ₄PH7.5,200mM NaCl, 10% glycerine, 0.1% NP40,10mM NaF, 2.5mMglycerolphosphate, 1mM Na ₃VO ₄, 0.5mM DTT, 1mM PMSF, 1 * plant protease inhibitor cocktail; Roche) add 100 μ l granulated glass spherees (Sigma) simultaneously.Fast concussion 5 minutes (per 30 seconds place 1 minute on ice), 14, centrifugal 10 minutes of 000rpm 4 degree.2 μ g anti-HA antibody (Sigma, precipitation GCR2-NubG-HA fusion rotein) is added in the supernatant 4 ℃ and fosters 4h, add after 20 μ l protein A-Sepharose (Sigma) continue to foster 2 hours, centrifugal 2 minutes collecting precipitations of 6000g 4 degree, precipitation are given a baby a bath on the third day after its birth with 4.5 milliliters of IP damping fluids and time are then boiled sample 10 minutes with 8%SDS-PAGE electrophoretic separation albumen in the SDS sample-loading buffer.Use anti-HA antibody and anti-GPA1 antibody detection protein signal respectively.Relative strength of signal MetaVue 6.2r4 (Universal Imaging Corp) software analysis.

GCR2-NubG+GPA1-Cub or NubG-KAT1+KAT1-Cub yeast at-Leu/-Trp/-His/-Ade substratum (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.6g/1000ml-Leu/-Trp/-His/-Ade shake the synthesizing amino acid mixture) training spend the night after, be diluted to fresh culture at 1: 1000, be added drop-wise to respectively the ABA that adds or do not add 10 μ M-the Leu/-Trp/-His/-Ade flat board on (available from Clontech company, it consists of 0.67% YNB DIFCO company, 2% glucose, 0.6g/1000ml-Leu/-Trp/-His/-Ade synthesizing amino acid mixture, 20 grams per liter agar, 1mM Met), 30 degree were cultivated 7 days, observed the yeast growth situation.Further in the yeast system of reorganization, confirmed that ABA combines with GCR2 and caused dissociating of GCR2-GPA1 complex body, thus the effector (E among Figure 10) in dissociate G α and G β γ subunit deexcitation downstream.

Among Figure 10, A is the experimental result of ABA in conjunction with GCR2; B is that ABA has the specific experimental result of three-dimensional arrangement in conjunction with GCR2; C is ABA has saturability in conjunction with GCR2 a experimental result; D is ABA and GCR2 bonded dissociation constant; E is that ABA causes the dissociated experimental result of GCR2-GPA1 complex body in conjunction with GCR2.Among the E, 10 μ M (±) ABA have been added in "+" expression in the ABA row, and (±) ABA is not added in "-" expression.

Sequence table

<160>3

<210>1

<211>1206

<212>DNA

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>1

atgccggagt ttgtaccgga agatttatcc ggagaagaag aaactgttac cgaatgtaaa 60

gattcgttga cgaaactgct atcacttccg tacaaatcat tctcagagaa gcttcacaga 120

tatgctctaa gcatcaaaga taaagtagtc tgggagacat gggaacgatc tggaaaacgt 180

gttcgagatt ataacttgta tactggagtt cttgggacag cttatctctt gttcaaatct 240

tatcaggtta ctagaaatga agatgatctt aagctatgct tagagaatgt tgaagcttgt 300

gatgtagctt caagagattc tgagcgagtg acatttatat gtggctatgc tggtgtatgt 360

gctcttggtg ctgttgcagc gaagtgttta ggtgatgacc agttatatga tcgttactta 420

gcccgtttcc gagggattag gcttcctagt gacttgccat atgagttgct atatggtaga 480

gcaggatact tgtgggcgtg tttgttcttg aataagcata ttggtcagga gagtatatca 540

tctgaacgaa tgagatcagt ggttgaggaa atcttcaggg caggaagaca actcgggaat 600

aaaggaactt gtccattgat gtatgagtgg cacgggaaga ggtactgggg ggctgcacac 660

ggtttagctg ggatcatgaa tgttttgatg catacggaac ttgaaccaga tgaaatcaaa 720

gatgtcaaag gtacactaag ctatatgata caaaaccgtt ttcctagcgg gaattaccta 780

tctagtgaag gaagcaaatc agatcgcctt gttcactggt gtcacggtgc tcctggtgtt 840

gctctcacac ttgtaaaggc agctcaggtt tataacacta aggaatttgt agaggcagca 900

atggaggcag gagaagttgt gtggagccgt ggattgctta aacgagtagg aatctgtcac 960

ggtatcagcg gaaacacata cgtgtttctt tctctatacc ggttaacaag aaacccaaag 1020

tatttgtacc gcgctaaagc tttcgcgtct ttcctactcg ataaatcaga gaagttaatc 1080

tcagaaggtc aaatgcatgg aggagataga cccttctctc tctttgaagg tatcggagga 1140

atggcctaca tgttactcga catgaatgat ccaacacaag ctctgtttcc aggttatgaa 1200

ctctaa 1206

<210>2

<211>401

<212>PRT

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>2

Met Pro Glu Phe Val Pro Glu Asp Leu Ser Gly Glu Glu Glu Thr Val

1 5 10 15

Thr Glu Cys Lys Asp Ser Leu Thr Lys Leu Leu Ser Leu Pro Tyr Lys

20 25 30

Ser Phe Ser Glu Lys Leu His Arg Tyr Ala Leu Ser Ile Lys Asp Lys

35 40 45

Val Val Trp Glu Thr Trp Glu Arg Ser Gly Lys Arg Val Arg Asp Tyr

50 55 60

Asn Leu Tyr Thr Gly Val Leu Gly Thr Ala Tyr Leu Leu Phe Lys Ser

65 70 75 80

Tyr Gln Val Thr Arg Asn Glu Asp Asp Leu Lys Leu Cys Leu Glu Asn

85 90 95

Val Glu Ala Cys Asp Val Ala Ser Arg Asp Ser Glu Arg Val Thr Phe

100 105 110

Ile Cys Gly Tyr Ala Gly Val Cys Ala Leu Gly Ala Val Ala Ala Lys

115 120 125

Cys Leu Gly Asp Asp Gln Leu Tyr Asp Arg Tyr Leu Ala Arg Phe Arg

130 135 140

Gly Ile Arg Leu Pro Ser Asp Leu Pro Tyr Glu Leu Leu Tyr Gly Arg

145 150 155 160

Ala Gly Tyr Leu Trp Ala Cys Leu Phe Leu Asn Lys His Ile Gly Gln

165 170 175

Glu Ser Ile Ser Ser Glu Arg Met Arg Ser Val Val Glu Glu Ile Phe

180 185 190

Arg Ala Gly Arg Gln Leu Gly Asn Lys Gly Thr Cys Pro Leu Met Tyr

195 200 205

Glu Trp His Gly Lys Arg Tyr Trp Gly Ala Ala His Gly Leu Ala Gly

210 215 220

Ile Met Asn Val Leu Met His Thr Glu Leu Glu Pro Asp Glu Ile Lys

225 230 235 240

Asp Val Lys Gly Thr Leu Ser Tyr Met Ile Gln Asn Arg Phe Pro Ser

245 250 255

Gly Asn Tyr Leu Ser Ser Glu Gly Ser Lys Ser Asp Arg Leu Val His

260 265 270

Trp Cys His Gly Ala Pro Gly Val Ala Leu Thr Leu Val Lys Ala Ala

275 280 285

Gln Val Tyr Asn Thr Lys Glu Phe Val Glu Ala Ala Met Glu Ala Gly

290 295 300

Glu Val Val Trp Ser Arg Gly Leu Leu Lys Arg Val Gly Ile Cys His

305 310 315 320

Gly Ile Ser Gly Asn Thr Tyr Val Phe Leu Ser Leu Tyr Arg Leu Thr

325 330 335

Arg Asn Pro Lys Tyr Leu Tyr Arg Ala Lys Ala Phe Ala Ser Phe Leu

340 345 350

Leu Asp Lys Ser Glu Lys Leu Ile Ser Glu Gly Gln Met His Gly Gly

355 360 365

Asp Arg Pro Phe Ser Leu Phe Glu Gly Ile Gly Gly Met Ala Tyr Met

370 375 380

Leu Leu Asp Met Asn Asp Pro Thr Gln Ala Leu Phe Pro Gly Tyr Glu

385 390 395 400

Leu

<210>3

<211>1662

<212>DNA

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>3

atgccggagt ttgtaccgga agatttatcc ggagaagaag aaactgttac cgaatgtaaa 60

gattcgttga cgaaactgct atcacttccg tacaaatcat tctcagagaa gcttcacaga 120

tatgctctaa gcatcaaaga taaagtaact cacttttcaa tttgattata tatgattttg 180

agttataatg aagttatgta gttataatga atttatgact tttctttagt ctagtgaagt 240

tgtgttttct cttgtttgtg tggtgattct gttttaggta gtctgggaga catgggaacg 300

atctggaaaa cgtgttcgag attataactt gtatactgga gttcttggga cagcttatct 360

cttgttcaaa tcttatcagg ttactagaaa tgaagatgat cttaagctat gcttagagaa 420

tgttgaagct tgtgatgtag cttcaagaga ttctgagtaa gtgaattttc ttcaatgatc 480

caattttcat gaattcattt cggggtaatg attgtggttt ctatcaggcg agtgacattt 540

atatgtggct atgctggtgt atgtgctctt ggtgctgttg cagcgaagtg tttaggtgat 600

gaccagttat atgatcgtta cttagcccgt ttccgagggg taattactaa ttacagtttc 660

ttttgctcta gtgaaaatag ataacttgtt ctatactttg cttgagtgtt gcaactttga 720

tctgtttaac agattaggct tcctagtgac ttgccatatg agttgctata tggtagagca 780

ggatacttgt gggcgtgttt gttcttgaat aagcatattg gtcaggagag tatatcatct 840

gaacgaatgg tataataaag ttataaaatt tctttggtta attgacttac tcaagaaagt 900

tcaagatttt atgatatctc tatatcttca gagatcagtg gttgaggaaa tcttcagggc 960

aggaagacaa ctcgggaata aaggaacttg tccattgatg tatgagtggc acgggaagag 1020

gtactggggg gctgcacacg gtttagctgg gatcatgaat gttttgatgc atacggaact 1080

tgaaccagat gaaatcaaag atgtcaaagg tacactaagc tatatgatac aaaaccgttt 1140

tcctagcggg aattacctat ctagtgaagg aagcaaatca gatcgccttg ttcactggtg 1200

tcacggtgct cctggtgttg ctctcacact tgtaaaggca gctcaggtaa tcatttgttg 1260

attgaagtac tcttatcagt aagtaaaacc acaatgcaaa actcattttc tggatatcgt 1320

caggtttata acactaagga atttgtagag gcagcaatgg aggcaggaga agttgtgtgg 1380

agccgtggat tgcttaaacg agtaggaatc tgtcacggta tcagcggaaa cacatacgtg 1440

tttctttctc tataccggtt aacaagaaac ccaaagtatt tgtaccgcgc taaagctttc 1500

gcgtctttcc tactcgataa atcagagaag ttaatctcag aaggtcaaat gcatggagga 1560

gatagaccct tctctctctt tgaaggtatc ggaggaatgg cctacatgtt actcgacatg 1620

aatgatccaa cacaagctct gtttccaggt tatgaactct aa 1662

Claims (8)

1, a kind of g protein coupled receptor and dormin acceptor are following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and can with the G protein-interacting and can with the dormin bonded by (a) deutero-protein.

2, the encoding gene of described g protein coupled receptor of claim 1 and dormin acceptor.

3, gene according to claim 2 is characterized in that: the encoding gene of described g protein coupled receptor and dormin acceptor is following 1) or 2) gene:

1) its nucleotide sequence is the sequence 1 or 3 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encode described g protein coupled receptor and dormin acceptor.

4, the recombinant expression vector that contains claim 2 or 3 described g protein coupled receptors and dormin acceptor encoding gene.

5, the transgenic cell line that contains claim 2 or 3 described g protein coupled receptors and dormin acceptor encoding gene.

6, the transformed host bacterium that contains claim 2 or 3 described g protein coupled receptors and dormin acceptor encoding gene.

7, claim 2 or 3 described g protein coupled receptors and the dormin acceptor encoding gene application in the resistance of regulating plant.

8, claim 2 or 3 described g protein coupled receptors and the dormin acceptor application in the resistance of regulating plant.

Images