CN1807452A - Helicobacter Pylori urease B subunit Th epitope peptide, its coding DNA, vaccine and uses - Google Patents

Abstract

The invention provides three Th cell epitope peptide and code DNA of pylorus spirillum urease B subunit, also providing a bacterin of B cell epitope which contains the triepitope peptide and an additional urease B subunit. Among them, the epitope peptide is the polypeptide which has one of the amino acid residue sequences as follows: 1) hasing amino acid sequence of sequence 2, sequence3 and sequence 7 in sequence table; 2) replacing, deleting or appending the amino acid sequence of sequence 2, sequence3 and sequence 7 in sequence table by one or several amino acid residue to form derivanting polypeptide. The coded DNA is one of the following sequences: 1) hasing the ribonucleotide sequence of sequence 8, sequence 9 and sequence sequence 10 table. 2) Hasing the ribonucleotide sequence of same coded product with sequence 8, sequence 9 and sequence10 in sequence table. The epitope vaccine which contains the polypeptide of this invention has the protein vaccine of amino acid sequence in sequence 12 of sequence table. The vaccine or medication which is made by using the polypeptide of the invention as active component can clean out the infection caused by pylorus spirillum and has wide application prospect in medical realm.

Description

The Th epitope peptide of helicobacter Pylori urease B subunit, its coding DNA, vaccine and application thereof

Technical field

The invention belongs to the medical biotechnology field, relate to polypeptide, its coding DNA and application from helicobacter pylori (Hp).Wherein preferred 3 polypeptide are helper T cell (Th) epi-position from urease B subunit (UreB), the present invention relates to contain the composition of these epitope peptides, said composition can be used for the treatment of and (or) prevention helicobacter pylori infection.The invention provides the epiposition vaccine that comprises 3 preferred Th epi-positions and a B cell epitope (SIKEDVQF), the invention still further relates to synthetic peptide vaccine, gene recombination subunit vaccine and the nucleic acid vaccine etc. that comprise these Th epi-positions in addition.

Background technology

Nineteen eighty-two Australia scholar Warren and Marshall at first from people's stomach mucous membrane separation and Culture go out helicobacter pylori (Helicobacter pylori, Hp), their discovery makes in the past more than 20 year, for the understanding and the treatment of Peptic Ulcers very big change taken place.On October 3rd, 2005, Nobel prize evaluation committee announces, 2005 annual Nobel's physiology and medical science awarded give this two Australian scientists, found helicobacter pylori (Hp) and the effect of this bacterium in diseases such as gastritis and stomach ulcer to commend them.Research has confirmed that Hp is the important virulence factor of chronic gastritis, peptide ulceration and stomach mucous membrane associated lymphoid tissue lymphoma diseases such as (MALT), and relevant with the generation of cancer of the stomach, the World Health Organization has classified Hp as the I class virulence factor of cancer of the stomach.Effectively treatment and elimination Hp infect and have become the focus that people pay close attention to.

The multi-joint therapy for treating Hp of clinical main employing microbiotic infects at present, though can reach 85% eradication rate, have following shortcoming: 1, pharmacotherapy toxic side effect is big; 2, it is poor that Fu Za drug combination causes patient's compliance; 3, medicine can not prevent the infection again of Hp; 4, antibiotic therapy easily produces resistance and causes the treatment failure; 5, for the patient of developing country, pharmacotherapy is also difficult economically.Immunization is prevention and the most economical and effective means of sense of control metachromia disease, the high incidence that infects in view of Hp and with the gastritis of going slowly, peptide ulceration and cancer of the stomach, the lymphadenomatous substantial connection of stomach mucous membrane associated lymphoid tissue, how to reach the purpose of preventing and treating these diseases by immunization, be the emphasis problem of various countries scientific research personnel research always.Vaccine inoculation is by transferring the immunity system of body effectively, overcoming bacterium reaches preventing infection and eliminates the purpose of bacterial infection host's immune evasion, economical and easy, can in the crowd, use on a large scale, and still effective to drug-resistant bacteria, therefore study helicobacter pylori vaccine and have great importance.

Animal experiment study shows that vaccine inoculation can reduce Hp in the field planting of stomach sticking to mould, and the inflammatory reaction that alleviates stomach mucous membrane, plays the effect that prevention and treatment Hp infect.At present mostly the vaccine research about Hp is to adopt whole-bacterial-vaccine or recombinant subunit vaccine and nucleic acid vaccine etc., and the immunne response of the immunne response of its initiation during to the Hp natural infection is similar.Produce intensive cell and humoral immunoresponse(HI) during the Hp natural infection in the body; but infect still chronic ensured sustained development even lifelong the infection; illustrate that there is immunological tolerance in body to Hp; the immunne response that produces during natural infection can not play a protective role; thereby remove Hp by the mode of vaccine inoculation and just must transform antigen in antigen selection and epitope levels, excite more effective immunne response.Epiposition vaccine is a kind of new vaccine form that grows up with molecular biology and immunologic progress in recent years, can induce body to produce antigen-specific immune responses, and its side effect is slight, security good, be a new direction of present vaccine research, be widely used in virus, tumour, and the immunoprophylaxis and the treatment of chronic infectious disease.Using for reference the achievement in research of epiposition vaccine in other chronic infectious disease, is the immunological tolerance that the vaccine of basic design might be broken body with the Hp epi-position, reaches the purpose that prevention and treatment Hp infect.

Cellular immunization is CD4 especially ⁺T lymphocyte (being also referred to as helper T cell, the Th cell) plays an important role in anti-Hp infects.CD4 ⁺The antigen of T lymphocyte identification is exotic antigen combined and offered cell surface with MHC quasi-molecule after antigen presenting cell (APC) was handled small peptide, i.e. Th epi-position.By Th epi-position activated CD4 ⁺The T lymphocyte can be assisted B cell and CTL cell performance immunological effect.CD4 in Hp infects ⁺T also directly brings into play immunological effect and mediation immunoprotection except the performance subsidiary function: the research model of using MHC I quasi-molecule knock-out mice and MHC II quasi-molecule knock-out mice is found; the mouse that MHC II quasi-molecule knocks out can not play a protective role to the infection of Hp, CD4 ⁺What the T lymphocyte was discerned is the small peptide (being the Th epi-position) that is attached on the MHC quasi-molecule, and CD8 ⁺What the T lymphocyte was discerned is the small peptide (being the CTL epi-position) that is attached on the MHC quasi-molecule, therefore points out CD4 ⁺T lymphocyte but not CD8 ⁺The T lymphocyte infects Hp and has played immanoprotection action.Thereby to excite protective immune response, CD4 that must excitating organism to Hp ⁺The T lymphocyte immunity is replied.

Urease (Urease) is the main virulence factor of Hp; Hp settled down at people's stomach mucous membrane play an important role; in the sour environment of stomach; general bacterium is difficult to survival; but the urease of Hp can hydrolyze urea and is discharged ammonia; form one deck " ammonia cloud " protection Hp opposing hydrochloric acid in gastric juice around the thalline and in the stomach mucous membrane field planting, and the ammonia that discharges can directly damage stomach mucous membrane.The content height of urease in the Hp thalline accounts for 6% of soluble proteins, is made up of A and two subunits of B, wherein B subunit (UreB) is the urease activity subunit, conservative relatively in each bacterial strain, studies confirm that UreB has very strong antigenicity, be the candidate antigens of Hp vaccine preferably.Epi-position research about Hp mainly is to carry out at the B cell epitope of urease at present, discover the activity of the inhibition urease that the monoclonal antibody at the different epi-positions of urease B subunit (UreB) has, the activity that then strengthens urease that has, there is the scholar to attempt preparing vaccine, produces the neutralizing antibody that suppresses urease activity with UreB top fragment.And studies show that at present the immunoprotection that anti-Hp infects is by CD4 ⁺The T cell mediated, therefore adopt immune means prevention and treatment Hp to infect the CD4 of necessary excitating organism ⁺The T lymphocyte immunity is replied, but regrettably present also someone identifies the Th cell epitope of Hp, so the present invention starts with the method for research prevention and treatment Hp infection from the Th epi-position of the urease B subunit of evaluation Hp.

Thinking of the present invention is as follows: initial research is with BALB/c (H-2 ^d) mouse is animal model, at BALB/c (H-2 ^d) epiposition vaccine of research Hp on the animal model of mouse, adopt biosoftware to predict that UreB may H-2 ^dRestrictive Th epi-position, and with CD4 ⁺The T lymphocyte proliferation assay screens and identifies, has obtained the Th epitope peptide of 3 UreB.Theory according to epi-position research, the notion that has heterozygosity t cell epitope (promiscuous T cell epitope) or Universal T-cell epitopes (universal T cell epitope), be that some helper T cell epi-positions can combine the restriction that is subjected to the MHC molecule that can be less with multiple MHC-II quasi-molecule.The notion of super type and hyper-base preface was proposed again afterwards; super type (HLA Supertype) be meant can with the multiple HLA molecule of a kind of epitope peptide bonded (people's MHC molecule); correspondingly with it can be called " hyper-base preface " (Supermotif) with multiple HLA bonded epitope peptide; prepare vaccine with this hyper-base preface epi-position and can overcome the restrictive problem of MHC, obtain protectiveness widely.And whether the epi-position that identifies under the genetic background of mouse also has this specific character, the inventor has collected peripheral blood lymphocyte (PBMC) the action effect cell of Hp infected patient again, observed of the effect of these 3 epitope peptides, found that these 3 epitope peptides also can stimulate people's PBMC propagation people's PBMC.Therefore epitope peptide of the present invention can be used for developing the Hp epiposition vaccine that people or mouse are used, and can be used for developing the polypeptide drugs that prevention or treatment Hp infect.

In addition the present invention on the Th epi-position basis of the UreB that identifies Hp, invented a kind of based on epitope peptide vaccine and the method for design and the preparation method of epiposition vaccine are provided, experimentation on animals shows that this vaccine has good immunogenicity.

Summary of the invention:

The present invention is through deeply and extensive studies, and the UreB albumen of Hp is carried out on the basis of computer software analysis, optionally synthesized 7 polypeptide that may induce body to produce the Th cellullar immunologic response, passes through CD4 ⁺The T lymphocyte proliferation assay, filter out 3 Th epitope peptides, and its immunological characteristic estimated, find that these 3 epitope peptides can cause and reply in the BALB/c mouse body at the specific of UreB, and these 3 epitope peptides can stimulate Hp the infected's peripheral blood lymphocyte propagation, can be used for the exploitation of the vaccine and the medicine of human.Obtain a kind of epiposition vaccine in addition, shown good immunogenicity in the experimentation on animals based on 3 epitope peptides.Particular content is as follows:

One, first aspect of the present invention provides 3 helper T cell epitope peptides from helicobacter pylori (Hp) urease B subunit (being the Th epitope peptide), its coding DNA and application.

1, the present invention relates to 7 proteic polypeptide of the UreB from Hp.These peptides are selected from down group: have the polypeptide of sequence 1 in the sequence table, sequence 2, sequence 3, sequence 4, sequence 5, sequence 6, sequence 7 aminoacid sequences, it is characterized by through software prediction and may be the Th epi-position.

2, the invention provides the proteic helper T cell epitope peptide of UreB of 3 Hp, it has following characteristics:

1) has the aminoacid sequence of sequence 2 in the sequence table, sequence 3, sequence 7.

2) polypeptide of deriving that the aminoacid sequence of the sequence in the sequence table 2, sequence 3, sequence 7 is formed through replacement, disappearance or the interpolation of one or several amino-acid residue, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.

3, the invention provides the nucleotide sequence of the UreB albumen helper T cell epitope peptide of 3 Hp of coding, it is characterized by:

1) has the nucleotide sequence of sequence 8 in the sequence table, sequence 9, sequence 10.

2) with sequence table in sequence 8, sequence 9, sequence 10 have the nucleotide sequence of same-code product.

4, polypeptide of the present invention can be used the ordinary method synthetic, also can obtain with the genetically engineered recombination method.

5, polypeptide of the present invention can induce body to produce specific Th cellullar immunologic response, and has the effect of removing Hp.

6, contain the carrier of peptide coding nucleotide sequence of the present invention, comprise naked DNA, and change the protokaryon or the eukaryotic expression host that comprise this nucleotide sequence carrier over to and all belong to content of the present invention.

7, polypeptide of the present invention can be used for the prevention or (with) curative vaccine composition, it is characterized in that:

1) group of forming by the polypeptide of describing in sequence in the sequence table 2, sequence 3, the sequence 7 and the polypeptide of deriving thereof.

2) this vaccine is except comprising the group that the polypeptide of describing in sequence 2 in the sequence table, sequence 3, the sequence 7 and the polypeptide of deriving thereof are formed, can also comprise at least one antigen that causes immune response or extra B cell or toxic T lymphocyte epi-position (CTL epi-position), perhaps immunological adjuvant.

8, the invention still further relates to prevention and treatment helicobacter pylori infection polypeptide drugs, have following feature:

1) activeconstituents is the epitope peptide of UreB of the present invention, the group of being made up of the polypeptide of sequence in the sequence table 2, sequence 3, sequence 7;

2) pharmaceutical composition also can contain pharmaceutically acceptable carrier, so-called carrier comprises thinner, vehicle, weighting agent, tackiness agent, wetting agent, disintegrating agent, absorption enhancer, tensio-active agent, absorption carrier of pharmaceutical field routine etc., can also contain immunological adjuvant in the immune composition in addition.。

3) medicine of the present invention can be made various ways such as injection liquid, tablet, pulvis, capsule, oral liquid.

4) medicine of the present invention can be united use with microbiotic etc.

5) in case be made into composition of the present invention, can directly give object with it, wait to prevent or the object for the treatment of can be animal, especially people.

9, treatment or the prophylactic medicament that contains epitope peptide of the present invention of the present invention comprises vaccine, can oral administration, and subcutaneous, modes such as intravenous injection are used, and the therapeutic dose scheme can be single agent scheme or multi-agent scheme.

Two, second aspect of the present invention provides a kind of based on epitope peptide and comprise epiposition vaccine of an extra B cell epitope (SIKEDVQF) and preparation method thereof.

1, vaccine of the present invention is the genetically engineered recombination epitope vaccine, this recombination epitope vaccine albumen has aminoacid sequence 1, aminoacid sequence 2, aminoacid sequence 3, aminoacid sequence 4, wherein aminoacid sequence 1, aminoacid sequence 2, aminoacid sequence 3, be the proteic Th epi-position of UreB of Hp, aminoacid sequence 4 is the proteic B cell epitope of the UreB of Hp.

2, aminoacid sequence or its derived sequence of above-mentioned aminoacid sequence 1 for having sequence 2 in the sequence table, aminoacid sequence or its derived sequence of aminoacid sequence 2 for having sequence 3 in the sequence table, aminoacid sequence or its derived sequence of aminoacid sequence 3 for having sequence 7 in the sequence table, the sequence of aminoacid sequence 4 is SIKEDVQF or its derived sequence.

3, vaccine among the present invention, its feature with aminoacid sequence 1, aminoacid sequence 2, aminoacid sequence 3, connection order between the aminoacid sequence 4 is: aminoacid sequence 1-aminoacid sequence 2-aminoacid sequence 3-aminoacid sequence 4, aminoacid sequence 1-aminoacid sequence 2-aminoacid sequence 4-aminoacid sequence 3, aminoacid sequence 1-aminoacid sequence 3-aminoacid sequence 2-aminoacid sequence 4, aminoacid sequence 1-aminoacid sequence 3-aminoacid sequence 4-aminoacid sequence 2, aminoacid sequence 1-aminoacid sequence 4-aminoacid sequence 2-aminoacid sequence 3, aminoacid sequence 1-aminoacid sequence 4-aminoacid sequence 3-aminoacid sequence 2, aminoacid sequence 2-aminoacid sequence 1-aminoacid sequence 3-aminoacid sequence 4, aminoacid sequence 2-aminoacid sequence 1-aminoacid sequence 4-aminoacid sequence 3, aminoacid sequence 2-aminoacid sequence 3-aminoacid sequence 1-aminoacid sequence 4, aminoacid sequence 2-aminoacid sequence 3-aminoacid sequence 4-aminoacid sequence 1, aminoacid sequence 2-aminoacid sequence 4-aminoacid sequence 1-aminoacid sequence 3, aminoacid sequence 2-aminoacid sequence 4-aminoacid sequence 3-aminoacid sequence 1, aminoacid sequence 3-aminoacid sequence 1-aminoacid sequence 2-aminoacid sequence 4, aminoacid sequence 3-aminoacid sequence 1-aminoacid sequence 4-aminoacid sequence 2, aminoacid sequence 3-aminoacid sequence 2-aminoacid sequence 1-aminoacid sequence 4, aminoacid sequence 3-aminoacid sequence 2-aminoacid sequence 4-aminoacid sequence 1, aminoacid sequence 3-aminoacid sequence 4-aminoacid sequence 1-aminoacid sequence 2, aminoacid sequence 3-aminoacid sequence 4-aminoacid sequence 2-aminoacid sequence 1, aminoacid sequence 4-aminoacid sequence 1-aminoacid sequence 2-aminoacid sequence 3, aminoacid sequence 4-aminoacid sequence 1-aminoacid sequence 3-aminoacid sequence 2, aminoacid sequence 4-aminoacid sequence 2, aminoacid sequence 1-aminoacid sequence 3, aminoacid sequence 4-aminoacid sequence 2-aminoacid sequence 3-aminoacid sequence 1, aminoacid sequence 4-aminoacid sequence 3-aminoacid sequence 1-aminoacid sequence 2, aminoacid sequence 4-aminoacid sequence 3-aminoacid sequence 2-aminoacid sequence 1.

4, epiposition vaccine of the present invention is characterized in that adopting intervening sequence as the connection between the epi-position, helps each epi-position performance alone function separately.Wherein preferred intervening sequence is two Methionins (KK).

5, the interpolation of the increase and decrease of the number of the epi-position that comprises in the epiposition vaccine and extra epi-position etc. all belongs to the scope of this patent protection.

6, the increase of the tandem copy number of each epi-position that comprises in the epiposition vaccine also belongs to the scope of protection of the invention.

7, the invention provides the aminoacid sequence of epiposition vaccine.

8, the invention provides the nucleotide sequence of coding epiposition vaccine.

9, epiposition vaccine of the present invention adopts engineered method to obtain.

1) nucleotide sequence of synthetic coding epiposition vaccine below is represented the nucleotide sequence of this epiposition vaccine with epi;

2) make up pET22b (+)-epi expression vector;

3) expression vector is transformed in BL21 (DE3) engineering bacteria, IPTG abduction delivering recombinant protein, engineering bacteria BL21-pET22b (+)-epi of target protein is expressed in acquisition;

4) recombinant protein of purifying expression obtains purifying antigen;

5) recombinant antigen of this engineering bacteria BL21-pET22b (+)-epi expression is the Hp epiposition vaccine.

10, epitope peptide of the present invention and epiposition vaccine can obtain with the form of synthetic or recombinant expressed polypeptide, also can be naked DNA vaccine, or with epitope peptide and epiposition vaccine thereof by obtaining on other carriers of recombinating, as attenuation salmonella, poxvirus vector, virus-like particle.

11, epiposition vaccine of the present invention has good immunogenicity, can induce generation at the specific Th cell response of Th epitope peptide and at the humoral immunoresponse(HI) of B cell epitope in mouse model, promptly produces the antibody at the B cell epitope.

Major advantage of the present invention is: the method that adds experimental identification with the information biology prediction is quick, accurately, and economy.3 epitope peptides that obtain are the Th epitope peptides in Hp UreB source, can cause the CD4 at Hp safely and effectively ⁺The T lymphocyte immunity is replied.Obtain this Th cell epitope peptide not only to the Hp Study on Pathogenesis, and the development of vaccine and treatment preparation is all had important meaning.Obtain a kind of epiposition vaccine based on 3 epitope peptides in addition, shown good immunogenicity in the experimentation on animals, specificity is good, has a good application prospect.

Description of drawings:

Fig. 1 has shown that 3 epitope peptides can stimulate the CD4 of the mouse of rUreB sensitization ⁺T lymphopoiesis (stimulation index SI＞2).

Fig. 2 shows that epitope peptide stimulates the situation of lymphocytic emiocytosis cytokine.

The splenic lymphocyte of Fig. 3 epitope peptide immunity BALB/c mouse is to the multiplication effect of corresponding immune peptide and rUreB.

The plasmid figure that Fig. 4 epiposition vaccine makes up, the purpose segment of the red part that marks for inserting among the figure.

Fig. 5 pET22b (+)-epi/BL21 screening enzyme is cut qualification result.

Fig. 6 pET22b (+)-epi/BL21 engineering bacterium expression recombinant protein:

Swimming lane 1: albumen Marker;

Swimming lane 2:22b empty plasmid bacterium is induced preceding sample;

Swimming lane 3:22b empty plasmid bacterium is induced back 6h sample;

Swimming lane 4: recombinant protein is induced preceding sample;

Swimming lane 5-9: be respectively recombinant protein and induce back 2h-6h sample (arrow is depicted as recombinant protein).

Fig. 7 Recombinant Protein Expression form is identified:

Swimming lane 1: albumen Marker;

Swimming lane 2,3: substratum supernatant;

Swimming lane 4-6: the ultrasonic supernatant of bacterium behind the abduction delivering;

Swimming lane 7-9: the precipitation after bacterium is ultrasonic.

Fig. 8 recombinant protein purification result:

Swimming lane 1:22b empty plasmid bacterium;

Swimming lane 2: sample before the purifying;

Swimming lane 3-5: be the sample behind the purifying.

Fig. 9 recombination epitope vaccine albumen n end sequencing result.

The cellullar immunologic response of Figure 10 epiposition vaccine immune mouse.

Figure 11 epiposition vaccine immune mouse induces antibody to produce.

Embodiment:

Below in conjunction with specific embodiment; further set forth the present invention; be understood that; these embodiment only are used to illustrate the present invention rather than limitation of the present invention; to preparation method's of the present invention simple modifications, the utilization that reaches epitope peptide of the present invention all belongs to the scope of protection of present invention under design prerequisite of the present invention.

The preparation of material

1, recombinant helicobacterpylori urease B subunit (rUreB) albumen is unit of the present invention recombination to construct.

2, age in laboratory animal: BALB/c mouse: 6-8 week, the SPF level, female, body weight 18-22g is available from Third Military Medical University's Experimental Animal Center.

3, synthetic polypeptide: be dissolved into the concentration of 5mg/ml with methyl-sulphoxide (DMSO) ,-70 ℃ of preservations face the time spent to be diluted to 0.5mg/ml with phosphate buffered saline buffer (PBS).

4, the incomplete substratum of RPMI-1640: RPMI-1640 powder: 10.4g (1 bag), Hepes:2.4g, NaHCO ₃: 2g adds deionized water and stirs evenly filtration sterilization to 1000ml, and packing is frozen

5, the incomplete substratum of RPMI-1640 perfect medium: RPMI-1640: 800ml, calf serum 200ml, penicillin and Streptomycin sulphate are two to be resisted (final concentration 10,000 units/ml): 10ml

6, freund's adjuvant: Freund's complete adjuvant: 1 of paraffin oil (1 part)+lanolin (1 part)+inactivated vaccine, Freund's incomplete adjuvant: paraffin oil (1 part)+lanolin (1 part)

7, LB liquid nutrient medium: Tryptones 10g, yeast extract 5g, NaCl ₂The 10g adding distil water is adjusted pH to 7.4, autoclaving to 1000ml.

8, LB solid medium: the 1.5g agar powder adds in the 100ml LB nutrient solution, (15 pounds of 20min) pour plate behind the autoclaving.

9, the DNA electrophoretic buffer (50 * TAE): Tris 242g, glacial acetic acid 57.1ml, Na ₂EDTA2H ₂O 37.2g adds water to 1000ml and gets final product, and application concentration is 1 * TAE.

10, EB solution: EB stock solution (10mg/ml), 0.2g EB is dissolved in 20ml H ₂Among the O, keep in Dark Place in 4 behind the mixing.

11, EB staining fluid: 10 μ l EB stock solutions, 100ml 1 * TAE damping fluid

12, PBS damping fluid (pH7.2): Na ₂HPO ₄14mmol, NaH ₂PO ₄6mmol, NaCl ₂9g, adding distil water is to 1L

13, NcoI, HindIII DaLian, China Takara company

14, DNA maker China ancient cooking vessel state company

15, plasmid extraction test kit Omega company

16, Coomassie brilliant blue R-250 rapid dyeing system (with reference to " fine works molecular biology experiment guide ").Staining fluid: 0.29g Coomassie brilliant blue R-250 is dissolved in the following destainer of 250ml.Destainer: 250ml 95% ethanol and 80ml glacial acetic acid add distilled water to 1000ml.

17、TE?buffer(pH?8.0)：10mmol/L?Tris，1mmol/L?EDTA

18, pvdf membrane transfering buffering liquid (protein sequencing is used): CAPS:2.21g, DTT:0.5g, methyl alcohol: 150ml adds distilled water to 1000ml, uses the NaOH adjustment to pH10.5.

19, the preparation of ELISA reagent

1) coating buffer: 0.05mmol/L carbonate buffer solution pH9.6:Na ₂CO ₃1.6g, NaHCO ₃2.9g, NaN ₃0.2g adding distil water is to 1000ml

2) antibody diluent: 10mmol/L PBS (pH7.3); 0.05%Tween-20; 0.5%BSA

3) confining liquid: 10mmol/L PBS (pH7.3); 2.0%BSA

4) washings: 10mmol/L PBS (pH7.3); 0.05%Tween-20

5) substrate solution: 0.1mmol/L Na ₂HPO ₄5.12ml; 0.05mmol/L citric acid 4.86ml; OPD 4mg; 30%H ₂O ₂5 μ l; Add water to 100ml.

The Screening and Identification of embodiment 1, Th epi-position:

1.1 the prediction of epitope peptide and synthetic

At first in the UreB sequence of the protein database search Hp of NCBI, UreB is conservative at each bacterial strain, select for use the UreB aminoacid sequence of a strain Helicobacter pylori 26695 wherein (numbering NP 206872) to predict that the UreB complete sequence has 569 amino acid.Adopt the aminoacid sequence of the UreB of online online software RANKPEP software analysis Hp, 7 possible Th epitope peptides have been screened, peptide total man worker synthesis method (assisting to synthesize) with routine by BeiJing ZhongKe Asia Optical, prepared 7 and might induce body to produce the polypeptide that Th replys, purity is all more than 85%.The information of synthetic peptide sees Table 1.

The protein database search network address of NCBI:

http：//www.ncbi.nlm.nih.gov/entrez/querv.fcgi？db＝Protein&itool＝toolbar

The RANKPEP forecasting software can following on the internet network address obtain:

http：//mif.dfci.harvard.edu/Tools/rankpep.html

The essential information of the UreB Th epi-position that table 1 prediction obtains

Sequence number	Numbering	Sequence information	The software scoring	Theoretical molecular	The actual measurement molecular weight	Purity (%)
							P1 P2 P3 P4 P5 P6 P7	U177-192 U546-561 U229-244 U120-135 U140-157 U78-92 U237-251	rnlkwmlraaeeysmn fvdgkevtskpankvs sainhaldvadkydvq alageglivtaggidt ispqqiptafasgvttmi ytgiykadigikdgk vadkydvqvaihtdt	16.15 14.73 14.50 12.20 10.47 21.78 13.60	2012.36 1705.94 1758.92 1457.66 1862.19 1641.90 1674.84	2011.75 1706.00 1758.50 1457.95 1863.00 1642.55 1674.55	91.34 89.78 99.08 86.94 95.60 99.61 85.69

1.2 animal immune:

The female BALB/c mouse of 6-8 week SPF level in age, add the subcutaneous multi-point injection immunity of complete freund adjuvant (CFA) with recombinant urease B subunit (rUreB), every mouse 100 μ g/0.5ml, the rUreB with same dosage after three weeks adds incomplete Freund's adjuvant (IFA) booster immunization once.Control group mice substitutes rUreB with PBS and carries out immunity, and immunization method and program are identical.

1.3CD4 ⁺The T lymphocyte proliferation assay is identified epitope peptide

Dislocation in 10-15 days is put to death after the immunity of mouse last, aseptic taking-up mouse spleen, mill on the steel mesh and prepare the spleen single cell suspension, separate the mononuclearcell of mouse with mouse lymphocyte parting liquid (Tianjin TBD company), and then with CD4 in negative method (test kit of Dynal company) the separation mouse boosting cell of selecting of immunomagnetic beads ⁺The T lymphocyte, operation is carried out according to the test kit specification sheets.CD4 after the separation ⁺The T lymphocyte dyes with the anti-mouse CD4 monoclonal antibody of PE mark, the anti-mouse CD3 monoclonal antibody of FITC mark, and flow cytometry identifies that purity is greater than 95%.With RPMI-1640 perfect medium suspension cell, in the flat culture plate in 96 holes, every hole adds CD4 ⁺T lymphocyte 2 * 10 ⁵, Co ⁶⁰Irradiation (roentgen dose X: spleen mononuclearcell (as antigen presenting cell) 4 * 10 20Gy) ⁵, (final concentration is: 1.25 μ g/ml), negative control hole does not add synthetic polypeptide, and the positive control hole adds rUreB, and (final concentration is: 15 μ g/ml), set up CD4 simultaneously to add the good synthetic polypeptide of dilution simultaneously ⁺The T lymphocyte adds the control wells that synthetic polypeptide and APC add ConA, and final volume is 200 μ l/ holes, does 3 parallel holes for every group.37,5%CO ₂Incubator was cultivated 5 days, 12-16 hour adding tritiated deoxidation pyrimidine nucleotide before finishing to cultivate ( ³H-TdR), 1 μ Ci/ hole, continue to cultivate after 12-16 hour with the bull cell harvestor with cell harvesting on glass fiber filter paper, per minute umber of pulse (cpm) is measured with the Beckman liquid scintillation counter in the oven dry back, calculate the average (x ± s) in 3 multiple holes, the result is with stimulation index (SI) expression (SI=experimental group cpm average/negative control group cpm average, negative control refer to not add the hole that antigen peptide stimulates), and SI 〉=2 are positive.

Result: adopt the negative sorting test kit of immunomagnetic beads to carry out CD4 ⁺The lymphocytic separation of T, the CD4 after the separation ⁺The T lymphocyte identifies that through streaming purity reaches more than 95%.Isolating CD4 ⁺T lymphocyte and Co ⁶⁰Irradiation spleen mononuclearcell and synthetic polypeptide co-cultivation are found P2 (U _546-561), P3 (U _229-244), P7 (U _237-251) can stimulate the CD4 of the BALB/c mouse spleen of rUreB sensitization ⁺T lymphopoiesis (SI＞2).CD4 ⁺Other is the MHC II on antigen presenting cell surface and the mixture of epitope peptide to T lymphocyte activation propagation when needing, and the spleen mononuclearcell stimulates CD4 at this as the auxiliary polypeptide of antigen presenting cell (APC) ⁺The T lymphopoiesis, Co ⁶⁰Irradiation can suppress the propagation of cell, stimulates Co with ConA ⁶⁰The APC of irradiation can not make its propagation, and the CD4 that is that breeds in the culture system is described ⁺The T lymphocyte.At CD4 ⁺Also set up CD4 during the T lymphocyte proliferation assay simultaneously ⁺The T lymphocyte adds antigenic contrast, CD4 under the situation of discovery shortage APC ⁺The T lymphocyte can not be bred.Illustrate that it is not nonspecific reaction that these 3 polypeptide stimulate lymphopoiesis, but the UreB antigen-specific.When immune mouse, set up the control group of adjuvant immunity, carried out CD4 simultaneously ⁺The T lymphocyte proliferation assay is found P2 (U _546-561), P3 (U _229-244), P7 (U _237-251) can stimulate rUreB mice immunized lymphopoiesis, and the lymphopoiesis (SI＜2) that can not stimulate the adjuvant immunity mouse is seen Fig. 1.These three polypeptide of this presentation of results can stimulate CD4 ⁺The T lymphopoiesis, and be that UreB is specific.

Embodiment 2:ELISA method detects epitope peptide and induces Th cell direction of polarization:

Get the splenocyte of rUreB immune mouse, separate spleen CD4 ⁺The T lymphocyte, with RPMI-1640 perfect medium re-suspended cell, in the flat culture plate in 24 holes, every hole adds CD4 ⁺T lymphocyte 5 * 10 ⁵, Co ⁶⁰The spleen mononuclearcell (as antigen presenting cell) 5 * 10 of irradiation (20Gy) ⁵, adding the good synthetic polypeptide (final concentration 1.25 μ g/ml) of dilution simultaneously, negative control hole does not add synthetic polypeptide, and final volume is the 0.5ml/ hole, does 3 parallel holes for every group.Behind the mouse spleen lymphocyte that synthetic epitope peptide stimulates, collected culture supernatant 400ul in 72 hours, place-70 ℃ standby.Adopt the Th1/Th2 parting kit of eBIOSCIENCE company to detect cytokine.Concrete steps are as follows: catch the monoclonal antibody coated elisa plate with gamma interferon (IFN-γ), interleukin 4 (IL-4), interleukin-22 (IL-2), interleukin-11 0 (IL-10), 4 ℃ are spent the night, washings washing 3 times, seal with confining liquid, room temperature 1h washs 3 times, and is standby.During detection, every hole adds the standard substance of 100 μ l culture supernatant to be measured and doubling dilution, hatches 2h in 37 ℃, wash plate 5 times, add the biotin labeled detection antibody of 100 μ l, hatch 1h for 37 ℃, wash plate 5 times, the avidin that adds 100 μ l HRP marks is again hatched 30min for 37 ℃ and is washed plate 7 times, adds 100 μ l tmb substrates, room temperature is placed 15min, add 50 μ l stop buffers at last, survey absorbance (A), result A respectively at wavelength 450nm and 570nm place ₄₅₀-A ₅₇₀Expression.

Result: P2 (U _546-561), P3 (U _229-244) excretory IL-4 and IL-10 all be significantly higher than negative control group (P＜0.05), is Th2 type epi-position, P7 (U _237-251) secretion of gamma-IFN is significantly higher than negative control group, (P＜0.05) is Th1 type epi-position.(see figure 2).Pathogenesis about Hp is recognized that the Th1 cell plays a major role in pathogenic course at present; not clear at present for immunoprotection mechanism; the Th1 type immunne response of thinking that has plays a major role; Th2 replys plays a major role for thinking of having; but tend to both synergies more at present, cause Th1/Th2 equilibrated immunne response and help the immunoprotection that Hp infects.Therefore identify the Th1/Th2 epi-position for research pathogenesis and immunoprotection mechanism, and the design of vaccine there is important directive function.

Embodiment 3: epitope peptide is worked in coordination with stimulatory effect

Concrete operations are with embodiment 1, difference is except that adopting independent synthetic epitope peptide to stimulate the lymphocyte, also on average mix in twos and all mix as stimulating the primary stimuli lymphopoiesis with 3 epitope peptides that filter out, the final total concn of epitope peptide is 1.25 μ g/ml, all the other steps are identical, and whether the stimulatory effect of stimulatory effect after relatively epitope peptide makes up and independent epitope peptide has difference.

The result: three epitope peptides make up in twos and three blended effect of stimulation all are higher than independent epitope peptide and stimulate (seeing Table 2), and prompting can be made up these three epi-positions in follow-up vaccine design.

The collaborative stimulatory effect of table 2. epitope peptide

Epitope peptide	The cpm value
		P2 P3 P7 P2+P3 P2+P7 P3+P7 P1+P2+P3 contrast	1723±128 1836±202 2103±264 4065±463 3861±253 3623±321 3860±167 824±124

Embodiment 4: the immunological effect of epitope peptide immunity BALB/c mouse

Whether the immunne response that main observation body produces at epitope peptide can discern the UreB of Hp, and whether further prove conclusively these three peptides is the epitope peptide of UreB.

4.1 epitope peptide immunity:

Add incomplete Freund's adjuvant (IFA) root of the tail portion and the subcutaneous immune BALB/c mouse of vola multiple spot with the synthetic epitope peptide, 14 days booster immunizations once are total to immunity three times at interval.Set up PBS contrast immune group simultaneously, every group of 10 mouse.

4.2, immunological effect detects:

Mouse spleen was got in the immunity of epitope peptide last in back 10 days, and with the lymphocyte of mouse lymphocyte parting liquid separation mouse, adjusting cell concn with the RPMI-1640 perfect medium is 4 * 10 ⁶/ ml adds 100 μ l in the every hole of 96 orifice plates, adds 100 μ l again and dilutes good polypeptide (final concentration is 1.25 μ g/ml) and rUreB (final concentration is 15 μ g/ml), and negative control hole does not add synthetic polypeptide, and final volume is 200 μ l/ holes, does 3 parallel holes for every group.37,5%CO2 incubator were cultivated 5 days, added in 12-16 hour before finishing cultivation ³H-TdR, 1 μ Ci/ hole, continue to cultivate after 12-16 hour with the bull cell harvestor with cell harvesting on glass fiber filter paper, per minute umber of pulse (cpm) is measured with the Beckman liquid scintillation counter in the oven dry back, calculate the average (x ± s) in 3 multiple holes, the result is with stimulation index (SI) expression (SI=experimental group cpm average/negative control group cpm average, negative control refer to not add the hole that antigen peptide stimulates), and SI 〉=2 are positive.

The result: 3 epitope peptides all can stimulate mouse to produce at the cellullar immunologic response of immune peptide and rUreB (SI＞2) separately, see Fig. 3.

Embodiment 5: the type of cellullar immunologic response behind the epitope peptide immune mouse

Behind the conventional aseptic extracting spleen cell, 2000 leave the heart, abandon supernatant, in cell precipitation, add 5ml erythrocyte cracked liquid (0.83% ammonium chloride), room temperature is placed and was removed red corpuscle in 2 minutes behind the piping and druming mixing, and with the PBS washing that contains 2% bovine serum albumin (BSA) 2 times, adjusting cell concn is 10 ⁷/ ml, get 100 μ l cell suspensions respectively and place two EP pipes, developmental tube adds the anti-mouse CD4 antibody of PE mark, the anti-mouse CD3 antibody of FITC mark, control tube adds the homotype antibody of PE and FITC mark, lucifuge is hatched 30min dyeing on ice, wash 2 times, it is resuspended to contain the PBS of 2%BSA with 500 μ l at last, and flow cytometer detects.

Result: epitope peptide immune group mouse, its CD4 ⁺The lymphocytic ratio of T all is significantly higher than the CD4 of PBS control group ⁺The T percentage of lymphocyte can promote CD4 after the immunity of prompting epitope peptide ⁺The T lymphopoiesis.The results are shown in Table 3.

The type of cellullar immunologic response behind the table 3 epitope peptide immune mouse

	CD4 +T cell (%)
		Contrast P1 P2 P3 P1+P2+P3	21.03±2.12 30.45±3.24 * 29.87±2.69 * 38.94±1.25 * 32.25±3.24 *

^*Expression is compared with control group, significant difference, P＜0.05

Embodiment 6: epitope peptide oral immunity BALB/c mouse immune protection effectiveness

6.1 epitope peptide oral immunity

The female BALB/c mouse of SPF level in age in 6-8 week is divided into two groups at random, 30 every group, immune group with 3 epitope peptide balanced mix after, add choleratoxin B subunit (CT-B) adjuvant immunity, control group PBS immunity, dosage is 150 μ g//times.

6.2 immune programme for children: fasting before the mouse immune, water 24 hours, the pin of feeding are irritated and are fed hydrochloric acid in gastric juice neutralizer 0.3ml, after 20 minutes, feed cumulative volume 0.3ml, PBS dissolved antigen and adjuvant by each group requirement filling, and the immunity time was 0,1,2,4 weeks.

6.3Hp liquid culture: the SS1 inoculation that is mixed is to brain heart infusion blood agar plate, little aerobic environment (10%CO2 is set up in ventilation by bleeding, 5%O2,85%N2) cultivated 2 days for 37 ℃, scrape from flat board and to get lawn, being suspended in stroke-physiological saline solution, is that to be made into concentration be 3 * 10 to standard with Maxwell standard opacity tube first pipe ⁸The bacteria suspension of individual/ml, get 2ml rapidly and be inoculated in the aseptic Hp culture broth of 200ml, little aerobic environment and 37 ℃ of vibrations (120 rev/mins) are cultivated, after cultivating 24h, take out nutrient solution, centrifugal 5 minutes of the speed that per minute 3000 changes keeps supernatant 20ml, abundant suspendible bacterium, the pin of feeding are immediately irritated and feed mouse.

6.4Hp attack poison: in 2 weeks after the last immunity, immune group and control group are all irritated with Hp SS1 strain bacterium liquid and are fed, all mouse shift to an earlier date 24h jejunitas, cut off the water supply, irritate stomach 0.3ml, about 10 for every ⁸CFU bacterium liquid, morning and afternoon each once, 6 hours at interval, last was irritated 2 hours feed water behind the stomach.

6.5 sampling: the 4th week after last is attacked poison, slaughter each 15 of immunity and control mice, put to death preceding 24 hours jejunitas water, eyeball bloodletting, separation of serum; Take out the mouse stomach, cut open along greater gastric curvature, wash out residue in the stomach gently with physiological saline, with half mucosa tissue coating Hp substratum, trilinear method streak inoculation, little aerobic cultivation 3-7 days, open a jar inspection every day,, carry out Hp by bacterium colony characteristics, ne ar and dyeability, quick urease test and identify if any suspicious colony growth, second half stomach mucous membrane is carried out urease test and direct smear respectively, remove from office blue formula dyeing microscopic examination.

6.6 the result judges and the calculating of immune protective rate:

If occur circular, translucent, moistening suspicious bacterium colony on the flat board of cultivating, through smear, gram stain microscopy, see Gram-negative screw shaped bacterium, and the urease test positive, judge that this mouse has Hp to infect field planting; If stomach mucous membrane direct smear dyeing microscopic examination is seen Gram-negative screw shaped bacterium, and the urease test positive, also judge that this mouse has Hp to infect field planting.Judge that the effective precondition of this experimental result is: immunization control group infection rate does not reach more than 80%, and the survival number of every group of mouse is more than 12.

Infection rate (%)=(every group of infecting mouse number/every group of survival mice number) * 100%

Protection ratio (%)=(every group not infecting mouse number/every group of survival mice number) * 100%

The result: PBS control group, infection rate reach more than 90%, epitope peptide oral immunity group; after Hp SS1 reference culture was attacked poison, 4 all immune protective rate bacterium were 70%, and immune group is compared significant difference with control group; results suggest, epitope peptide oral immunity mouse infect Hp the certain protection effect.But because the independent molecular weight of polypeptide is little; easily degraded in vivo; and it is poor to cause immunogenicity; causing in this experiment, protection ratio only is 70%; but can illustrate that still epitope peptide of the present invention has provide protection for anti-Hp infection, can make it recover the macromole characteristic by follow-up vaccine design; increase methods such as immunogenicity, can reach the better protection effect.

Table 4: the protection effect of epitope peptide immunity

Group	Laboratory animal quantity	Infect quantity	Do not infect quantity	Infection rate	Protection ratio
						Epitope peptide immune group PBS group	30 30	9 28	21 2	-- 93.3％	70％ --

Embodiment 7: epitope peptide is induced Hp infected patient peripheral blood lymphocyte propagation

5 routine Hp infected patient peripheral bloods are collected from Xinan Hospital, Chongqing, and all inspection is diagnosed as the Hp infection through gastroscope.5 routine healthy blood donors' peripheral blood is aseptic collection in contrast, and the personnel selection lymphocyte separation medium separates peripheral blood mononuclear cell (PBMC) and preserves standby in liquid nitrogen.

Lymphocyte proliferation assay:

It is 4 * 10 that 5 routine Hp the infecteds and 5 routine healthy person PBMC adjust cell concn with RPMI-1640 perfect medium (it is two anti-to contain 10% calf serum, 2mML-glutamine, 50 μ M 3-mercaptoethanols and Streptomycin sulphate, penicillin) ⁶/ ml adds 100 μ l in the every hole of 96 orifice plates, adds 100 μ l again and dilutes good polypeptide (final concentration is 1.25 μ g/ml) and rUreB (final concentration is 15 μ g/ml), and negative control hole does not add synthetic polypeptide, and final volume is 200 μ l/ holes, does 3 parallel holes for every group.37,5%CO2 incubator were cultivated 5 days, added in 12-16 hour before finishing cultivation ³H-TdR, 1 μ Ci/ hole, continue to cultivate after 12-16 hour and organoid is collected on the glass fiber filter paper with the bull cell harvesting, per minute umber of pulse (cpm) is measured with the Beckman liquid scintillation counter in the oven dry back, calculate the average (x ± s) in 3 multiple holes, the result is with stimulation index (SI) expression (SI=experimental group cpm average/negative control group cpm average, negative control refer to not add the hole that antigen peptide stimulates), and SI 〉=2 are positive.

Result: in the lymphocyte proliferation assay of the PBMC of the 5 routine Hp infected patients of collecting, P2, P7 can stimulate 3 routine patients' PBMC that proliferative response takes place, P3 can stimulate 2 routine patients' PBMC that proliferative response takes place, and P2, P3, P7 all can not stimulate the PBMC of healthy person to breed (SI＜2), see Table 5.Point out our epitope peptide to have the potential of developing vaccine for man.

It is restricted that the epi-position function will be subjected to MHC; people's MHC molecule is called HLA again; have a lot of types; our epitope polypeptide can not stimulate the lymphocyte proliferation assay of 5 routine patients' PBMC fully, may be because the HLA type does not match, and further studies 5 routine patients' HLA type; can understand the restricted feature of HLA of 3 epitope peptides; can be in the triturating of vaccine for man with its reasonable combination, make vaccine have that HLA is restricted widely, can in most crowds, play a protective role.

Table 5 epitope peptide stimulation human peripheral blood lymphopoiesis

Patient	Stimulation index (SI)
				P2	P3	P7
	12345 contrasts, 1 contrast, 2 contrasts, 3 contrasts, 4 contrasts 5	3.14 2.39 1.56 4.51 0.81 0.65 0.98 1.36 0.85 1.49	0.76 4.21 2.96 1.56 0.69 1.65 0.67 1.34 0.97 1.26				3.75 1.69 1.48 3.32 3.58 0.69 1.57 1.68 0.95 1.02

Embodiment 8: the design of epiposition vaccine, structure, expression

1, the design of epiposition vaccine

With a B cell epitope SIKEDVQF of 3 preferred Th cell epitope peptides and bibliographical information from UreB (referring to document: Hirota K.; Nagata K.; Norose Y.; Futagami S.; Nakagawa Y.; Senpuku H.; Kobayashi M.; Takahashi H. (2001). identify the epitope infection and immunity 69 that can induce the generation neutralizing antibody of the urease of helicobacter pylori, 6597-6603.) be connected in series, between the epi-position with two Methionins (KK) at interval, KK is the cleavage site of cathepsin B, adding the KK intervening sequence between each epi-position helps cutting in the body of Th epitope peptide, so that each epi-position is brought into play effect separately, and avoid producing new in conjunction with epi-position in the junction of epi-position.(referring to document: Yano A.; Onozuka A.; Asahi-Ozaki Y.; Imai S.; Hanada N.; Miwa Y.; The vaccinology of method of design cleverly 23 (2005) 2322-2326 of a Nisizawa T. peptide vaccine)

The vaccine form that makes up is as follows:

Th cell epitope (P7-P3-P2)-B cell epitope (SIKEDVQF)

Aminoacid sequence is as follows:

VADKYDVQVAIHTDT KKSAINHALDVADKYDVQ KKFVDGKEVTSKPANKVS KKSI

KEDVQF

2, epiposition vaccine gene (epigen is called for short epi) is synthetic:

Adopt colibacillary optimal codon, the aminoacid sequence of the vaccine of above-mentioned structure is converted into nucleotide sequence, two ends add restriction enzyme site NcoI and Hind respectively, and nucleotide sequence carried out the restriction enzyme site analysis, nucleotide sequence self there is no NcoI and Hind restriction enzyme site, 186 bp of totally 195 bp expressing protein parts, sequence following (wherein line part is a restriction enzyme site):

NcoI CCATGGTGGCGGATAAATATGATGTGCAGGTGGCGATCCACACCGATACCAAAAAAAGC GCGATTAACCACGCGCTGGATGTGGCGGATAAATATGATGTGCAGAAAAAATTTGTGGAT GGCAAAGAAGTGACCAGCAAACCGGCGAACAAAGTGAGCAAAAAGAGCATTAAAGAA GATGTGCAGTTT?T AAGCTT

Hind□

Adopt NcoI and two restriction enzyme sites of Hind that full gene is connected on pET22b (+) carrier, can utilize the signal peptide on this carrier, express with soluble form, help keeping proteic activity and antigenicity with the expectation target protein.The dna fragmentation that inserts has can remove the His label before terminator codon (TAA) is inserted in carrier His label.Complete genome sequence is synthetic entrusts (Genray) company to finish.Design of graphics is seen Fig. 4, and synthetic full gene provides with the plasmid form, and the plasmid name nominating is: pET22b (+)-epi.

3. preparation (the CaCl of competence bacteria ₂Method):

[1] the aseptic inoculation ring dips in and gets-70 ℃ of frozen bacteriums guarantor kind of liquid, and the trilinear method streak inoculation was cultivated 12～16 hours for 37 ℃ in the LB flat board.

[2] the single colony inoculation of picking is in 5ml LB nutrient solution, 37 ℃ of shaking table incubated overnight.

[3] with the BL21 of incubated overnight in 1% ratio transferred species to 10ml LB substratum, 37 ℃ of shaking tables are cultured to OD ₆₀₀Be 0.2～0.4 o'clock, get 4ml bacterium liquid and transfer in the 5ml centrifuge tube, ice bath 10min,

[4] 5000 leave heart 10min, abandon supernatant.

[5] add the 0.1M C that 1mL ices precooling _aCl ₂Resuspended precipitation, ice-water bath 1h.5000 leave heart 10min, abandon supernatant.The 0.1M CaCl that adds the precooling of 100 μ l ice ₂Suspend and precipitate, ice-water bath 1h, standby.

4. the conversion of plasmid pET22b (+)-epi (heat-shocked method)

[1] get competence bacteria liquid 100 μ l, conversion tube adds plasmid pET22b (+)-epi 10 μ l; Control tube does not add plasmid.Ice-water bath 45min, 42 ℃ of water-bath heat-shocked 90s place ice-water bath 2min rapidly.

[2] add 100 μ l LB nutrient solutions, 37 ℃ of shaking tables are cultivated recovery 1h.

[3] respectively get 50 μ l coating Amp ⁺-LB flat board, 37 ℃ of incubator overnight incubation.

5 Amp ⁺-LB plate screening transforms successful bacterium

BL21 is covered with bacterium on the LB flat board, Amp ⁺The aseptic length of being born of the dull and stereotyped BL21 negative control of-LB; Picking transforms dull and stereotyped going up and separates good single colony inoculation in 7mlAmp ⁺In-LB the nutrient solution, 37 ℃ of shaking table overnight incubation.Get 4ml extracting plasmid.

6, plasmid DNA extracting (using U.S. Omega company plasmid extraction test kit)

[1] get 4ml bacterium liquid in the 5mL centrifuge tube, the centrifugal 2min of 12000g leaves and takes precipitation.

[2] every pipe adds 250 μ l Solution I suspension, fully mixing.

[3] add 250 μ l Solution II, softly put upside down mixing 4-6 time.

[4] add 350 μ lSolutionIII, softly put upside down mixing 4-6 time.

[5] 4 ℃, the centrifugal 10min of 12000g move to supernatant in the separator column.

[6] the centrifugal 1min of 12000g topples over the waste liquid in the collection tube.

[7] add 500 μ l Hb buffer in separator column, the centrifugal 1min of 12000g topples over the waste liquid in the collection tube.

[8] add 750 μ lDNA wash buffer (adding dehydrated alcohol), the centrifugal 1min of 12000g repeats once.The centrifugal 12000g of void column, 2min.

[9] room temperature is placed 5-10min, and ethanol is volatilized fully.

[10] separator column is placed the Ep pipe of another clean 1.5ml and add the ddH of 50 μ l ₂O (55 ℃ of pre-temperature), the centrifugal 1min of 12000g.Collect elutriant and be extractive plasmid, place-20 ℃ of preservations standby.

7, the plasmid double digestion is identified:

Identify that with NcoI and Hind double digestion it is as follows that enzyme is cut system:

Plasmid 7 μ l,

NcoI 0.5μl，

Hind□ 0.5μl，

10×buffer(K) 1μl，

1％BSA 1μl，

Mixing, 37 ℃ of water-bath 2h, 2% agarose gel electrophoresis is observed enzyme and is cut the result.

The fragment of plasmid size and cutting-out is at about 200bp place, and size conforms to desired value (195bp), sees Fig. 5.

8, IPTG induces recombinant bacterial strain BL21 (DE3) to express:

Get and identify that errorless reorganization bacterium is inoculated in 3mL and contains in the LB nutrient solution of Amp 37 shaking table overnight incubation.Contain the recombinant bacterial strain of incubated overnight in the LB nutrient solution of Amp in 10mL in 1% ratio transferred species next day, and 37 shaking tables are cultivated, and treat OD ₆₀₀During about 0.6-1.0, add IPTG and induce, final concentration is 0.5mM, leaves and takes before inducing respectively and the bacterium liquid sample of inducing back 2,3,4,5,6h, and measures OD ₆₀₀Value; Induce empty carrier pET22b/BL21 (DE3) simultaneously, and leave and take and induce the front and back sample in contrast.

10, polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) detects Recombinant Protein Expression

Sample process: by formula: bacterium liquid measure (ml)=1/OD ₆₀₀It is centrifugal to take a sample, and abandons supernatant, collects bacterial precipitation and adds 100 μ l ddH ₂O and 100 μ l 2 * go up sample buffer, resuspended mixing boils 10min, and it is standby to get supernatant behind the centrifugal 3min of 1000g.

Configuration 16%Tricine-SDS-PAGE polyacrylamide gel, prescription is as table 6.After treating the complete polymerization of gel, extract the sample comb, blot liquid in the hole with sample hole on the ability cathode electrophoresis buffer solution for cleaning and with filter paper.Sample to be tested and albumen Marker are gone up sample, 60V electrophoresis 1h, 100V 3h, the gel 1h that in the coomassie brilliant blue R250 staining fluid, dyes, destainer decolours colourless to background.

Table 6,16%Tricine-SDS-PAGE glue prescription

	Separation gel (ml)	Concentrate glue (ml)
			45% acrylamide Tris cl (pH:8.45), 30% glycerine, 10% ammonium persulphate TEMED H 2O	3.56 3.2 1.06 0.1 0.004 2.08	0.24 0.744 -- 0.02 0.002 0.992

Recombinant bacterial strain BL21-pET22b (+)-epi carries out electrophoresis observation protein expression situation after IPTG induces, target protein has expression compared with the control, sees Fig. 6.

11, the expression of recombinant proteins form is identified:

Carrying out ultrasonic bacteria breaking: the ultrasonic treatment thalline, power 300W, ultrasonic 10s, intermittently 10s works 90 times.Broken bacterium effect is observed in microscopically in sampling dyeing back, and not broken bacterium＜the 2/oily mirror visual field is complete for splitting bacterium.750g * 30min is centrifugal to remove broken bacterium, and supernatant is through 12000g * 30min high speed centrifugation, cleer and peaceful precipitation in the separation.Get precipitation and supernatant respectively and do the Tricine-SDS-PAGE electrophoresis.If electrophoresis result shows recombinant protein and expresses with soluble form in ultrasonic supernatant.See Fig. 7.

12, the purifying of recombinant protein:

Analyze through the DNASIS software prediction, the recombinant protein iso-electric point is 9.53, adopts anion chromatography and cationic layer phase separation bonded method purifying

[1] anion column purifying: select anion column HiTrap Q to carry out purifying, A liquid uses 10mmol/L NaHCO ₃, PH10B liquid adopts 10mmol/L NaHCO ₃+ 1M NaCl.

[2] ion column purifying: adopt Sepharose SP cation seperation column, A liquid uses 10mmol/L PB, and pH6.0, B liquid adopt 10mmol/L PB+1M NaCl.

[3] purified target protein is carried out SDS-PAGE, examines and determine its purity

The result; The purity of protein of purifying is seen accompanying drawing 8 more than 95%.

13, the N of target protein end order-checking

1) target protein of 16% Tricine-SDS-PAGE separation and purification.

2) take out pvdf membrane, soak the several seconds, put into CAPS electrotransfer damping fluid then with methyl alcohol.

3) take out running gel, in the CAPS damping fluid, soaked 5-10 minute.

4) will be used for the filter paper of electrotransfer and sponge and put into the CAPS damping fluid and soak, the order by sponge, filter paper, pvdf membrane, gel, filter paper, sponge installs the transfer printing interlayer then.

5) the transfer printing interlayer is inserted transfer device, pvdf membrane is near anode.Be full of transfer groove with the CAPS transfering buffering liquid, electrotransfer 3h under the 50V constant voltage.

6) carefully take off pvdf membrane, after rinsed with deionized water, soak the several seconds with methyl alcohol, then with the 50% methyl alcohol dyeing 1min that contains 0.1% Xylene Brilliant Cyanine G R-250, with 50% methyl alcohol that contains 10% acetate decolour to background clear till, with the abundant rinsing of deionized water.

6. with blade the target protein band is downcut, send the order-checking N of centralab of Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences 5 amino acid of end.

The result: sequencer address is seen Fig. 9, and each circulation all has two amino acid to react simultaneously as shown in the figure, has the peptide chain of two kinds of different N ends in the prompting sample.Analysis revealed, these two kinds of peptide chains are a kind of protein, wherein first residue of Yi Bufen N-terminal M disappears, and does not observe the existence of other protein peptide chains.Conclusion: 6 amino acid of sequencing result N end are MVADKY, and are in full accord with the proteic N terminal sequence of recombination epitope vaccine.

Embodiment 9: the immunological effect of epiposition vaccine is observed

1, forint (folin)-phenol reagent process (also claiming the Lowry method) is measured purifying protein concentration:

1) Lowry protein concentration detection reagent (biochemical teaching and research room provides by this school),

2) sample is prepared: at first with 2 times, 5 times, 10 times dilutions of protein sample of purifying, every pipe adds 500 μ l in test tube; Standard pipe adds standard substance, and (bovine serum albumin: 500 μ l 250 μ g/ml), blank pipe add distilled water 500 μ l; All do multiple pipe;

3) add the every pipe 2.5ml of first reagent (having first reagent A and 50: 1 mixed of first reagent B to form), the mixing room temperature is placed 10min;

4) add second reagent, every pipe 250 μ l, room temperature is placed 30min;

5) absorbancy at UV spectrophotometer measuring wavelength 650nm place returns to zero with the blank pipe.

6) drawing standard curve as a result obtains the regression equation of typical curve, sample value is treated into the formula calculation sample average of getting multiple pipe is a final concn.

Result: typical curve equation: Y=0.0021X+0.0056

Purifying protein concentration is 1.45mg/ml.

2, animal immune

2.1 grouping: be divided into three groups, specifically see Table 7.

The grouping of table 7 animal

Group	Quantity	Antigen	Dosage
				PBS control group empty carrier contrast epi-position vaccine immunity group	30 30 30	PBS empty carrier reorganization bacterium whole bacterial protein recombination epitope vaccine albumen	100 μ g/0.5ml/ only

2.2 immune programme for children

Adopt antigen to add complete freund adjuvant immunity first, 2 weeks adopted same antigen to add incomplete freund adjuvant booster immunization at interval, cutd open 15 mouse extremely in back ten days in immunity for the second time, detected cellullar immunologic response.The blood supernatant of getting remaining mouse after immune four times on the 7th day detects antibody horizontal.

3, cellullar immunologic response detects: concrete operations adopt P2, P3, P7 and epiposition vaccine albumen and reorganization UreB albumen former as stimulating with among the embodiment 4.2 in the present embodiment, observe proliferation of lymphocytes.

Result: P2, P3, P7, epiposition vaccine recombinant protein and reorganization UreB albumen all can stimulate the lymphopoiesis (SI＞2) of epiposition vaccine mice immunized, see Figure 10.The epiposition vaccine recombinant protein immune mouse that shows construction expression of the present invention can cause the cellullar immunologic response at P2, P3, three Th epitope peptides of P7, shows that the method for the epiposition vaccine that the present invention makes up can make the epi-position that comprises bring into play effect separately.And epiposition vaccine of the present invention can be discerned UreB albumen.

4, enzyme linked immunosorbent assay (ELISA) method detects production of antibodies:

Antibody in the serum of the elisa plate detection epiposition vaccine immunity of employing rUreB, Hp whole bacterial protein, recombination epitope vaccine albumen bag quilt.Step is as follows:

1) pre-treatment of enzyme plate: will newly purchase enzyme plate distilled water soaked overnight, standby after drying.

2) be that suitable concentration: rUreB is 2 μ g/ml with coating buffer with antigen diluent, Hp whole bacterial protein and recombination epitope vaccine albumen are 5 μ g/ml,

3) bag quilt: enzyme plate adds the above-mentioned antigen liquid in 100 μ l/ holes, and 4 ℃ are spent the night, washings washing 5 times, empty doing.

4) sealing: add confining liquid 300 μ l/ holes, 4 ℃ are spent the night, and wash 5 times, empty doing, and it is standby to seal 4 ℃ of preservations.

5) blood sampling and dilution: mouse orbit is got blood, 1: the 1000 times of dilution of antibody dilution of centrifuging and taking supernatant.

6) get bag by good enzyme plate, add dilute serum 100 μ l/ holes successively, 37 ℃ of water-bath 30min wash 4 times, empty doing.

7) add goat anti-mouse igg antibody working fluid (1: 20000 dilution) the 100 μ l/ holes of horseradish peroxidase-labeled, 37 ℃ of water-bath 30min washs 4 times, and are empty dried.

8) add substrate colour developing liquid 100 μ l/ holes, room temperature lucifuge reaction 5～10min.

9) add stop buffer 50 μ l/ holes, on microplate reader, measure the OD value immediately with the 492nm wavelength

10) result judges: OD value is considered as antibody positive during more than or equal to 2.1 times of negative control (preceding 1: the 10 times of dilution of serum of mouse immune).

The result: as Figure 11, the serum of epiposition vaccine immune group can with epi-position recombinant protein and the reaction of reorganization UreB albumen and Hp whole bacterial protein, and empty carrier immunity control group and PBS control group can not with above-mentioned antigen-reactive.Illustrate antibody that epiposition vaccine inducing mouse that the present invention makes up produces can specific identification epi-position recombinant protein, reorganization UreB albumen and Hp whole bacterial protein.

Provable according to above experiment, the Th epitope polypeptide among the present invention has the ability of the peripheral blood lymphocyte propagation of inducing BALB/c mouse splenic lymphocyte and people, and can the infection of Hp be played a protective role.Epiposition vaccine of the present invention has utilized the B cell epitope peptide of a Th epitope polypeptide of the present invention and an extra UreB, experimental verification has good immunogenicity, can induce the cell and the humoral immunoresponse(HI) of body, the construction strategy that shows epiposition vaccine of the present invention is successful.

Epiposition vaccine of the present invention is the implementation example of a kind of application of polypeptide of the present invention in vaccine development, rather than the polypeptide of the present invention restriction of using in the vaccine development field, other has utilized the vaccine of amino acid sequence of polypeptide of the present invention or dna sequence dna also to belong to protection scope of the present invention; Polypeptide of the present invention has the effect that anti-Hp infects, and is used for developing preventative or therapeutical peptide medicine or immunological reagent.

In addition, here the embodiment that provides should be regarded as and illustrates and nonrestrictive, after having read foregoing of the present invention, those skilled in the art are not violating under the essence of fully setting forth the front of the present invention or range of condition, can make various changes or modification to embodiment of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

Sequence 1:

＜110〉Military Medical Univ No.3, P.L.A

＜120〉the Th epitope peptide of helicobacter Pylori urease B subunit, its coding DNA, vaccine and application thereof

<130>

<160>12

<210>1

<211>16

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the polypeptide of helicobacter Pylori urease B subunit

<400>1

Arg?Asn?Leu?Lys?Trp?Met?Leu?Arg?Ala?Ala?Glu?Glu?Tyr?Ser?Met?Asn

1 5 10 15

Sequence 2:

<210>2

<211>16

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the Th epitope peptide of helicobacter Pylori urease B subunit

<400>2

Phe?Val?Asp?Gly?Lys?Glu?Val?Thr?Ser?Lys?Pro?Ala?Asn?Lys?Val?Ser

1 5 10 15

Sequence 3:

<210>3

<211>16

<212>PRT

＜213〉(helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the Th epitope peptide of helicobacter Pylori urease B subunit

<400>3

Ser?Ala?Ile?Asn?His?Ala?Leu?Asp?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln

1 5 10 15

Sequence 4:

<210>4

<211>16

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the polypeptide of helicobacter Pylori urease B subunit

<400>4

Ala?Leu?Ala?Gly?Glu?Gly?Leu?Ile?Val?Thr?Ala?Gly?Gly?Ile?Asp?Thr

1 5 10 15

Sequence 5:

<210>5

<211>18

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the polypeptide of helicobacter Pylori urease B subunit

<400>5

Ile?Ser?Pro?Gln?Gln?Ile?Pro?Thr?Ala?Phe?Ala?Ser?Gly?Val?Thr?Thr

1 5 10 15

Met?Ile

Sequence 6:

<210>6

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the polypeptide of helicobacter Pylori urease B subunit

<400>6

Tyr?Thr?Gly?Ile?Tyr?Lys?Ala?Asp?Ile?Gly?Ile?Lys?Asp?Gly?Lys

1 5 10 15

Sequence 7:

<210>7

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<220>

＜230〉be derived from the Th epitope peptide of helicobacter Pylori urease B subunit

<400>7

Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala?Ile?His?Thr?Asp?Thr

1 5 10 15

Sequence 8:

<210>8

<211>48

<212>DNA

＜213〉artificial sequence

<220>

＜230〉according to the nucleotide sequence of colibacillary optimal codon synthetic coding epitope peptide

<400>8

ttt?gtg?gat?ggc?aaa?gaa?gtg?acc?agc?aaa?ccg?gcg?aac?aaa?gtg?agc

Phe?Val?Asp?Gly?Lys?Glu?Val?Thr?Ser?Lys?Pro?Ala?Asn?Lys?Val?Ser

1 5 10 15

Sequence 9:

<210>9

<211>48

<212>DNA

＜213〉artificial sequence

<220>

＜230〉according to the nucleotide sequence of colibacillary optimal codon synthetic coding epitope peptide

<400>9

agc?gcg?att?aac?cac?gcg?ctg?gat?gtg?gcg?gat?aaa?tat?gat?gtg?cag

Ser?Ala?Ile?Asn?His?Ala?Leu?Asp?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln

1 5 10 15

Sequence 10:

<210>10

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜230〉according to the nucleotide sequence of colibacillary optimal codon synthetic coding epitope peptide

<400>10

gtg?gcg?gat?aaa?tat?gat?gtg?cag?gtg?gcg?atc?cac?acc?gat?acc

Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala?Ile?His?Thr?Asp?Thr

1 5 10 15

Sequence 11:

<210>11

<211>186

<212>DNA

＜213〉artificial sequence

<220>

＜230〉according to the nucleotide sequence of colibacillary optimal codon synthetic coding epiposition vaccine

<400>11

atg?gtg?gcg?gat?aaa?tat?gat?gtg?cag?gtg?gcg?atc?cac?acc?gat?acc?aaa?aaa?agc?gcg60

Met?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala?Ile?His?Thr?Asp?Thr?Lys?Lys?Ser?Ala

1 5 10 15 20

att?aac?cac?gcg?ctg?gat?gtg?gcg?gat?aaa?tat?gat?gtg?cag?aaa?aaa?ttt?gtg?gat?ggc?120

Ile?Asn?His?Ala?Leu?Asp?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Lys?Lys?Phe?Val?Asp?Gly

25 30 35 40

aaa?gaa?gtg?acc?agc?aaa?ccg?gcg?aac?aaa?gtg?agc?aaa?aag?agc?att?aaa?gaa?gat?gtg?180

Lys?Glu?Val?Thr?Ser?Lys?Pro?Ala?Asn?Lys?Val?Ser?Lys?Lys?Ser?Ile?Lys?Glu?Asp?Val

45 50 55 60

cag?ttt 186

Gln?Phe

62

Sequence 12:

<210>12

<211>62

<212>PRT

＜213〉artificial sequence

<220>

＜223〉with two Methionins (Lys Lys) joint with 4 epiposition vaccines that connect into from the epi-position of helicobacter pylori (helicobacter pylori)

<400>12

Met?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala?Ile?His?Thr?Asp?Thr

1 5 10 15

Lys?Lys?Ser?Ala?Ile?Asn?His?Ala?Leu?Asp?Val?Ala?Asp?Lys?Tyr?Asp

20 25 30

Val?Gln?Lys?Lys?Phe?Val?Asp?Gly?Lys?Glu?Val?Thr?Ser?Lys?Pro?Ala

35 40 45

Asn?Lys?Val?Ser?Lys?Lys?Ser?Ile?Lys?Glu?Asp?Val?Gln?Phe

50 55 60

Claims (10)

1, three complementary Th cell epitope peptides from helicobacter Pylori urease B subunit.

2, the complementary Th cell epitope peptide of the described helicobacter Pylori urease B subunit of claim 1, the polypeptide that it is characterized in that having one of following amino acid residue sequences:

1) has the polypeptide of the aminoacid sequence of sequence 2 in the sequence table, sequence 3, sequence 7.

2) polypeptide of deriving that the aminoacid sequence of the sequence in the sequence table 2, sequence 3, sequence 7 is formed through replacement, disappearance or the interpolation of one or several amino-acid residue.

3, the nucleotide sequence of the complementary Th cell epitope peptide of the described helicobacter Pylori urease B subunit of coding claim 1.

4, nucleotide sequence according to claim 3 is characterized in that: described nucleotide sequence is one of following nucleotide sequence:

1) has the nucleotide sequence of sequence 8 in the sequence table, sequence 9, sequence 10.

2) with sequence table in sequence 8, sequence 9, sequence 10 have the nucleotide sequence of same-code product.

5, the expression vector that comprises claim 3 or 4 described nucleotide sequences, transgenic cell line and host bacterium.

6, a kind of vaccine is characterized by the group that the epitope peptide that comprises described in the claim 1 is formed.

7, vaccine as claimed in claim 6 except that comprising at least one helper T cell epi-position, also comprises at least one antigen that causes immune response or extra B cell or toxic T lymphocyte epi-position.

8, a kind of epiposition vaccine, its activeconstituents are a described epitope peptide of claim 1 and an extra B cell epitope (SIKEDVQF) from UreB, the amino acid residue sequence that it is characterized in that having sequence 11 in the sequence table.

9, the Nucleotide of the described epiposition vaccine of coding claim 8, the nucleotide sequence that it is characterized in that having sequence 12 in the sequence table.

10, the composition that comprises the polypeptide described in the claim 1, it is characterized in that can be as the drug regimen of prevention or treatment helicobacter pylori infection.

Images