CN101863963A - Helicobacter pylori antigen epitope polypeptide and application thereof - Google Patents

Abstract

The invention discloses a helicobacter pylori urease B antigen epitope polypeptide and application thereof. The amino acid sequence of the antigen epitope polypeptide is the sequence 34 in a sequence table, and the coding gene sequence of the antigen epitope polypeptide is the sequence 25 in the sequence table. The antigen epitope polypeptide provided by the invention can stimulate an organism to generate helicobacter pylori resistance protective immunity reaction, thereby enhancing the effect of inhibiting helicobacter pylori infection, improving germ eliminating capacity of the organism, and playing an improving role in corresponding researches on development of vaccine and pathogenic mechanism and clinical diagnosis.

Description

A kind of helicobacter pylori antigen epitope polypeptide and application thereof

Technical field

The present invention relates to a kind of helicobacter pylori (Helicobacter pylori) urease B subunit (UreB) protein B cell antigen epitope polypeptide and application thereof.

Background technology

Nineteen eighty-two Australia scholar Warren separates from chronic active gastritis patient gastric mucosa first with Marshall and turns out helicobacter pylori (Helicabucter pylori, H.pylori), the New Times of stomach microbe research has been opened in the discovery of this bacterium.Helicobacter pylori distributes very extensive, and the crowd infection rate is up to about 50% in the world wide.Confirmed already, helicobacter pylori infection be chronic chronic gastritis, stomach ulcer, duodenal ulcer main diseases because of, the persistent infection of helicobacter pylori is also closely related with the generation of adenocarcinoma of stomach (gastric adenocarcinoma) and gastric lymphoma (gastric lymphoma).1994, the World Health Organization was decided to be I class carcinogen (Type I carcinogen) with it.

Treatment at helicobacter pylori infection mainly is to adopt two kinds of microbiotic associating proton pump inhibitors now, yet, this treatment means has many shortcomings, as spend too high, the high risk of patient's compliance difference and generation drug resistance bacterial strain etc., especially antibiotic therapy can not prevent to infect once again.So, generally believe that now vaccine is the effective means of inner control helicobacter pylori infection in the world.The full bacterium composition of helicobacter pylori is used in the research of early stage helicobacter pylori vaccine mostly, exists weak effect, is difficult for shortcoming such as stdn.The antigenic research of helicobacter pylori vaccine at present concentrates on the antigen that has immanoprotection action in the helicobacter pylori.On mouse model, confirm multiple Heliobacter pylori antigen at present, comprised vacuolating cytotoxin (VacA), cytotoxin-associated protein (CagA), heat shock protein(HSP) A and B (HspA and HspB), urease and catalase etc.Wherein urease albumen is regarded as the most promising helicobacter pylori vaccine candidate, is to study maximum one.Urease not only provides provide protection to helicobacter pylori field planting under stomach inner acidic environment, and is a kind of conservative protein in the helicobacter pylori, and the conservative property between different strains reaches more than 98%.Existing a large amount of experimentation on animalies have proved its security and validity as vaccine antigen.Urease comprises urease A (UreA) and two structure subunits of B (UreB), and wherein UreB is the major function unit of urease, contains the avtive spot of urease, and its protectiveness is better than UreA.

Vaccine is the most cost-effective way of sense of control metachromia disease, and vaccine inoculation can stimulate the body generation to be different from the specific immune response that natural infection causes, and can reach the purpose of prevention or treatment helicobacter pylori infection.The helicobacter pylori infection of urease vaccine prevention is at present succeedd on many animal models, and external a plurality of study group report that oral helicobacter Pylori urease can prevent mouse infection cat Helicobacter pylori.Up to now; research to helicobacter pylori vaccine mainly is to adopt the antigenic method of simulating nature to carry out the development of protein vaccine both at home and abroad; certain antigen molecule of single expression or the several antigen molecules of amalgamation and expression; also or with antigen molecule and mucosal adjuvant amalgamation and expression, can partly obtain the immanoprotection action in the certain period.At present, epiposition vaccine has become the direction of development infectious diseases and malignant tumour vaccine, and has shown special advantages at aspects such as HIV, malaria, hepatitis B virus, tumours.Given this, selecting on epitope levels and recombinate and design vaccine, may be the vaccine form of a kind of effective prevention and treatment helicobacter pylori infection.Utilize the epi-position of helicobacter pylori protective antigen to design vaccine; by the specificity epitope on single or the polyphone expression protective antigen; and be aided with the adjuvant that can effectively bring out mucosa-immune and come exciter immunne response originally stronger, more special, when being different from natural infection; immunological tolerance might be broken, thereby the purpose of prevention or treatment helicobacter pylori infection can be reached.

Had a large amount of experiments to show, urease B subunit (UreB) not only has prophylactic effect to helicobacter pylori infection, but also can remove the helicobacter pylori that has infected in the body to a certain extent.Discover that the monoclonal antibody at the different epi-positions of UreB can suppress the activity of urease, thereby the infection of blocking-up helicobacter pylori, but the activity with complete urease immune animal can not the good restraining urease thereby can not stop the field planting of helicobacter pylori in stomach fully.

Summary of the invention

The purpose of this invention is to provide a kind of helicobacter pylori (Helicobacter pylori) urease B subunit (UreB) protein B cell antigen epitope polypeptide and application thereof.

Helicobacter Pylori urease B subunit neutrality B cell antigen epitope polypeptide provided by the invention derives from helicobacter Pylori urease B subunit (UreB), and name is called UP35,, be following 1) or 2) polypeptide:

1) polypeptide of forming by the aminoacid sequence shown in the sequence in the sequence table 34;

2) with the aminoacid sequence of sequence in the sequence table 34 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have helicobacter Pylori urease epitope function by 1) polypeptides derived.

Sequence 34 is made up of 15 amino-acid residues in the sequence table, derives from the last 181-195 amino acids residue of helicobacter Pylori urease B subunit (UreB).

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation can be replacement and/or the disappearance and/or the interpolation of 1-10 amino-acid residue; The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation can occur in outside the said structure territory.

The encoding gene of above-mentioned epitope polypeptide also belongs to protection scope of the present invention, and described encoding gene is 1), 2), 3) or 4):

1) DNA of sequence 25 in the sequence table;

2) polynucleotide of the protein sequence of sequence 34 in the code sequence tabulation;

3) under stringent condition with 1) or 2) gene recombination and the described proteic gene of coding claim 1.

4) with sequence table in sequence 25 homologys 80% or more and the Nucleotide of the polypeptide of the helicobacter Pylori urease epitope function of encoding.

Above-mentioned stringent condition can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized under 65 ℃ and washed film with 0.1 * SSPE in DNA or RNA hybrid experiment.

Sequence 25 in the sequence table is made up of 45 Nucleotide, is encoding sequence from the 1st to 45 Nucleotide of 5 ' end.

The present invention also provides the immunological reagent of detection, prevention or treatment helicobacter pylori infection, its activeconstituents comprises above-mentioned epitope polypeptide, form multi-joint poly epiposition vaccine preparation as this immunological reagent by the epitope polypeptide shown in the sequence 37 in the epitope polypeptide shown in the sequence 31, the sequence table in above-mentioned epitope polypeptide and the sequence table, the activeconstituents of this immunological reagent also can be separately the epitope polypeptide shown in the sequence 34 in the above-mentioned sequence table.The present invention also provides the active medicine that suppresses urease, and its activeconstituents comprises above-mentioned epitope polypeptide and/or its antibody.As this medicine of forming by the epitope polypeptide shown in the sequence 37 in the epitope polypeptide shown in the sequence 31, the sequence table in above-mentioned epitope polypeptide and the sequence table; This active constituents of medicine also can be separately above-mentioned epitope polypeptide and/or its antibody; The antibody that this antibody obtains for the vitro culture hybridoma cell line.

The present invention also provides the screening method of above-mentioned helicobacter Pylori urease B subunit neutrality B cell antigen epitope polypeptide, mainly may further comprise the steps:

(1) adopt the truncation method segmentation to make up the UreB antigen of helicobacter pylori and carry out the expression of target protein, by immunoblotting assay, tentatively determine monoclonal antibody A1H10, B3D9, A3C10 at the epi-position scope;

(2) according to the determined helicobacter Pylori urease B subunit monoclonal antibody of above-mentioned steps (1) A1H10, B3D9, A3C10 at the epitope region, carry out for the second time and brachymemma segmentation for the third time makes up UreB antigen, with monoclonal antibody A1H10, B3D9, A3C10 at epitope accurately be positioned at the UreB certain location;

(3) epitope that chemosynthesis above-mentioned steps (2) is identified, by indirect elisa method, with further determine anti-helicobacter pylori urease B subunit monoclonal antibody A1H10, B3D9, A3C10 at epitope.

The method that the present invention uses molecular biology binding molecule immunological experiment to identify, screening have obtained the epitope polypeptide that is made of 15 amino-acid residues, and be economical, effectively, for the screening of epitope provides reference.The present invention has decided the basis for the exploitation honor of novel multi-joint poly epiposition vaccine, also for bringing new thinking based on the exploitation of the causal organism diagnostic kit of albumen epi-position and the development of treatment preparation.The epitope that obtains has great importance to the H.pylori Study on Pathogenesis, helps the infection of more effective prevention and control helicobacter pylori.

Antigen epitope polypeptide provided by the invention has good immunogenicity, in mouse model, can induce the specific humoral immune response of generation at this B cell epitope, the antiserum(antisera) that produces not only can in and the activity of urease, and can also with the urease generation specific antigen-antibody reaction of the natural bacterial strain of H.pylori.Adopt the antibody that has produced among the serological analysis method confirmation clinical infection helicobacter pylori patients serum at this UreB epitope simultaneously.

Antigen epitope polypeptide provided by the invention excites the antibody that produces in the mouse body can suppress urease activity, for the research of urease epitope is had laid a good foundation.Antigen epitope polypeptide provided by the invention can stimulate body to produce the anti-helicobacter pylori protective immunological reaction; and can avoid producing the conformational epitope specific antibody; thereby strengthen the inhibition of helicobacter pylori infection and remove effect, playing good pushing effect in the research of the research and development of corresponding vaccine, pathogenesis and the clinical diagnosis.The epitope of the protective immunological reaction of the anti-H.pylori of excitating organism of the present invention is in vitro detection and the of great value application that has that produces on the immunoprotection.

Description of drawings

(numeral is pairing position in UreB for the corresponding site plan of the different brachymemma UreB fragments of Fig. 1, white bars is represented with monoclonal antibody A1H10, B3D9 or A3C10 western blot reaction negative, and grey bar is represented with monoclonal antibody A1H10, B3D9 or A3C10 western blot reaction positive)

Each brachymemma antigen pcr amplification result of Fig. 2 helicobacter pylori (H.pylori) urease B subunit; Wherein,

A: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (400bp) of goal gene UP1; Swimming lane 3 is the pcr amplification product (430bp) of goal gene UP2; Swimming lane 4 is the pcr amplification product (450bp) of goal gene UP3; Swimming lane 5 is the pcr amplification product (660bp) of goal gene UP4;

B: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (100bp) of goal gene U21; Swimming lane 3 is the pcr amplification product (85bp) of goal gene U22; Swimming lane 4 is the pcr amplification product (100bp) of goal gene U23; Swimming lane 5 is the pcr amplification product (115bp) of goal gene U24; Swimming lane 6 is the pcr amplification product (115bp) of goal gene U25; Swimming lane 7 is the pcr amplification product (100bp) of goal gene U26.

C: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (60bp) of goal gene GST-UP32; Swimming lane 3 is the pcr amplification product (60bp) of goal gene GST-UP33; Swimming lane 4 is the pcr amplification product (60bp) of goal gene GST-UP34; Swimming lane 5 is the pcr amplification product (60bp) of goal gene GST-UP36; Swimming lane 6 is the pcr amplification product (60bp) of goal gene GST-UP38; Swimming lane 7 is the pcr amplification product (60bp) of goal gene GST-UP39

D: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (330bp) of goal gene GST-UP31; Swimming lane 3 is the pcr amplification product (330bp) of goal gene GST-UP35; Swimming lane 4 is the pcr amplification product (330bp) of goal gene GST-UP37; The result shows that the PCR clonal expansion of each goal gene is respond well.

Fig. 3 is each brachymemma antigen gene reorganization bacterium TPTG abduction delivering SDS-PAGE electrophorogram of helicobacter pylori (H.pylori) urease B subunit; Wherein,

A: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the empty carrier bacterium; Swimming lane 3 is induced 4h for the reorganization bacterium of expressing the UP1 gene; Swimming lane 4 is induced 4h for expressing the UP2 gene recombination bacterium; Swimming lane 5 is induced 4h for expressing the UP3 gene recombination bacterium; Swimming lane 6 is induced 4h for expressing the UP4 gene recombination bacterium;

B: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium UP21; Swimming lane 5 is induced 4h for gene recombination bacterium UP22; Swimming lane 6 is induced 4h for gene recombination bacterium UP23; Swimming lane 7 is induced 4h for gene recombination bacterium UP24; Swimming lane 8 is induced 4h for gene recombination bacterium UP25; Swimming lane 9 is induced 4h for gene recombination bacterium UP26;

C: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium GST-UP32; Swimming lane 5 is induced 4h for gene recombination bacterium GST-UP33; Swimming lane 6 is induced 4h for gene recombination bacterium GST-UP34; Swimming lane 7 is induced 4h for gene recombination bacterium GST-UP36; Swimming lane 8 is induced 4h for gene recombination bacterium GST-UP38; Swimming lane 9,10 is induced 4h for gene recombination bacterium GST-UP39;

D: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium GST-UP31; Swimming lane 5 is induced 4h for gene recombination bacterium GST-UP35; Swimming lane 6 is induced 4h for gene recombination bacterium GST-UP37

Fig. 4 is the UreB fragment of brachymemma and monoclonal antibody A1H10, B3D9, A3C10 western blot figure; Wherein, the brachymemma antigen (UP1, UP2, UP3 and UP4) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay of the A partitioned representation first time; (1) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody A1H10; (2) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody B3D9; (3) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody A3C10;

B is the brachymemma antigen (UP21, UP22, UP23, UP24, UP25 and UP26) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay of partitioned representation for the second time; (1) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody A1H10; (2) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody B3D9; (3) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody A3C10;

C is brachymemma antigen (GST-UP31, GST-UP32, the GST-UP33 of partitioned representation for the third time, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38 and GST-UP39) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay; (1) the immunoblotting result of GST-UP31, GST-UP32, GST-UP33 and monoclonal antibody A1H10; (2) the immunoblotting result of GST-UP34, GST-UP35, GST-UP36 and monoclonal antibody B3D9; (3) the immunoblotting result of GST-UP37, GST-UP38, GST-UP39 and monoclonal antibody A3C10

Fig. 5 analyzes with A1H10, B3D9, A3C10 indirect ELISA respectively for merging epitope peptide GST-UP32, GST-UP35, GST-UP38.

Fig. 6 is that monoclonal antibody A1H10, B3D9, A3C10 analyze the indirect ILISA of the identification of synthetic epitope peptide

Fig. 7 is the identification of epitope peptide to the H.pylori patients serum.

A:H.pylori patients serum and the ELISA reaction of merging epi-position GST-UP32, GST-UP35 and GST-UP38; The ELISA reaction of B:H.pylori patients serum and synthetic epitope peptide UP32, UP35 and UP38.

Fig. 8 merges epitope peptide serum to merging epitope peptide, synthetic peptide, the proteic identification of different natural H.pylori bacterial strain urease B subunit for mouse-anti; The anti-epi-position serum of A is analyzed with the Western blot of corresponding fusogenic peptide; The anti-epi-position serum of B reacts with the ELISA of corresponding synthetic peptide; Anti-epi-position serum of C and the reaction of natural H.pylori bacterial strain urease B subunit protein ELISA.

Fig. 9 is that monoclonal antibody A1H10, B3D9, A3C10 and the anti-epi-position that merges resist inhibition helicobacter Pylori urease activity experiment more.

Embodiment

Method among the following embodiment if no special instructions, is ordinary method.

Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.

The evaluation of embodiment 1, anti-helicobacter pylori urease B subunit monoclonal antibody A1H10, B3D9, A3C10 antigen recognition epi-position

By the screening of brachymemma partitioned representation urease B fragment repeatedly epitope, each time blocked fragment and concerned as shown in Figure 1 in the position of helicobacter Pylori urease B subunit.

One, the partitioned representation and the preliminary evaluation of the epitope first time of UreB truncated protein

1, the helicobacter pylori UreB segmentation antigen UP1 (sequence 5) of brachymemma, UP2 (sequence 6), UP3 (sequence 7), UP4's (sequence 8) is recombinant expressed:

1) cultivation of helicobacter pylori (Helicobacter pylori)

Helicobacter pylori (Helicobacter pylori) 26695 (ATCC No.700392) is adopted solid culture, and substratum is: jejunum campylobacter bacterio-agar matrix (Chinese dysentery control agent delivery research centre, Shanghai) 43g/L, defiber sheep blood (by market purchasing live sheep after carotid artery is got blood, handle with the granulated glass sphere defiber after promptly) 50ml/L, antibiotic PXB (available from Merck) 0.38mg/L, vancomycin (available from Amresco) 10mg/L and amphotericin B (available from Sigma) 5mg/L.37 ℃ of little aerobic environment (5%O ₂, 10%CO ₂, 85%N ₂) the middle 48-72hr that cultivates, improved broth medium is collected thalline.

2) preparation of helicobacter pylori (Helicobacter pylori) genomic dna

Helicobacter pylori (Helicobacter pylori) 26695 extracting genome DNA are extracted the test kit specification sheets according to promega company bacterial genomes and are carried out.

3) primer sequence design

The genome sequence of the H.pylori international standard strain 26695 of having announced according to Genbank finds the gene order (gi:21637177) of UreB, utilize 4 pairs of Auele Specific Primers of Primer5.0 software design design, add SacI and Hind III restriction enzyme site (underscore shows restriction enzyme site) in the upstream and downstream primer respectively, their sequence is as follows:

The primer of the encoding gene (sequence 1 in the sequence table) of amplification UP1: UP1-F:C GAGCTCAAAAAGAT

TAGCAGAAAAG；UP1-R：CCC AAGCTTTTAAGCAGTTACGATC。

The primer of the encoding gene (sequence 2 in the sequence table) of amplification UP2: UP2-F:C GAGCTCAATCTTAG

CGTAGGTCC；UP2-R：CCC AAGCTTTTAGTCTGTGTGGATAG。

The primer of the encoding gene (sequence 3 in the sequence table) of amplification UP3: UP3-F:C GAGCTCATCAATC

ATGCGTTAG；UP3-R：CCC AAGCTTTTACCAAGTTCTAGTGATA。

The primer of the encoding gene (sequence 4 in the sequence table) of amplification UP4: UP4-F: GAGCTCATTTTCTCA

ATCACCAG；UP4-R：CCC AAGCTTGAAAATGCTAAAGAGTT。

4) pcr amplification goal gene

26695 pnca gene group DNA are template with helicobacter pylori (Helicobacter pylori), add corresponding primer, obtain UreB segmentation fragment UP1 (encoding gene has the nucleotide sequence of sequence 1 in the sequence table) through 30 PCR cyclic amplifications, UP2 (nucleotide sequence of sequence 2 in the encoding gene ordered list), UP3 (encoding gene has the nucleotide sequence of sequence 3 in the sequence table), the encoding gene of UP4 (encoding gene has the nucleotide sequence of sequence 4 in the sequence table), show that through 1.0% agarose electrophoresis each purpose fragment is consistent with the theoretical size of amplification gene.

The pcr amplification result of each section goal gene is shown in A among Fig. 2, the PCR clonal expansion effect that shows goal gene UP1, UP2, UP3, UP4 encoding gene is better, amplified the purpose fragment of about 400bp, 430bp, 450bp, 660bp size respectively, shown that through order-checking sequence is correct.

2, the structure and the expression of segmentation antigen UP1, UP2, UP3, UP4 expression plasmid

Use SacI and Hind III double digestion and Transformed E .coli DH5 α (available from sky root biochemistry) after the plasmid pET-28a (+) (available from Merck) of enzyme double digestion is connected equally respectively behind the PCR product UP1 that step 1 amplification is obtained, UP2, UP3, the UP4 encoding gene purifying, be to carry out enzyme evaluations of cutting and check order after the substratum screening of 50 μ g/ml kalamycin resistances at final concentration, enzyme cut and the evaluation of checking order shows correct recombinant vectors called after pET-UP1, pET-UP2, pET-UP3, pET-UP4.Extract recombinant plasmid pET-UP1, pET-UP2, pET-UP3, pET-UP4 and transformed into escherichia coli BL21 (available from sky root biochemistry) strain, after being the substratum screening of 50 μ g/ml kalamycin resistances at final concentration, plasmid carries out enzyme and cuts evaluation, obtains identifying the reorganization bacterium of errorless expression UP1, UP2, UP3 or UP4.Get and identify that errorless reorganization bacterium is inoculated in 5ml and contains in the LB nutrient solution of kantlex 37 ℃ of shaking table overnight incubation.Contain the reorganization bacterium of the incubated overnight ratio transferred species in 1: 100 in the fresh LB nutrient solution of kantlex in 5ml next day, and 37 ℃, 200rpm is cultured to OD ₆₀₀Value is about at 0.6 o'clock and adds IPTG to final concentration 1.0mM, inducing culture 4h, get the 1ml culture, centrifugal collection thalline is with 80 μ l PBS (0.01mol/L, pH7.4) resuspended, add 5 times of SDS-PAGE sample-loading buffers of 20 μ l (contain in the 1L solution: 15.1g Tris alkali, the 94g glycine, 5gSDS), boiled 5 minutes in the boiling water after being mixed, centrifugal receipts supernatant carries out SDS-PAGE and analyzes.Simultaneously, be contrast with the e. coli bl21 reorganization bacterium that changes pET-28a (+).SDS-PAGE detects the Recombinant Protein Expression situation, the screening efficient expression strain.

The abduction delivering qualification result is shown in A among Fig. 3, the result shows the differential protein band of expression that UP1 has at the about 28kD of relative molecular mass place at the about 21kD of relative molecular mass, UP4 at the about 20kD of relative molecular mass, UP3 at the about 18kD of relative molecular mass, UP2, and is consistent with the fusion rotein size of expection.

3, Western blot identifies the epi-position region of A1H10, B3D9, the identification of A3C10 monoclonal antibody

Western blot concrete operations step is as follows:

According to the method for step 2, the reorganization bacterium of culture expression UP1, UP2, UP3 or UP4 prepares the protein electrophoresis sample respectively, carries out 15% SDS-PAGE electrophoresis.Electrophoresis finishes, and 50V voltage is wet to be changeed on 4h to the NC film.Add the PBST room temperature sealing 2h that contains 5% skim-milk, PBST washes 3 times, each 5min.Three strain mouse anti UreB monoclonal antibody B3D9 (biotechnology communication, 2007 that add dilution in 1: 5000 respectively; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), A1H10 (biotechnology communication, 2007; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), A3C10 (biotechnology communication, 2007; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), room temperature is placed 1h, and PBST washes 3 times.The goat anti-mouse igg (Sigma) that adds the HRP mark of dilution in 1: 50000, room temperature is placed 1h, and PBST washes 3 times.The DAB colour developing.

Western blot the results are shown in Figure A in 4, the immunoblotting result shows that the antigen and antibody specific association reaction has taken place for reorganization UP2 albumen and mouse anti UreB monoclonal antibody A1H10 and B3D9, the antigen and antibody specific association reaction has taken place in reorganization UP3 and UP4 albumen and mouse anti UreB monoclonal antibody A3C10, illustrated monoclonal antibody A1H10 and B3D9 at epitope be positioned at UreB albumen UP2, monoclonal antibody A3C10 at epitope be positioned at UP3 and the synergetic position of UP4.

For the epitope with each section of three strain monoclonal antibodies identification UreB is limited to than in the little scope in school, we will express again for the first time can be carried out secondary expression and evaluation by the section of this three strains monoclonal antibody identification.

Two, the partitioned representation and the further evaluation of the epitope second time of UreB truncated protein

The UreB truncated protein the second time partitioned representation and the method identified of the used method of the further evaluation of epitope and partitioned representation for the first time similar, used expression vector is PGEX-4T-2 (available from Amersham).

Segmentation for the second time is divided into six sections UreB truncated protein UP21 (sequence 15 in the sequence table), UP22 (sequence 16 in the sequence table), UP23 (sequence 17 in the sequence table), UP24 (sequence 18 in the sequence table), UP25 (sequence 19 in the sequence table) and UP26 (sequence 20 in the sequence table), each encoding gene primer table of expressing UP21, UP22, UP23, UP24, UP25, UP26 is as follows, add EcoR I and Xho I restriction enzyme site in the upstream and downstream primer respectively, underscore shows restriction enzyme site.

The primer of amplification UP21 encoding gene (sequence 9 in the sequence table) is right: UP21F:

CCG GAATTCTAGATGGCGTTAAAAA；UP21R：CCG CTCGAGTCATGTGTCAATACCA。

The primer of amplification UP22 encoding gene (sequence 10 in the sequence table) is right: UP22F:CCG GAATTCTCGGT

GGTATTGACA；UP22R：CCG CTCGAGTTAGGTTGTTACACCGCTT。

The primer of amplification UP23 encoding gene (sequence 11 in the sequence table) is right: UP23F:CCG GAATTCTAAG

CGGTGTAACAAC；UP23R：CCG CTCGAGTTATTTTAAATTTCTTCTG。

The primer of amplification UP24 encoding gene (sequence 12 in the sequence table) is right: UP24F:CCG GAATTCTAACT

ATCACTCCAGGCA；UP24R：CCG CTCGAGTTACGCGTCGTTAGAAG。

The primer of amplification UP25 encoding gene (sequence 13 in the sequence table) is right: UP25F:CCG GAATTCTAGCT

TCTAACGACGCG；UP25R：CCG CTCGAGTTATAACGCATGATTGATT。

The primer of amplification UP26 encoding gene (sequence 14 in the sequence table) is right: UP26F:

CG GAATTCTACCTCAAACCATTGCGGC；UP26R：

CCG CTCGAGTTAACCCACACGACCCATAG。

The pcr amplification result amplifies UP21, UP22, UP23, UP24, UP25, UP26 encoding gene respectively shown in Fig. 2 B, the purpose fragment of the about 100bp of their size, 85bp, 100bp, 115bp, 115bp, 100bp size.

According to the method for the step 2 in the step 1 recombinant vectors of construction expression UP21, UP22, UP23, UP24, UP25 or UP26 respectively, the carrier that just will set out is replaced pET-28a (+) by PGEX-4T-2.Evaluation shows correct recombinant vectors called after PGEX-UP21, PGEX-UP22, PGEX-UP23, PGEX-UP24, PGEX-UP25, PGEX-UP26.According to the described method abduction delivering of the step 2 of step 1 UP21, UP22, UP23, UP24, UP25 or UP26 albumen, and carry out SDS-PAGE and detect the Recombinant Protein Expression situation, the screening efficient expression strain.

Protein induced expression qualification result shows that gene recombination bacterium through after inducing, has the protein expression band of increase at about 28KDa～29KDa place shown in B among Fig. 3, consistent with target protein molecular weight size.

Method with reference to the step 3 of step 1 is carried out UP21, UP22, UP23, UP24, UP25 or UP26 albumen Westernblot detect, Western blot result is shown in B among Fig. 4, reorganization UP23 albumen can be discerned by mouse anti UreB monoclonal antibody A1H10, UP24 albumen can be discerned by mouse anti UreB monoclonal antibody B3D9, UP26 albumen can be discerned by mouse anti UreB monoclonal antibody A3C10, specific reaction band appears, show monoclonal antibody A1H10 at epitope be positioned at UreB albumen UP23, monoclonal antibody B3D9 at epitope be positioned at UP24, monoclonal antibody A3C10 at epitope be positioned at UP26.

For the epitope with each section of three strain monoclonal antibodies identification UreB accurately navigates to littler scope, carry out littler segmentation evaluation with being accredited as for the second time the male fragment equally.

Three, the accurate location of the partitioned representation for the third time of UreB truncated protein and epitope

Segmentation for the third time is divided into nine sections UreB truncated proteins, it is as follows to express the primer table, GST-UP32 (the UP32 sequence is a sequence 31 in the sequence table), GST-UP33 (the UP33 sequence is a sequence 32 in the sequence table), GST-UP34 (the UP34 sequence is a sequence 33 in the sequence table), GST-UP36 (the UP36 sequence is a sequence 35 in the sequence table), GST-UP38 (the UP38 sequence is a sequence 37 in the sequence table), add EcoR I and Xho I restriction enzyme site respectively in GST-UP39 (the UP39 sequence is a sequence 38 in the sequence table) the upstream and downstream primer, GST-UP31 (the UP31 sequence is a sequence 30 in the sequence table), GST-UP35 (the UP35 sequence is a sequence 34 in the sequence table), add BstB I and Xho I restriction enzyme site (underscore shows restriction enzyme site) respectively in GST-UP37 (the UP37 sequence is a sequence 36 in the sequence table) the upstream and downstream primer

The primer of amplification GST-UP31 encoding gene (the UP31 coding gene sequence is a sequence 21 in the sequence table) is right: GST-UP31F:

GAAAATG TTCGAAGATCGTTTATGTCA；GST-UP31R：

CCG CTCGAGATCAGCAGGACCAGTTCCGCCACCAATCATGGTTGTTACACCGCTACGCG

GAACCAGATC。

The primer of amplification GST-UP32 encoding gene (the UP32 coding gene sequence is a sequence 22 in the sequence table) is right: GST-UP32F:

CG GAATTCTAGGTGGCGGAACTGGTCCTGCTGATGGC；GST-UP32R：

CCG CTCGAGTCAGATAGTAGTCGCATTAGTGCCATCAGCAGGAC。

The primer of amplification GST-UP33 encoding gene (the UP33 coding gene sequence is a sequence 23 in the sequence table) is right: GST-UP33F:

CCG GAATTCTCGGCACTAATGCGACTACTATCACTCCAGGC；GST-UP33R：

CCG CTCGAGCTATTTTAAATTTCTTCTGCCTGGAGTGAT。

The primer of amplification GST-UP34 encoding gene (the UP34 coding gene sequence is a sequence 24 in the sequence table) is right: GST-UP34F:

CCG GAATTCTGACTATCACTCCAGGCAGAAGAAATTTAAAA；

GST-UP34R：CCG CTCGAGTTACGCTCTGAGCATCCATTTTAAATTTCT。

The primer of amplification GST-UP35 encoding gene (the UP35 coding gene sequence is a sequence 25 in the sequence table) is right: GST-UP35F:

GAAAATGTTCGAAGATCGTTTATGTCA；GST-UP35R：

CCGCTCGAGGAAACCTAAGTTCATAGAATATTCTTCAGCCGCTCTGAGCATCCAACGCG

GAACCAGATC。

The primer of amplification GST-UP36 encoding gene (the UP36 coding gene sequence is a sequence 26 in the sequence table) is right: GST-UP36F:

CG GAATTCTAATGAACTTAGGTTTCTTGGCTAAAGGTAACGC；

GST-UP36R：CCG CTCGAGTTACGCGTCGTTAGAAGCGTTACCTTTA。

The primer of amplification GST-UP37 encoding gene (the UP37 coding gene sequence is a sequence 27 in the sequence table) is right: GST-UP37F:

GAAAATGTTCGAAGATCGTTTATGTCA；GST-UP37R：

CCGCTCGAGCCCCATGTCATGCAAAGTGTCTTCAGCCGCAATGGTTTGAGGACGCGGAA

CCAGATC。

The primer of amplification GST-UP38 encoding gene (the UP38 coding gene sequence is a sequence 28 in the sequence table) is right: GST-UP38F:

CG GAATTCTAACTTTGCATGACATGGGGATTTTCTCAATCAC；GST-UP38R：

CCG CTCGAGTTAAGAGTCAGAGCTGGTGATTGAGAAAATCC。

The primer of amplification GST-UP39 encoding gene (the UP39 coding gene sequence is a sequence 29 in the sequence table) is right: GST-UP39F:

G GAATTCTAATTTTCTCAATCACCAGCTCTGACTCTCAAGCTATGGG；GST-UP39R：

CCG CTCGAGTTAACCCACACGACCCATAGCTTGA。

GST-UP32, GST-UP33, GST-UP34, GST-UP36, GST-UP38, GST-UP39 directly anneal synthetic with two long primers, GST-UP31, GST-UP35, GST-UP37 are template with PGEX-4T-2, obtain with conventional PCR method amplification.

The pcr amplification result is shown in Fig. 2 C, 2D, amplified the specificity purpose fragment of the about 60bp size of encoding gene of GST-UP32, GST-UP33, GST-UP34, GST-UP36, GST-UP38, GST-UP39, amplification obtains the specificity purpose fragment of the encoding gene of GST-UP31, GST-UP35, GST-UP37 for about 330bp size.

According to the method for the step 2 in the step 1 recombinant vectors of construction expression GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 respectively, the carrier that just will set out is replaced pET-28a (+) by PGEX-4T-2.Evaluation shows correct recombinant vectors called after PGEX-UP31, PGEX-UP32, PGEX-UP33, PGEX-UP34, PGEX-UP35, PGEX-UP36, PGEX-UP37, PGEX-UP38, PGEX-UP39.Colibacillus engineering according to the described method construction expression of the step 2 of step 1 GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 target protein, and abduction delivering GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 and carry out SDS-PAGE and detect the Recombinant Protein Expression situation, the screening efficient expression strain.

Protein induced expression qualification result shows that gene recombination bacterium through after inducing, has the protein expression band of increase at about 27KDa～28KDa place shown in D among C, Fig. 3 among Fig. 3, consistent with target protein molecular weight size.

With reference to the method for the step 3 of step 1 to GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 carries out Western blot and detects, Western blot result is shown in C among Fig. 4, the result shows that the specificity association reaction has taken place for reorganization GST-UP32 albumen and monoclonal antibody A1H10, the specificity association reaction has taken place in GST-UP35 albumen and monoclonal antibody B3D9, the specificity association reaction has taken place in GST-UP38 albumen and monoclonal antibody A3C10, show that the corresponding epi-position of monoclonal antibody A1H10 explanation monoclonal antibody is GST-UP32, the corresponding epi-position of monoclonal antibody B3D9 is GST-UP35, and the corresponding epi-position of monoclonal antibody A3C10 is GST-UP38.

Four, enzyme linked immunosorbent assay (ELISA) method is determined the epi-position of monoclonal antibody A1H10, B3D9, A3C10

Simultaneously, determine the epi-position of monoclonal antibody A1H10, B3D9, A3C10 with enzyme linked immunosorbent assay (ELISA) method, to wrap respectively by elisa plate by fusion epi-position Protein G ST-UP32, GST-UP35, the GST-UP38 of GSTrap 4B affinity column purifying, with detect monoclonal antibody A1H10, B3D9, A3C10 at epi-position.The concrete operations step is as follows:

1, the recombinant protein sample is prepared:

Expression GST-UP32, the GST-UP35 of above-mentioned structure, the colibacillus engineering of GST-UP38 target protein are rule 37 ℃ of activation 16-20h in containing on the corresponding antibiotic LB flat board; Choose mono-clonal and be inoculated in the 5ml LB substratum, 37 ℃ are shaken bacterium and spend the night; Be transferred in fresh LB substratum with 1: 100 (weight ratio) inoculum size next day, and 37 ℃ are shaken bacterium to OD600 ≈ 1.0, adds IPTG (final concentration 1mM) inducing culture 3-4h; Collect thalline, every liter of bacterium liquid is resuspended with the solution of the STE (10mM Tris HCl pH8.0,150m M NaCl, 1mM EDTA, pH 8.0) of 50mL precooling approximately; The ultrasonication thalline, 15000g, the centrifugal collection supernatant of 10min, merge epi-position albumen by GSTrap 4B affinity column purifying, specifically be that an amount of Triton x-100 of adding is 1% to final concentration in supernatant, h) 0.45 μ m filter membrane syringe filtering, 4 ℃ of preservations of supernatant are standby; In the 8mL supernatant, add 1mL precooling 1X PBS (140mM NaCl, 2.7mM KCl, 10mMNa ₂HPO4,1.8mM KH ₂PO4, pH 7.3) washed GST resin, shake its adhesion protein of command of execution 0.5h gently.The solution that will contain gst fusion protein injects the good chromatography column of balance, when the solution that contains fusion rotein all enters in the post, precooling PBS washing with 30 times of volumes, the gsh elutriant (pH8.0 among the gsh of 10mM, the Tris-HCl of 50mM) that adds the freshly prepared 15mM of 1mL, leave standstill 10min after having hanged gently, collect elutriant, repeat twice of wash-out; Get the effluent liquid that contains gst fusion protein (PGEX-4T-2 expressing protein purifying) of equivalent respectively, the target protein of washings and wash-out carries out SDS-PAGE with analysis purposes albumen; Collection contains the wash-out part of target protein; By PBS dialysis or remove the free gsh, sample carries out gathering gel photograph behind the SDS-PAGE, analyzes with BandScan5.0 software then, and detecting the fusion rotein purity that surperficial purifying obtains is more than 90%.

2, determine the epi-position of monoclonal antibody A1H10, B3D9, A3C10 with enzyme linked immunosorbent assay (ELISA) method

1) antigen coated: with coating buffer is the suspension of 3 μ g/mL with antigen (albumen that step 1 obtains) dilution respectively, adds elisa plate, and negative control (being the gst fusion protein of purifying) is set in the 100ul/ hole simultaneously, and 4 ℃ of bags are spent the night;

2) washing: wash each hole of elisa plate 3 times with washings PBST, each 5 minutes, drain;

3) sealing: every hole adds each the 200 μ L of PBST solution that contain 5% skim-milk, puts 37 ℃ and hatches 2h;

4) add monoclonal antibody A1H10, B3D9, the A3C10 that suitably dilutes (1: 400-1: 1000 times) with insulation liquid (the PBST solution that contains 0.5% skim-milk), 100 μ l/ holes, each extent of dilution respectively adds two holes.Put 37 ℃ and hatch 2h, washing :) with step 2;

5) add enzyme conjugates (two is anti-): add reacting hole, every hole 100 μ L with being incubated the anti-mouse two anti-suitably dilutions (1: 50000) of liquid with horseradish peroxidase-labeled.Put 37 ℃ and hatch 1h, washing: same step (2);

6) colour developing: add chromogenic substrate solution, every hole 100 μ L, room temperature lucifuge colour developing 5-10min;

7) termination reaction: add stop buffer 2M/L H ₂SO ₄, every hole 50 μ L;

8) measure OD value: measure the OD value of each reacting hole with enzyme connection detector in the 492nm wavelength, write down the result;

9) result judges: with the GST OD of purifying ₄₉₂Mean value merges epi-position albumen OD as negative control ₄₉₂〉=2.1 times of negative control values (P/N 〉=2.1) be considered as monoclonal antibody at epitope.

Above-mentioned reaction result is consistent with Western blot result, as shown in Figure 5, show that the specificity association reaction has taken place for monoclonal antibody A1H10, B3D9, A3C10 and fusion epi-position Protein G ST-UP32, GST-UP35, GST-UP38, instruction book clonal antibody A1H10, the pairing epi-position of B3D9, A3C10 are respectively GST-UP32, GST-UP35, GST-UP38.

Embodiment 2, synthetic epitope polypeptide with further conclusive evidence monoclonal antibody A1H10, B3D9, A3C10 at epitope

1, epitope peptide is synthetic

At determined monoclonal antibody identification epi-position among the embodiment 1, adopt the synthetic epitope polypeptide of chemical synthesis (sending BeiJing ZhongKe inferior photo bio company limited to synthesize), called after UP32 (aminoacid sequence is a sequence 31 in the sequence table), UP35 (aminoacid sequence is a sequence 34 in the sequence table), UP38 (aminoacid sequence is a sequence 37 in the sequence table) purity are more than 90% respectively, and resultant quantity is 4mg.

2, the ELISA method determine monoclonal antibody A1H10, B3D9, A3C10 at epitope

Synthetic 3 epitope polypeptide UP32, UP35, UP38 (10 μ g/ml) are wrapped respectively by elisa plate (100ul/ hole), with detect A1H10, B3D9, A3C10 monoclonal antibody at epi-position.The concrete operations step is with the step 4 of embodiment 1.

Reaction result as shown in Figure 6, show that the specificity association reaction has taken place for monoclonal antibody A1H10, B3D9, A3C10 and fusion epi-position Protein G ST-UP32, GST-UP35, GST-UP38, instruction book clonal antibody A1H10, the pairing epi-position of B3D9, A3C10 are respectively UP32, UP35, UP38.

Embodiment 3, fusion epitope peptide and synthetic epitope peptide and patients serum's identification experiment

In order to detect the specific antibody that whether produces the epitope that identifies at the present invention among the clinical infection H.pylori patients serum, we are with fusion epitope peptide (the 3 μ g/ml) GST-UP32 of embodiment 1 preparation, GST-UP35, GST-UP38 and embodiment 2 synthetic epitope peptides (10 μ g/ml) UP32, UP35, UP38 wraps respectively by elisa plate (100ul/ hole), this laboratory to collect and with S001 helicobacter Pylori urease detection kit (colloidal gold method, Beijing Kang Mei days letter Bioisystech Co., Ltd) be accredited as 3 parts of UreB male patients serums and 2 portions of normal human serums and resist (1: 100) to carry out elisa assay as one, the concrete operations step is with the step 4 of embodiment 1.

Reaction result as shown in Figure 7, merge epi-position albumen and synthetic epitope peptide and all positive reaction has taken place with 3 parts of helicobacter pylori infection patients serums, all do not react with 2 portions of normal human serums, the antibody that has produced among the helicobacter pylori infection patient at epitope peptide of the present invention is described, this development for multivalence epitope vaccine and diagnostic reagent provides new thinking.

The polyclonal antiserum of embodiment 4, epitope antigen is to synthetic peptide and the proteic identification of natural UreB

1, the preparation of mouse-anti serum

1) animal immune

Choose the 6-8 female BALB/C mice of SPF level in age in week, fusion epi-position Protein G ST-UP32, GST-UP35 and GST-UP38 purified in the subcutaneous multi-point injection embodiment 1 in back carry out immunity, and 3 times immunizing antigen dosage only is 100 μ g/.During first immunisation antigen added subcutaneous multi-point injection after the emulsification of equivalent complete Freund's adjuvant (CFA) thorough mixing, booster immunization is twice every 2 weeks added equivalent incomplete Freund's adjuvant (IFA) emulsification again with antigen after.Set up simultaneously and only inject the PBS damping fluid (pH7.0,50mmol/L) and GST protein immunization group immune group in contrast, immune programme for children is identical, every group of 5 mouse.Back 10 days ear edge vein exploitating bloods of 3 immunity detect antiserum titre, reach comparatively ideal titre after, finish back 14 days in immune programme for children, get blood and collect immunity back polyclonal antiserum.

2) indirect elisa method detects antibody titer

The detection that antagonist is tired adopts indirect elisa method to carry out.GST-UP32, GST-UP35, GST-UP38 fusion rotein with purifying are diluted to 3 μ g/ml with coating buffer, wrap by in enzyme plate, and every hole 100 μ l, 4 ℃ of bags are spent the night.Add different extent of dilution antiserum(antisera) to be checked next day, normal mouse serum with dilution in 1: 100 is contrast, two anti-be the HRP mark sheep anti-mouse igg of dilution in 1: 50000, chromogenic substrate is O-Phenylene Diamine (OPD), colour developing is the result measure at wavelength 490nm place with microplate reader, and P/N is positive greater than 2.1.

The result shows, after three immunity, the antibody titer of each experimental group can reach 1: 25600-1: 51200, and the PBS control group does not merge the epi-position reaction with any one substantially, illustrates that the present invention makes up the fusion epi-position albumen humoral immunoresponse(HI) of excitating organism well.

2, the ELISA method detects polyclonal antiserum and synthetic peptide of different epi-positions and the proteic identification of natural UreB

1) preparation of protein sample

(1) cultivation of helicobacter pylori

The cultivation of helicobacter pylori international standard bacterial strain NCTC I 1637 (available from the state-run standard type culture collection institute (NCTC) of Britain), helicobacter pylori (Helicobacter pylori) 26695 is with the step 1) in the step 1 of embodiment 1.

(2) preparation of helicobacter pylori NCTC I 1637,26695 whole bacterial protein samples

Scrape helicobacter pylori international standard bacterial strain NCTC I 1637 or helicobacter pylori (Helicobacter pylori) 26695 thalline with meat soup from helicobacter pylori solid culture plate, 4 ℃, the centrifugal 10min of 5000g collects thalline, less salt PBS damping fluid (pH7.0 with precooling, 50mmol/L) wash 3 times, be 4 ℃ at every turn, the centrifugal 10min of 5000g, use at last less salt PBS (pH7.0,50mmol/L) resuspended.Ice-bath ultrasonic 10min makes cell thoroughly broken.Then the solution room temperature is placed 0.5h, abundant solubilising protein, 8000g is centrifugal, and 20min removes insolubles.Collect supernatant, be whole bacterial protein solution.

2) enzyme-linked immunosorbent assay detects polyclonal antiserum and the synthetic proteic identification of the natural UreB of peptide of different epi-positions

With embodiment 2 synthetic epitope peptide UP32, UP35, UP38 and helicobacter pylori NCTC I 1637,26695 whole bacterial protein samples with the amount bag in 1000ng/100ul/ hole by elisa plate.One anti-be the mouse-anti serum (1: 100) of fusion protein immunization, and specifically experimental procedure is with embodiment 1.

Reaction result found that shown in Fig. 8 A, 8B the mouse-anti serum of immunity can be discerned the synthetic peptide of corresponding epi-position well, also can react with natural UreB simultaneously.

3, the proteic western blot of polyclonal antiserum and natural UreB analyzes

With the capable SDS-PAGE electrophoresis of above-mentioned ready helicobacter pylori 26695 whole bacterial protein samples, change film, then with embodiment 1 in behind purified fusion epi-position Protein G ST-UP32, GST-UP35 and the GST-UP38 immune mouse antiserum(antisera) carry out immunoblotting assay, with the fusion epi-position albumen of purifying and the UreB albumen UreBM of brachymemma (is the polypeptide of 106-377 position on the UreB albumen, according to the method expression and purification of embodiment 1, the amplimer of its encoding gene is F:

C GAGCTCAATCTTAGCGTAGGTCC ( SacI); R:CCC AAGCTTCCAAGTTCTAGTGATAA ( The Hind III); Utilize this primer, with helicobacter pylori (Helicobacter pylori) 26695 genomes is template, expand and the target gene fragment, insert again to make up between the SacI of pET28a (+) carrier and the Hind III restriction enzyme site and obtain recombinant vectors, express after recombinant vectors transformed BL21, purifying just can obtain being used for the UreBM of positive control) as positive control, the while, as negative control, antiserum(antisera) diluted all the other concrete operations steps with embodiment 1 by 1: 200 times with BSA.

The result is shown in Fig. 8 C, positive reaction has taken place in the UreB albumen UreBM of the fusion epi-position albumen of antiserum(antisera) and purifying and brachymemma, and with the UreaB of natural helicobacter pylori 26695 specific antigen-antibody reaction has taken place also, and do not see that with BSA positive reaction takes place, explanation can be discerned natural UreB albumen by the antiserum(antisera) that merges the preparation of epi-position protein immunization BALB/e mouse, further specifying the epi-position that we identify out is effective epi-position, can be used as the candidate molecules of epiposition vaccine.

Embodiment 5, monoclonal antibody and polyvalent antibody suppress the urease activity test

The extract that contains urease activity comes from the centrifugal supernatant of the broken thing of helicobacter pylori NCTC 11637 full bacterium of above-mentioned preparation.Getting the extract that contains urease is diluted among the 25 μ l PBS (pH7.0), respectively with the embodiment 4 that is diluted in 25 μ l PBS (pH7.0) equally in GST-UP32, GST-UP35 and the GST-UP38 polyclonal antiserum, monoclonal antibody A1H10, B3D9, A3C10 of preparation hatch altogether in elisa plate, 4 ℃ are spent the night.Get and contain 500mM urea, 0.02% phenol red and 50mM phosphate buffered saline buffer (pH6.8) 50 μ l 0.1mM DTT are added in the enzyme connection hole, measure the OD value at 560nm place behind the incubated at room 5h.Simultaneously with the how anti-mouse serum of anti-GST, with PBS mice immunized serum among the embodiment 4 in contrast.Inhibiting rate (%)=(the OD value behind the OD value-Jia antibody of no antibody)/(the OD value of no antibody) * 100.

Test-results as shown in Figure 9, compare with control group, monoclonal antibody A1H10, B3D9, A3C10 have significant inhibitory effect to urease, and when dosage reached 25 μ g, inhibiting rate all can reach 70%, GST-UP32, GST-UP35 and GST-UP38 polyclonal antiserum also have certain restraining effect to urease, when the antibody dosage that adds was 30 μ g, inhibiting rate all can reach 50%, and this inhibition has dose-dependently, along with the increase that adds antibody dosage, inhibiting rate is in rising trend.

Provable according to above test, the present invention utilize the segmentation truncation method make up segmentation antigen and with western blot method determined each monoclonal antibody at epitope.Behind the epi-position immune animal that the present invention identifies out, the specific humoral immune response of excitating organism effectively, confirmed that they have good immunogenicity, and the antiserum(antisera) that produces has certain urease activity restraining effect, and can avoid producing the conformational epitope specific antibody, enhancing is to the inhibition of helicobacter pylori infection and remove effect, to playing good pushing effect in the research of the research and development of corresponding vaccine, pathogenesis and the clinical diagnosis.Simultaneously, the antiserum(antisera) that epi-position of the present invention produces can react with the urease of natural helicobacter pylorus bacteria strain, shows that epi-position of the present invention can be applied to the causal organism diagnosis of albumen epi-position.

Sequence table

<160>38

 

<210>1

<211>390

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

<400>1

atgaaaaaga?ttagcagaaa?agaatatgtt?tctatgtatg?gccctactac?aggcgataaa 60

gtgagattgg?gcgatacaga?cttgatcgct?gaagtagaac?atgactacac?catttatggc 120

gaagagctta?aattcggtgg?cggtaaaacc?ctgagagaag?gcatgagcca?atccaacaac 180

cctagcaaag?aagaattgga?tctaatcatc?actaacgctt?taatcgtgga?ttacaccggt 240

atttataaag?cggatattgg?tattaaagat?ggcaaaatcg?ctggcattgg?taaaggcggt 300

aacaaagaca?tgcaagatgg?cgttaaaaac?aatcttagcg?taggtcctgc?tactgaagcc 360

ttagccggtg?aaggtttgat?cgtaactgct 390

<210>2

<211>420

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>2

aatcttagcg?taggtcctgc?tactgaagcc?ttagccggtg?aaggtttgat?cgtaactgct 60

ggtggtattg?acacacacat?ccacttcatt?tcaccccaac?aaatccctac?agcttttgca 120

agcggtgtaa?caaccatgat?tggtggcgga?actggtcctg?ctgatggcac?taatgcgact 180

actatcactc?caggcagaag?aaatttaaaa?tggatgctca?gagcggctga?agaatattct 240

atgaacttag?gtttcttggc?taaaggtaac?gcttctaacg?acgcgagctt?agtcgatcaa 300

attgaagctg?gtgcgattgg?ctttaaaatc?cacgaagact?ggggcaccac?tccttctgca 360

atcaatcatg?cgttagatgt?tgcagacaaa?tacgatgtgc?aagtcgctat?ccacacagac 420

<210>3

<211>441

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>3

atcaatcatg?cgttagatgt?tgcagacaaa?tacgatgtgc?aagtcgctat?ccacacagac 60

actttgaatg?aagccggttg?cgtggaagac?actatggcag?ctattgccgg?acgcactatg 120

cacactttcc?acactgaagg?tgctggcggc?ggacacgctc?ctgatattat?taaagtagct 180

ggtgaacaca?acattcttcc?cgcttccact?aaccccacta?tccctttcac?tgtgaataca 240

gaagcagaac?acatggacat?gcttatggtg?tgccaccact?tggataaaag?cattaaagaa 300

gatgttcagt?tcgctgattc?aaggatccgc?cctcaaacca?ttgcggctga?agacactttg 360

catgacatgg?ggattttctc?aatcaccagc?tctgactctc?aagctatggg?tcgtgtgggt 420

gaagttatca?ctagaacttg?g 441

<210>4

<211>648

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>4

attttctcaa?tcaccagctc?tgactctcaa?gctatgggtc?gtgtgggtga?agttatcact 60

agaacttggc?aaacagctga?caaaaacaaa?aaagaatttg?gccgcttgaa?agaagaaaaa 120

ggcgataacg?acaacttcag?gatcaaacgc?tacttgtcta?aatacaccat?taacccagcg 180

atcgctcatg?ggattagcga?gtatgtaggt?tctgtagaag?tgggcaaagt?ggctgacttg 240

gtattgtgga?gtcccgcatt?ctttggcgta?aaacccaaca?tgatcatcaa?aggcgggttc 300

attgcgttga?gtcaaatggg?tgacgcgaac?gcttctatcc?ctaccccaca?accagtttat 360

tacagagaaa?tgttcgctca?tcatggtaaa?gccaaatacg?atgcaaacat?cacttttgtg 420

tctcaagcgg?cttatgacaa?aggcattaaa?gaagaattag?ggcttgaaag?acaagtgttg 480

ccggtaaaaa?attgcagaaa?catcactaaa?aaagacatgc?aattcaacga?cactaccgct 540

cacattgaag?tcaatcctga?aacttaccat?gtgttcgtgg?atggcaaaga?agtaacttct 600

aaaccagcca?ataaagtgag?cttggcgcaa?ctctttagca?ttttctag 648

<210>5

<211>130

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>5

Met?Lys?Lys?Ile?Ser?Arg?Lys?Glu?Tyr?Val?Ser?Met?Tyr?Gly?Pro?Thr

1 5 10 15

Thr?Gly?Asp?Lys?Val?Arg?Leu?Gly?Asp?Thr?Asp?Leu?Ile?Ala?Glu?Val

20 25 30

Glu?His?Asp?Tyr?Thr?Ile?Tyr?Gly?Glu?Glu?Leu?Lys?Phe?Gly?Gly?Gly

35 40 45

Lys?Thr?Leu?Arg?Glu?Gly?Met?Ser?Gln?Ser?Asn?Asn?Pro?Ser?Lys?Glu

50 55 60

Glu?Leu?Asp?Leu?Ile?Ile?Thr?Asn?Ala?Leu?Ile?Val?Asp?Tyr?Thr?Gly

65 70 75 80

Ile?Tyr?Lys?Ala?Asp?Ile?Gly?Ile?Lys?Asp?Gly?Lys?Ile?Ala?Gly?Ile

85 90 95

Gly?Lys?Gly?Gly?Asn?Lys?Asp?Met?Gln?Asp?Gly?Val?Lys?Asn?Asn?Leu

100 105 110

Ser?Val?Gly?Pro?Ala?Thr?Glu?Ala?Leu?Ala?Gly?Glu?Gly?Leu?Ile?Val

115 120 125

Thr?Ala

130

<210>6

<211>140

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>6

Asn?Leu?Ser?Val?Gly?Pro?Ala?Thr?Glu?Ala?Leu?Ala?Gly?Glu?Gly?Leu

1 5 10 15

Ile?Val?Thr?Ala?Gly?Gly?Ile?Asp?Thr?His?Ile?His?Phe?Ile?Ser?Pro

20 25 30

Gln?Gln?Ile?Pro?Thr?Ala?Phe?Ala?Ser?Gly?Val?Thr?Thr?Met?Ile?Gly

35 40 45

Gly?Gly?Thr?Gly?Pro?Ala?Asp?Gly?Thr?Asn?Ala?Thr?Thr?Ile?Thr?Pro

50 55 60

Gly?Arg?Arg?Asn?Leu?Lys?Trp?Met?Leu?Arg?Ala?Ala?Glu?Glu?Tyr?Ser

65 70 75 80

Met?Asn?Leu?Gly?Phe?Leu?Ala?Lys?Gly?Asn?Ala?Ser?Asn?Asp?Ala?Ser

85 90 95

Leu?Val?Asp?Gln?Ile?Glu?Ala?Gly?Ala?Ile?Gly?Phe?Lys?Ile?His?Glu

100 105 110

Asp?Trp?Gly?Thr?Thr?Pro?Ser?Ala?Ile?Asn?His?Ala?Leu?Asp?Val?Ala

115 120 125

Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala?Ile?His?Thr?Asp

130 135 140

<210>7

<211>147

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>7

Ile?Asn?His?Ala?Leu?Asp?Val?Ala?Asp?Lys?Tyr?Asp?Val?Gln?Val?Ala

1 5 10 15

Ile?His?Thr?Asp?Thr?Leu?Asn?Glu?Ala?Gly?Cys?Val?Glu?Asp?Thr?Met

20 25 30

Ala?Ala?Ile?Ala?Gly?Arg?Thr?Met?His?Thr?Phe?His?Thr?Glu?Gly?Ala

35 40 45

Gly?Gly?Gly?His?Ala?Pro?Asp?Ile?Ile?Lys?Val?Ala?Gly?Glu?His?Asn

50 55 60

Ile?Leu?Pro?Ala?Ser?Thr?Asn?Pro?Thr?Ile?Pro?Phe?Thr?Val?Asn?Thr

65 70 75 80

Glu?Ala?Glu?His?Met?Asp?Met?Leu?Met?Val?Cys?His?His?Leu?Asp?Lys

85 90 95

Ser?Ile?Lys?Glu?Asp?Val?Gln?Phe?Ala?Asp?Ser?Arg?Ile?Arg?Pro?Gln

100 105 110

Thr?Ile?Ala?Ala?Glu?Asp?Thr?Leu?His?Asp?Met?Gly?Ile?Phe?Ser?Ile

115 120 125

Thr?Ser?Ser?Asp?Ser?Gln?Ala?Met?Gly?Arg?Val?Gly?Glu?Val?Ile?Thr

130 135 140

Arg?Thr?Trp

145

<210>8

<211>215

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>8

Ile?Phe?Ser?Ile?Thr?Ser?Ser?Asp?Ser?Gln?Ala?Met?Gly?Arg?Val?Gly

1 5 10 15

Glu?Val?Ile?Thr?Arg?Thr?Trp?Gln?Thr?Ala?Asp?Lys?Asn?Lys?Lys?Glu

20 25 30

Phe?Gly?Arg?Leu?Lys?Glu?Glu?Lys?Gly?Asp?Asn?Asp?Asn?Phe?Arg?Ile

35 40 45

Lys?Arg?Tyr?Leu?Ser?Lys?Tyr?Thr?Ile?Asn?Pro?Ala?Ile?Ala?His?Gly

50 55 60

Ile?Ser?Glu?Tyr?Val?Gly?Ser?Val?Glu?Val?Gly?Lys?Val?Ala?Asp?Leu

65 70 75 80

Val?Leu?Trp?Ser?Pro?Ala?Phe?Phe?Gly?Val?Lys?Pro?Asn?Met?Ile?Ile

85 90 95

Lys?Gly?Gly?Phe?Ile?Ala?Leu?Ser?Gln?Met?Gly?Asp?Ala?Asn?Ala?Ser

100 105 110

Ile?Pro?Thr?Pro?Gln?Pro?Val?Tyr?Tyr?Arg?Glu?Met?Phe?Ala?His?His

115 120 125

Gly?Lys?Ala?Lys?Tyr?Asp?Ala?Asn?Ile?Thr?Phe?Val?Ser?Gln?Ala?Ala

130 135 140

Tyr?Asp?Lys?Gly?Ile?Lys?Glu?Glu?Leu?Gly?Leu?Glu?Arg?Gln?Val?Leu

145 150 155 160

Pro?Val?Lys?Asn?Cys?Arg?Asn?Ile?Thr?Lys?Lys?Asp?Met?Gln?Phe?Asn

165 170 175

Asp?Thr?Thr?Ala?His?Ile?Glu?Val?Asn?Pro?Glu?Thr?Tyr?His?Val?Phe

180 185 190

Val?Asp?Gly?Lys?Glu?Val?Thr?Ser?Lys?Pro?Ala?Asn?Lys?Val?Ser?Leu

195 200 205

Ala?Gln?Leu?Phe?Ser?Ile?Phe

210 215

<210>9

<211>90

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>9

gatggcgtta?aaaacaatct?tagcgtaggt?cctgctactg?aagccttagc?cggtgaaggt 60

ttgatcgtaa?ctgctggtgg?tattgacaca 90

<210>10

<211>75

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>10

ggtggtattg?acacacacat?ccacttcatt?tcaccccaac?aaatccctac?agcttttgca 60

agcggtgtaa?caacc 75

<210>11

<211>90

<212>DNA

<213>11

 

<400>11

agcggtgtaa?caaccatgat?tggtggcgga?actggtcctg?ctgatggcac?taatgcgact 60

actatcactc?caggcagaag?aaatttaaaa 90

<210>12

<211>105

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>12

actatcactc?caggcagaag?aaatttaaaa?tggatgctca?gagcggctga?agaatattct 60

atgaacttag?gtttcttggc?taaaggtaac?gcttctaacg?acgcg 105

<210>13

<211>105

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>13

gcttctaacg?acgcgagctt?agtcgatcaa?attgaagctg?gtgcgattgg?ctttaaaatc 60

cacgaagact?ggggcaccac?tccttctgca?atcaatcatg?cgtta 105

<210>14

<211>90

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>14

cctcaaacca?ttgcggctga?agacactttg?catgacatgg?ggattttctc?aatcaccagc 60

tctgactctc?aagctatggg?tcgtgtgggt 90

<210>15

<211>30

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>15

Asp?Gly?Val?Lys?Asn?Asn?Leu?Ser?Val?Gly?Pro?Ala?Thr?Glu?Ala?Leu

1 5 10 15

Ala?Gly?Glu?Gly?Leu?Ile?Val?Thr?Ala?Gly?Gly?Ile?Asp?Thr

20 25 30

<210>16

<211>25

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>16

Gly?Gly?Ile?Asp?Thr?His?Ile?His?Phe?Ile?Ser?Pro?Gln?Gln?Ile?Pro

1 5 10 15

Thr?Ala?Phe?Ala?Ser?Gly?Val?Thr?Thr

20 25

<210>17

<211>30

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

<400>17

Ser?Gly?Val?Thr?Thr?Met?Ile?Gly?Gly?Gly?Thr?Gly?Pro?Ala?Asp?Gly

1 5 10 15

Thr?Asn?Ala?Thr?Thr?Ile?Thr?Pro?Gly?Arg?Arg?Asn?Leu?Lys

20 25 30

<210>18

<211>35

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>18

Thr?Ile?Thr?Pro?Gly?Arg?Arg?Asn?Leu?Lys?Trp?Met?Leu?Arg?Ala?Ala

1 5 10 15

Glu?Glu?Tyr?Ser?Met?Asn?Leu?Gly?Phe?Leu?Ala?Lys?Gly?Asn?Ala?Ser

20 25 30

Asn?Asp?Ala

35

<210>19

<211>35

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>19

Ala?Ser?Asn?Asp?Ala?Ser?Leu?Val?Asp?Gln?Ile?Glu?Ala?Gly?Ala?Ile

1 5 10 15

Gly?Phe?Lys?Ile?His?Glu?Asp?Trp?Gly?Thr?Thr?Pro?Ser?Ala?Ile?Asn

20 25 30

His?Ala?Leu

35

<210>20

<211>30

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>20

Pro?Gln?Thr?Ile?Ala?Ala?Glu?Asp?Thr?Leu?His?Asp?Met?Gly?Ile?Phe

1 5 10 15

Ser?Ile?Thr?Ser?Ser?Asp?Ser?Gln?Ala?Met?Gly?Arg?Val?Gly

20 25 30

<210>21

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>21

agcggtgtaa?caaccatgat?tggtggcgga?actggtcctg?ctgat 45

<210>22

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>22

ggtggcggaa?ctggtcctgc?tgatggcact?aatgcgacta?ctatc 45

<210>23

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>23

ggcactaatg?cgactactat?cactccaggc?agaagaaatt?taaaa 45

<210>24

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>24

actatcactc?caggcagaag?aaatttaaaa?tggatgctca?gagcg 45

<210>25

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>25

tggatgctca?gagcggctga?agaatattct?atgaacttag?gtttc 45

<210>26

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

<400>26

atgaacttag?gtttcttggc?taaaggtaac?gcttctaacg?acgcg 45

<210>27

<211>42

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>27

cctcaaacca?ttgcggctga?agacactttg?catgacatgg?gg 42

<210>28

<211>45

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>28

actttgcatg?acatggggat?tttctcaatc?accagctctg?actct 45

<210>29

<211>48

<212>DNA

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>29

attttctcaa?tcaccagctc?tgactctcaa?gctatgggtc?gtgtgggt?48

<210>30

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>30

Ser?Gly?Val?Thr?Thr?Met?Ile?Gly?Gly?Gly?Thr?Gly?Pro?Ala?Asp

1 5 10 15

<210>31

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>31

Gly?Gly?Gly?Thr?Gly?Pro?Ala?Asp?Gly?Thr?Asn?Ala?Thr?Thr?Ile

1 5 10 15

<210>32

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>32

Gly?Thr?Asn?Ala?Thr?Thr?Ile?Thr?Pro?Gly?Arg?Arg?Asn?Leu?Lys

1 5 10 15

<210>33

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>33

Thr?Ile?Thr?Pro?Gly?Arg?Arg?Asn?Leu?Lys?Trp?Met?Leu?Arg?Ala

1 5 10 15

<210>34

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>34

Trp?Met?Leu?Arg?Ala?Ala?Glu?Glu?Tyr?Ser?Met?Asn?Leu?Gly?Phe

1 5 10 15

<210>35

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>35

Met?Asn?Leu?Gly?Phe?Leu?Ala?Lys?Gly?Asn?Ala?Ser?Asn?Asp?Ala

1 5 10 15

<210>36

<211>14

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>36

Pro?Gln?Thr?Ile?Ala?Ala?Glu?Asp?Thr?Leu?His?Asp?Met?Gly

1 5 10

<210>37

<211>15

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>37

Thr?Leu?His?Asp?Met?Gly?Ile?Phe?Ser?Ile?Thr?Ser?Ser?Asp?Ser

1 5 10 15

<210>38

<211>16

<212>PRT

＜213〉helicobacter pylori (Helicobacter pylori)

 

<400>38

Ile?Phe?Ser?Ile?Thr?Ser?Ser?Asp?Ser?Gln?Ala?Met?Gly?Arg?Val?Gly

1 5 10 15

Claims (10)

1. a peptide species is following 1) or 2) polypeptide:

1) polypeptide of forming by the aminoacid sequence shown in the sequence in the sequence table 34;

2) with the aminoacid sequence of sequence in the sequence table 34 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have helicobacter Pylori urease epitope function by 1) polypeptides derived.

2. the encoding gene of the described polypeptide of claim 1.

3. encoding gene according to claim 2 is characterized in that: described encoding gene is 1), 2), 3) or 4):

1) DNA of sequence 25 in the sequence table;

2) polynucleotide of the protein sequence of sequence 34 in the code sequence tabulation;

3) under stringent condition with 1) or 2) gene recombination and the described proteic gene of coding claim 1.

4) with sequence table in sequence 25 homologys 80% or more and the Nucleotide of the polypeptide of the helicobacter Pylori urease epitope function of encoding.

4. the described polypeptide of claim 1 or its encoding gene application in the immunological reagent of preparation prevention or treatment helicobacter pylori infection.

5. application according to claim 4 is characterized in that: described immunological reagent is the epiposition vaccine preparation, is preferably multi-joint poly epiposition vaccine preparation.

6. the described polypeptide of claim 1 or its encoding gene application in the active medicine of preparation inhibition urease.

7. the described polypeptide of claim 1 or its encoding gene application in preparation helicobacter pylori vitro detection reagent

8. detect, prevent or treat the immunological reagent of helicobacter pylori infection, its activeconstituents comprises the described polypeptide of claim 1.

9. suppress the active medicine of urease, its activeconstituents comprises the described polypeptide of claim 1 and/or its antibody.

10. method of screening the described helicobacter Pylori urease B subunit of claim 1 neutrality B cell antigen epitope polypeptide mainly may further comprise the steps:

(1) adopt the truncation method segmentation to make up the UreB antigen of helicobacter pylori and carry out the expression of target protein, by immunoblotting assay, tentatively determine monoclonal antibody A1H10, B3D9, A3C10 at the epi-position scope;

(2) according to the determined helicobacter Pylori urease B subunit monoclonal antibody of above-mentioned steps (1) A1H10, B3D9, A3C10 at the epitope region, carry out for the second time and brachymemma segmentation for the third time makes up UreB antigen, with monoclonal antibody A1H10, B3D9, A3C10 at epitope accurately be positioned at the UreB certain location;

(3) epitope that chemosynthesis above-mentioned steps (2) is identified, by indirect elisa method, with further determine anti-helicobacter pylori urease B subunit monoclonal antibody A1H10, B3D9, A3C10 at epitope.

Images