CN101863965B - Helicobacter pylori urease B antigenic epitope polypeptide and application thereof - Google Patents
Helicobacter pylori urease B antigenic epitope polypeptide and application thereof Download PDFInfo
- Publication number
- CN101863965B CN101863965B CN2010101822522A CN201010182252A CN101863965B CN 101863965 B CN101863965 B CN 101863965B CN 2010101822522 A CN2010101822522 A CN 2010101822522A CN 201010182252 A CN201010182252 A CN 201010182252A CN 101863965 B CN101863965 B CN 101863965B
- Authority
- CN
- China
- Prior art keywords
- helicobacter pylori
- gst
- sequence
- gly
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention discloses a helicobacter pylori urease B antigenic epitope polypeptide and application thereof. The amino acid sequence of the antigenic epitope polypeptide is the sequence 37 in a sequence table, and the encoding gene sequence of the antigenic epitope polypeptide is the sequence 28 in the sequence table. The antigenic epitope polypeptide can stimulate organisms to generate helicobacter pylori resistant protective immune response so as to enhance the suppression of the helicobacter pylori infection, improve the capacity of removing germs of the organisms, and play a promoting role in development of corresponding vaccines, research on pathogenic mechanism, and clinical diagnosis.
Description
Technical field
The present invention relates to a kind of helicobacter pylori (Helicobacter pylori) urease B subunit (UreB) protein B cell antigen epitope polypeptide and application thereof.
Background technology
Nineteen eighty-two Australia scholar Warren separates from chronic active gastritis patient gastric mucosa first with Marshall and turns out helicobacter pylori (Helicabucter pylori, H.pylori), the New Times of stomach microbe research has been opened in the discovery of this bacterium.Helicobacter pylori distributes very extensive, and the crowd infection rate is up to about 50% in the world wide.Confirmed already; Helicobacter pylori infection be chronic chronic gastritis, stomach ulcer, duodenal ulcer main diseases because of, the persistent infection of helicobacter pylori is also closely related with the generation of adenocarcinoma of stomach (gastric adenocarcinoma) and gastric lymphoma (gastric lymphoma).1994, the World Health Organization was decided to be I class carcinogen (Type I carcinogen) with it.
Treatment to helicobacter pylori infection mainly is to adopt two kinds of microbiotic associating proton pump inhibitors now; Yet; This treatment means has many shortcomings; As spend too high, patient's compliance difference and the high risk that produces the drug resistance bacterial strain etc., especially antibiotic therapy can not prevent to infect once again.So, generally believe that at present vaccine is the effective means of inner control helicobacter pylori infection in the world.The full bacterium composition of helicobacter pylori is used in the research of early stage helicobacter pylori vaccine mostly, exists weak effect, is difficult for shortcoming such as stdn.The antigenic research of helicobacter pylori vaccine at present concentrates on the antigen that has immanoprotection action in the helicobacter pylori.On mouse model, confirm multiple Heliobacter pylori antigen at present, comprised VacA (VacA), cytotoxin-associated protein (CagA), heat shock protein(HSP) A and B (HspA and HspB), urease and katalase etc.Wherein urease albumen is regarded as the most promising helicobacter pylori vaccine candidate, is to study maximum one.Urease not only provides provide protection to helicobacter pylori field planting under stomach inner acidic environment, and is a kind of conservative protein in the helicobacter pylori, and the conservative property between different strains reaches more than 98%.Existing a large amount of experimentation on animalies have proved its security and validity as vaccine antigen.Urease comprises urease A (UreA) and two structure subunits of B (UreB), and wherein UreB is the major function unit of urease, contains the avtive spot of urease, and its protectiveness is superior to UreA.
Vaccine is the most cost-effective way of sense of control metachromia disease, and vaccine inoculation can stimulate the body generation to be different from the specific immune response that natural infection causes, and can reach the purpose that helicobacter pylori infection is perhaps treated in prevention.The helicobacter pylori infection of urease vaccine prevention is at present succeedd on many animal models, and external a plurality of study group report that oral helicobacter Pylori urease can prevent mouse infection cat Helicobacter pylori.Up to now; Research to helicobacter pylori vaccine mainly is to adopt the antigenic method of simulating nature to carry out the development of protein vaccine both at home and abroad; Certain antigen molecule of single expression or the several antigen molecules of amalgamation and expression; Also or with antigen molecule and mucosal adjuvant amalgamation and expression, can partly obtain the immanoprotection action in the certain period.At present, epiposition vaccine has become the direction of development infection and malignant tumour vaccine, and has shown special advantages at aspects such as HIV, malaria, hepatitis B virus, tumours.Given this, on epitope levels, selecting and recombinate and design vaccine, may be the vaccine form of a kind of effective prevention and treatment helicobacter pylori infection.Utilize the epi-position of helicobacter pylori protective antigen to design vaccine; Express the specificity epitope on the protective antigen through single or polyphone; And be aided with the adjuvant that can effectively bring out mucosa-immune come exciter originally more by force, immunne response more special, when being different from natural infection; Immunological tolerance might be broken, thereby the purpose of prevention or treatment helicobacter pylori infection can be reached.
Had a large amount of experiments to show, urease B subunit (UreB) not only has prophylactic effect to helicobacter pylori infection, but also can remove the helicobacter pylori that has infected in the body to a certain extent.Discover that the monoclonal antibody to the different epi-positions of UreB can suppress the activity of urease; Thereby the infection of blocking-up helicobacter pylori; But the activity with complete urease immune animal can not the good restraining urease thereby can not stop the field planting of helicobacter pylori in stomach fully.
Summary of the invention
The purpose of this invention is to provide a kind of helicobacter pylori (Helicobacter pylori) urease B subunit (UreB) protein B cell antigen epitope polypeptide and application thereof.
Helicobacter Pylori urease B subunit neutrality B cell antigen epitope polypeptide provided by the invention derives from helicobacter Pylori urease B subunit (UreB), and name is called UP38,, be following 1) or 2) polypeptide:
1) polypeptide of forming by the aminoacid sequence shown in the sequence in the sequence table 37;
2) with the aminoacid sequence of sequence in the sequence table 37 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have helicobacter Pylori urease epitope function by 1) polypeptides derived.
Sequence 37 is made up of 15 amino-acid residues in the sequence table, derives from the last 181-195 amino acids residue of helicobacter Pylori urease B subunit (UreB).
The replacement of said one or several amino-acid residue and/or disappearance and/or interpolation can be replacement and/or the disappearance and/or the interpolation of 1-10 amino-acid residue; The replacement of said one or several amino-acid residue and/or disappearance and/or interpolation can occur in outside the said structure territory.
The encoding sox of above-mentioned epitope polypeptide also belongs to protection scope of the present invention,, said encoding sox is 1), 2), 3) or 4):
1) DNA of sequence 28 in the sequence table;
2) polynucleotide of the protein sequence of sequence 37 in the code sequence tabulation;
3) under stringent condition with 1) or 2) gene recombination and the said proteic gene of coding claim 1.
4) with sequence table in sequence 28 homologys 80% or more and the Nucleotide of the polypeptide of the helicobacter Pylori urease epitope function of encoding.
Above-mentioned stringent condition can be that (or 0.1 * SSC), the solution of 0.1%SDS is hybridized under 65 ℃ and washed film with 0.1 * SSPE in DNA or RNA hybrid experiment.
Sequence 28 in the sequence table is made up of 45 Nucleotide, is encoding sequence from the 1st to 45 Nucleotide of 5 ' end.
The present invention also provides the immunological reagent of detection, prevention or treatment helicobacter pylori infection; Its activeconstituents comprises above-mentioned epitope polypeptide; Form the poly epiposition vaccine preparations that join like this immunological reagent by the epitope polypeptide shown in the sequence 31 in the epitope polypeptide shown in the sequence 34, the sequence table in above-mentioned epitope polypeptide and the sequence table, the activeconstituents of this immunological reagent also can be separately the epitope polypeptide shown in the sequence 37 in the above-mentioned sequence table more.The present invention also provides the active medicine that suppresses urease, and its activeconstituents comprises above-mentioned epitope polypeptide and/or its antibody.Like this medicine of forming by the epitope polypeptide shown in the sequence 31 in the epitope polypeptide shown in the sequence 34, the sequence table in above-mentioned epitope polypeptide and the sequence table; This active constituents of medicine also can be separately above-mentioned epitope polypeptide and/or its antibody; The antibody that this antibody obtains for the vitro culture hybridoma cell line.
The present invention also provides the screening method of above-mentioned helicobacter Pylori urease B subunit neutrality B cell antigen epitope polypeptide, mainly may further comprise the steps:
(1) the UreB antigen with helicobacter pylori adopts truncation method segmentation structure and carries out the expression of target protein, through immunoblotting assay, tentatively confirms the epi-position scope that monoclonal antibody A1H10, B3D9, A3C10 are directed against;
(2) the epitope region that is directed against according to the determined helicobacter Pylori urease B subunit monoclonal antibody of above-mentioned steps (1) A1H10, B3D9, A3C10; Carry out the second time and the structure of brachymemma segmentation for the third time UreB antigen, the epitope that monoclonal antibody A1H10, B3D9, A3C10 are directed against accurately is positioned at the UreB certain location;
(3) chemosynthesis above-mentioned steps (2) is identified the epitope of coming out, through indirect elisa method, further to confirm the epitope that anti-helicobacter pylori urease B subunit monoclonal antibody A1H10, B3D9, A3C10 are directed against.
The method that the present invention uses molecular biology binding molecule immunological experiment to identify, screening have obtained the epitope polypeptide that is made up of 15 amino-acid residues, and be economical, effectively, for the screening of epitope provides reference.The present invention has decided the basis for the exploitation honor of novel many couplet poly epiposition vaccine, also for bringing new thinking based on the exploitation of the causal organism diagnostic kit of albumen epi-position and the development of treatment preparation.The epitope that obtains has great importance to the H.pylori Study on Pathogenesis, helps the infection of more effective prevention and control helicobacter pylori.
Antigen epitope polypeptide provided by the invention has good immunogenicity; In mouse model, can induce the specific humoral immune response that produces to this B cell epitope; The antiserum(antisera) that produces not only can in the activity of urease, and can also with the urease generation specific antigen-antibody reaction of the natural bacterial strain of H.pylori.Adopt the serological analysis method to confirm to have produced antibody among the clinical infection helicobacter pylori patients serum simultaneously to this UreB epitope.
Antigen epitope polypeptide provided by the invention excites the antibody that produces in the mouse body can suppress urease activity, for the research of urease epitope is had laid a good foundation.Antigen epitope polypeptide provided by the invention can stimulate body to produce the anti-helicobacter pylori protective immunological reaction; And can avoid producing the conformational epitope specific antibody; Thereby strengthen the inhibition of helicobacter pylori infection and remove effect, playing good pushing effect in the research of the research and development of corresponding vaccine, pathogenesis and the clinical diagnosis.The epitope of the protective immunological reaction of the anti-H.pylori of excitating organism of the present invention is in vitro detection and the of great value application that has that produces on the immunoprotection.
Description of drawings
(numeral is pairing position in UreB for the corresponding site plan of the different brachymemma UreB fragments of Fig. 1; White bars is represented with monoclonal antibody A1H10, B3D9 or A3C10 western blot reaction negative, and grey bar is represented with monoclonal antibody A1H10, B3D9 or A3C10western blot reaction positive)
Each brachymemma antigen pcr amplification result of Fig. 2 helicobacter pylori (H.pylori) urease B subunit; Wherein,
A: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (400bp) of goal gene UP1; Swimming lane 3 is the pcr amplification product (430bp) of goal gene UP2; Swimming lane 4 is the pcr amplification product (450bp) of goal gene UP3; Swimming lane 5 is the pcr amplification product (660bp) of goal gene UP4;
B: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (100bp) of goal gene U21; Swimming lane 3 is the pcr amplification product (85bp) of goal gene U22; Swimming lane 4 is the pcr amplification product (100bp) of goal gene U23; Swimming lane 5 is the pcr amplification product (115bp) of goal gene U24; Swimming lane 6 is the pcr amplification product (115bp) of goal gene U25; Swimming lane 7 is the pcr amplification product (100bp) of goal gene U26.
C: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (60bp) of goal gene GST-UP32; Swimming lane 3 is the pcr amplification product (60bp) of goal gene GST-UP33; Swimming lane 4 is the pcr amplification product (60bp) of goal gene GST-UP34; Swimming lane 5 is the pcr amplification product (60bp) of goal gene GST-UP36; Swimming lane 6 is the pcr amplification product (60bp) of goal gene GST-UP38; Swimming lane 7 is the pcr amplification product (60bp) of goal gene GST-UP39
D: swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker); Swimming lane 2 is the pcr amplification product (330bp) of goal gene GST-UP31; Swimming lane 3 is the pcr amplification product (330bp) of goal gene GST-UP35; Swimming lane 4 is the pcr amplification product (330bp) of goal gene GST-UP37; The result shows that the PCR clonal expansion of each goal gene is respond well.
Fig. 3 is each brachymemma antigen gene reorganization bacterium TPTG abduction delivering SDS-PAGE electrophorogram of helicobacter pylori (H.pylori) urease B subunit; Wherein,
A: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the empty carrier bacterium; Swimming lane 3 is induced 4h for the reorganization bacterium of expressing the UP1 gene; Swimming lane 4 is induced 4h for expressing the UP2 gene recombination bacterium; Swimming lane 5 is induced 4h for expressing the UP3 gene recombination bacterium; Swimming lane 6 is induced 4h for expressing the UP4 gene recombination bacterium;
B: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium UP21; Swimming lane 5 is induced 4h for gene recombination bacterium UP22; Swimming lane 6 is induced 4h for gene recombination bacterium UP23; Swimming lane 7 is induced 4h for gene recombination bacterium UP24; Swimming lane 8 is induced 4h for gene recombination bacterium UP25; Swimming lane 9 is induced 4h for gene recombination bacterium UP26;
C: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium GST-UP32; Swimming lane 5 is induced 4h for gene recombination bacterium GST-UP33; Swimming lane 6 is induced 4h for gene recombination bacterium GST-UP34; Swimming lane 7 is induced 4h for gene recombination bacterium GST-UP36; Swimming lane 8 is induced 4h for gene recombination bacterium GST-UP38; Swimming lane 9,10 is induced 4h for gene recombination bacterium GST-UP39;
D: swimming lane 1 is protein molecular weight standard (Marker); Swimming lane 2 is induced 4h for the host bacterium; Swimming lane 3 is induced 4h for the empty carrier bacterium; Swimming lane 4 is induced 4h for gene recombination bacterium GST-UP31; Swimming lane 5 is induced 4h for gene recombination bacterium GST-UP35; Swimming lane 6 is induced 4h for gene recombination bacterium GST-UP37
Fig. 4 is the UreB fragment of brachymemma and monoclonal antibody A1H10, B3D9, A3C10 western blot figure; Wherein, the brachymemma antigen (UP1, UP2, UP3 and UP4) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay of the A partitioned representation first time; (1) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody A1H10; (2) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody B3D9; (3) the immunoblotting result of UP1, UP2, UP3 and UP4 and monoclonal antibody A3C10;
B is the brachymemma antigen (UP21, UP22, UP23, UP24, UP25 and UP26) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay of partitioned representation for the second time; (1) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody A1H10; (2) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody B3D9; (3) the immunoblotting result of UP21, UP22, UP23, UP24, UP25 and UP26 and monoclonal antibody A3C10;
C is the brachymemma antigen (GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38 and GST-UP39) and monoclonal antibody A1H10, B3D9 or A3C10 immunoblotting assay of partitioned representation for the third time; (1) the immunoblotting result of GST-UP31, GST-UP32, GST-UP33 and monoclonal antibody A1H10; (2) the immunoblotting result of GST-UP34, GST-UP35, GST-UP36 and monoclonal antibody B3D9; (3) the immunoblotting result of GST-UP37, GST-UP38, GST-UP39 and monoclonal antibody A3C10
Fig. 5 analyzes with A1H10, B3D9, A3C10 indirect ELISA respectively for merging epitope peptide GST-UP32, GST-UP35, GST-UP38.
To be monoclonal antibody A1H10, B3D9, A3C10 analyze the indirect ILISA of the identification of synthetic epitope peptide Fig. 6
Fig. 7 is the identification of epitope peptide to the H.pylori patients serum.
A:H.pylori patients serum and the ELISA reaction of merging epi-position GST-UP32, GST-UP35 and GST-UP38; The ELISA reaction of B:H.pylori patients serum and synthetic epitope peptide UP32, UP35 and UP38.
Fig. 8 merges epitope peptide serum to merging epitope peptide, synthetic peptide, the proteic identification of different natural H.pylori bacterial strain urease B subunit for mouse-anti; The anti-epi-position serum of A is analyzed with the Western blot of corresponding fusogenic peptide; The anti-epi-position serum of B reacts with the ELISA of corresponding synthetic peptide; Anti-epi-position serum of C and the reaction of natural H.pylori bacterial strain urease B subunit protein ELISA.
Fig. 9 is that monoclonal antibody A1H10, B3D9, A3C10 and the anti-epi-position that merges resist inhibition helicobacter Pylori urease activity experiment more.
Embodiment
Method among the following embodiment if no special instructions, is ordinary method.
Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.
The evaluation of embodiment 1, anti-helicobacter pylori urease B subunit monoclonal antibody A1H10, B3D9, A3C10 antigen recognition epi-position
Through the screening of brachymemma partitioned representation urease B fragment repeatedly epitope, each time blocked fragment and concerned as shown in Figure 1 in the position of helicobacter Pylori urease B subunit.
One, the partitioned representation and the preliminary evaluation of the epitope first time of UreB truncated protein
1, the helicobacter pylori UreB segmentation antigen UP1 (sequence 5) of brachymemma, UP2 (sequence 6), UP3 (sequence 7), UP4's (sequence 8) is recombinant expressed:
1) cultivation of helicobacter pylori (Helicobacter pylori)
Helicobacter pylori (Helicobacter pylori) 26695 (ATCC No.700392) is adopted solid culture, and substratum is: jejunum campylobacter bacterio-agar matrix (Chinese dysentery control agent delivery research centre, Shanghai) 43g/L, defiber sheep blood (by market purchasing live sheep after carotid artery is got blood with promptly getting after the granulated glass sphere defiber processing) 50ml/L, microbiotic PXB (available from Merck) 0.38mg/L, vancomyein (available from Amresco) 10mg/L and amphotericin B (available from Sigma) 5mg/L.37 ℃ of little aerobic environment (5%O
2, 10%CO
2, 85%N
2) the middle 48-72hr that cultivates, improved broth medium is collected thalline.
2) preparation of helicobacter pylori (Helicobacter pylori) genomic dna
Helicobacter pylori (Helicobacter pylori) 26695 extracting genome DNA are extracted the test kit specification sheets according to promega company bacterial genomes and are carried out.
3) primer sequence design
The genome sequence of the H.pylori international standard strain 26695 of having announced according to Genbank finds the gene order (gi:21637177) of UreB; Utilize 4 pairs of Auele Specific Primers of Primer5.0 software design design; In the upstream and downstream primer, add SacI and Hind III restriction enzyme site (underscore shows restriction enzyme site) respectively, their sequence is as follows:
The primer of the encoding sox (sequence 1 in the sequence table) of amplification UP1: UP1-F:C
GAGCTCAAAAAGAT
TAGCAGAAAAG;UP1-R:CCC
AAGCTTTTAAGCAGTTACGATC。
The primer of the encoding sox (sequence 2 in the sequence table) of amplification UP2: UP2-F:C
GAGCTCAATCTTAG
CGTAGGTCC;UP2-R:CCC
AAGCTTTTAGTCTGTGTGGATAG。
The primer of the encoding sox (sequence 3 in the sequence table) of amplification UP3: UP3-F:C
GAGCTCATCAATC
ATGCGTTAG;UP3-R:CCC
AAGCTTTTACCAAGTTCTAGTGATA。
The primer of the encoding sox (sequence 4 in the sequence table) of amplification UP4: UP4-F:
GAGCTCATTTTCTCA
ATCACCAG;UP4-R:CCC
AAGCTTGAAAATGCTAAAGAGTT。
4) pcr amplification goal gene
26695 pnca gene group DNA are template with helicobacter pylori (Helicobacter pylori); Add corresponding primer; Obtain the encoding sox of UreB segmentation fragment UP1 (encoding sox has the nucleotide sequence of sequence 1 in the sequence table), UP2 (nucleotide sequence of sequence 2 in the encoding sox ordered list), UP3 (encoding sox has the nucleotide sequence of sequence 3 in the sequence table), UP4 (encoding sox has the nucleotide sequence of sequence 4 in the sequence table) through 30 PCR cyclic amplifications; Show that through 1.0% agarose electrophoresis each purpose fragment is consistent with the theoretical size of amplification gene.
The pcr amplification result of each section goal gene is shown in A among Fig. 2; The PCR clonal expansion effect that shows goal gene UP1, UP2, UP3, UP4 encoding sox is better; Amplified the purpose fragment of about 400bp, 430bp, 450bp, 660bp size respectively, shown that through order-checking sequence is correct.
2, the structure and the expression of segmentation antigen UP1, UP2, UP3, UP4 expression plasmid
Use SacI and Hind III double digestion and Transformed E .coli DH5 α after the plasmid pET-28a (+) (available from Merck) of enzyme double digestion is connected equally (available from sky root biochemistry) respectively behind the PCR product UP1 that step 1 amplification is obtained, UP2, UP3, the UP4 encoding sox purifying; Be to carry out the enzyme evaluation of cutting and check order after the screening of medium of 50 μ g/ml kalamycin resistances at final concentration, enzyme cut and checked order identify and show correct recombinant vectors called after pET-UP1, pET-UP2, pET-UP3, pET-UP4.Extract recombinant plasmid pET-UP1, pET-UP2, pET-UP3, pET-UP4 and transformed into escherichia coli BL21 (biochemical) strain available from the sky root; After being the screening of medium of 50 μ g/ml kalamycin resistances at final concentration; Plasmid carries out enzyme and cuts evaluation, obtains identifying the reorganization bacterium of errorless expression UP1, UP2, UP3 or UP4.Get and identify that errorless reorganization bacterium is inoculated in 5ml and contains in the LB nutrient solution of kantlex 37 ℃ of shaking table overnight cultures.Next day, the reorganization bacterium of incubated overnight changeed in 1: 100 ratio kind contain in the fresh LB nutrient solution of kantlex in 5ml, 37 ℃, 200rpm is cultured to OD
600Value is about at 0.6 o'clock and adds IPTG to final concentration 1.0mM, and inducing culture 4h gets the 1ml culture; Centrifugal collection thalline, with 80 μ l PBS (0.01mol/L, pH7.4) resuspended; Add 5 times of SDS-PAGE sample-loading buffers of 20 μ l (contain in the 1L solution: 15.1g Tris alkali, the 94g glycocoll, 5gSDS); Boiled 5 minutes in the boiling water after being mixed, centrifugal receipts supernatant carries out SDS-PAGE and analyzes.Simultaneously, be contrast with the e. coli bl21 reorganization bacterium that changes pET-28a (+).SDS-PAGE detects the Recombinant Protein Expression situation, the screening efficient expression strain.
The abduction delivering qualification result is shown in A among Fig. 3; The result shows the differential protein band of expression that UP1 has at the about 28kD of relative molecular mass place at the about 21kD of relative molecular mass, UP4 at the about 20kD of relative molecular mass, UP3 at the about 18kD of relative molecular mass, UP2, and is consistent with the fusion rotein size of expection.
3, Western blot identifies the epi-position region of A1H10, B3D9, the identification of A3C10 monoclonal antibody
Western blot concrete operations step is following:
According to the method for step 2, the reorganization bacterium of culture expression UP1, UP2, UP3 or UP4 prepares the protein electrophoresis sample respectively, carries out 15% SDS-PAGE electrophoresis.Electrophoresis finishes, and 50V voltage is wet to be changeed on 4h to the NC film.Add the PBST room temperature sealing 2h that contains 5% skim-milk, PBST washes 3 times, each 5min.Three strain mouse anti UreB monoclonal antibody B3D9 (biotechnology communication, 2007 that add dilution in 1: 5000 respectively; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), A1H10 (biotechnology communication, 2007; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), A3C10 (biotechnology communication, 2007; 18 (2): 246-8, Biologic Engineering Inst., Academy of Millitary Medical Sciences of P.L.A provided in the term of protection of patent), room temperature is placed 1h, and PBST washes 3 times.The goat anti-mouse igg (Sigma) that adds the HRP mark of dilution in 1: 50000, room temperature is placed 1h, and PBST washes 3 times.The DAB colour developing.
Western blot result sees A among Fig. 4; The immunoblotting result shows that the antigen and antibody specific association reaction has taken place for reorganization UP2 albumen and mouse anti UreB monoclonal antibody A1H10 and B3D9; The antigen and antibody specific association reaction has taken place in reorganization UP3 and UP4 albumen and mouse anti UreB monoclonal antibody A3C10; Explained that the epitope that monoclonal antibody A1H10 and B3D9 were directed against is positioned at UreB albumen UP2, the epitope that monoclonal antibody A3C10 was directed against is positioned at UP3 and the synergetic position of UP4.
For the epitope with each section of three strain monoclonal antibodies identification UreB is limited to than in the little scope in school, we will express again for the first time can be carried out secondary expression and evaluation by the section of this three strains monoclonal antibody identification.
Two, the partitioned representation and the further evaluation of the epitope second time of UreB truncated protein
The UreB truncated protein the second time partitioned representation and the method identified of the used method of the further evaluation of epitope and partitioned representation for the first time similar, used expression vector is PGEX-4T-2 (available from Amersham).
Segmentation for the second time is divided into six sections UreB truncated protein UP21 (sequence 15 in the sequence table), UP22 (sequence 16 in the sequence table), UP23 (sequence 17 in the sequence table), UP24 (sequence 18 in the sequence table), UP25 (sequence 19 in the sequence table) and UP26 (sequence 20 in the sequence table); Each encoding sox primer table of expressing UP21, UP22, UP23, UP24, UP25, UP26 is following; In the upstream and downstream primer, add EcoR I and Xho I restriction enzyme site respectively, underscore shows restriction enzyme site.
The primer of amplification UP21 encoding sox (sequence 9 in the sequence table) is right: UP21F:
CCG
GAATTCTAGATGGCGTTAAAAA;UP21R:CCG
CTCGAGTCATGTGTCAATACCA。
The primer of amplification UP22 encoding sox (sequence 10 in the sequence table) is right: UP22F:CCG
GAATTCTCGGT
GGTATTGACA;UP22R:CCG
CTCGAGTTAGGTTGTTACACCGCTT。
The primer of amplification UP23 encoding sox (sequence 11 in the sequence table) is right: UP23F:CCG
GAATTCTAAG
CGGTGTAACAAC;UP23R:CCG
CTCGAGTTATTTTAAATTTCTTCTG。
The primer of amplification UP24 encoding sox (sequence 12 in the sequence table) is right: UP24F:CCG
GAATTCTAACT
ATCACTCCAGGCA;UP24R:CCG
CTCGAGTTACGCGTCGTTAGAAG。
The primer of amplification UP25 encoding sox (sequence 13 in the sequence table) is right: UP25F:CCG
GAATTCTAGCT
TCTAACGACGCG;UP25R:CCG
CTCGAGTTATAACGCATGATTGATT。
The primer of amplification UP26 encoding sox (sequence 14 in the sequence table) is right: UP26F:
CG
GAATTCTACCTCAAACCATTGCGGC;UP26R:
CCG
CTCGAGTTAACCCACACGACCCATAG。
The pcr amplification result amplifies UP21, UP22, UP23, UP24, UP25, UP26 encoding sox respectively shown in Fig. 2 B, the purpose fragment of the about 100bp of their size, 85bp, 100bp, 115bp, 115bp, 100bp size.
According to the method for the step 2 in the step 1 recombinant vectors of construction expression UP21, UP22, UP23, UP24, UP25 or UP26 respectively, the carrier that just will set out is replaced pET-28a (+) by PGEX-4T-2.Evaluation shows correct recombinant vectors called after PGEX-UP21, PGEX-UP22, PGEX-UP23, PGEX-UP24, PGEX-UP25, PGEX-UP26.According to the described method abduction delivering of the step 2 of step 1 UP21, UP22, UP23, UP24, UP25 or UP26 albumen, and carry out SDS-PAGE and detect the Recombinant Protein Expression situation, the screening efficient expression strain.
Protein induced expression qualification result shows that gene recombination bacterium through after inducing, has the protein expression band of increase at about 28KDa~29KDa place shown in B among Fig. 3, consistent with target protein molecular weight size.
Carrying out UP21, UP22, UP23, UP24, UP25 or UP26 albumen Western blot with reference to the method for the step 3 of step 1 detects; Western blot result is shown in B among Fig. 4; Reorganization UP23 albumen can be by mouse anti UreB monoclonal antibody A1H10 identification, and UP24 albumen can be by mouse anti UreB monoclonal antibody B3D9 identification, and UP26 albumen can be discerned by mouse anti UreB monoclonal antibody A3C10; Specific reaction band appears; Show that the epitope that monoclonal antibody A1H10 is directed against is positioned at UreB albumen UP23, the epitope that monoclonal antibody B3D9 was directed against is positioned at UP24, and the epitope that monoclonal antibody A3C10 was directed against is positioned at UP26.
For the epitope with each section of three strain monoclonal antibodies identification UreB accurately navigates to littler scope, carry out littler segmentation evaluation with being accredited as for the second time the male fragment equally.
Three, the accurate location of the partitioned representation for the third time of UreB truncated protein and epitope
Segmentation for the third time is divided into nine sections UreB truncated proteins; It is following to express the primer table; In GST-UP32 (the UP32 sequence is a sequence 31 in the sequence table), GST-UP33 (the UP33 sequence is a sequence 32 in the sequence table), GST-UP34 (the UP34 sequence is a sequence 33 in the sequence table), GST-UP36 (the UP36 sequence is a sequence 35 in the sequence table), GST-UP38 (the UP38 sequence is a sequence 37 in the sequence table), GST-UP39 (the UP39 sequence is a sequence 38 in the sequence table) upstream and downstream primer, add EcoR I and Xho I restriction enzyme site respectively, in GST-UP31 (the UP31 sequence is a sequence 30 in the sequence table), GST-UP35 (the UP35 sequence is a sequence 34 in the sequence table), GST-UP37 (the UP37 sequence is a sequence 36 in the sequence table) upstream and downstream primer, add BstB I and Xho I restriction enzyme site (underscore shows restriction enzyme site) respectively
The primer of amplification GST-UP31 encoding sox (the UP31 coding gene sequence is a sequence 21 in the sequence table) is right: GST-UP31F:
GAAAATG
TTCGAAGATCGTTTATGTCA;GST-UP31R:
CCG
CTCGAGATCAGCAGGACCAGTTCCGCCACCAATCATGGTTGTTACACCGCTACGCG
GAACCAGATC。
The primer of amplification GST-UP32 encoding sox (the UP32 coding gene sequence is a sequence 22 in the sequence table) is right: GST-UP32F:
CG
GAATTCTAGGTGGCGGAACTGGTCCTGCTGATGGC;GST-UP32R:
CCG
CTCGAGTCAGATAGTAGTCGCATTAGTGCCATCAGCAGGAC。
The primer of amplification GST-UP33 encoding sox (the UP33 coding gene sequence is a sequence 23 in the sequence table) is right: GST-UP33F:
CCG
GAATTCTCGGCACTAATGCGACTACTATCACTCCAGGC;GST-UP33R:
CCG
CTCGAGCTATTTTAAATTTCTTCTGCCTGGAGTGAT。
The primer of amplification GST-UP34 encoding sox (the UP34 coding gene sequence is a sequence 24 in the sequence table) is right: GST-UP34F:
CCG
GAATTCTGACTATCACTCCAGGCAGAAGAAATTTAAAA;
GST-UP34R:CCG
CTCGAGTTACGCTCTGAGCATCCATTTTAAATTTCT。
The primer of amplification GST-UP35 encoding sox (the UP35 coding gene sequence is a sequence 25 in the sequence table) is right: GST-UP35F:
GAAAATGTTCGAAGATCGTTTATGTCA;GST-UP35R:
CCGCTCGAGGAAACCTAAGTTCATAGAATATTCTTCAGCCGCTCTGAGCATCCAACGCG
GAACCAGATC。
The primer of amplification GST-UP36 encoding sox (the UP36 coding gene sequence is a sequence 26 in the sequence table) is right: GST-UP36F:
CG
GAATTCTAATGAACTTAGGTTTCTTGGCTAAAGGTAACGC;
GST-UP36R:CCG
CTCGAGTTACGCGTCGTTAGAAGCGTTACCTTTA。
The primer of amplification GST-UP37 encoding sox (the UP37 coding gene sequence is a sequence 27 in the sequence table) is right: GST-UP37F:
GAAAATGTTCGAAGATCGTTTATGTCA;GST-UP37R:
CCGCTCGAGCCCCATGTCATGCAAAGTGTCTTCAGCCGCAATGGTTTGAGGACGCGGAA
CCAGATC。
The primer of amplification GST-UP38 encoding sox (the UP38 coding gene sequence is a sequence 28 in the sequence table) is right: GST-UP38F:
CG
GGAATTCTAACTTTGCATGACATGGGGATTTTCTCAATCAC;GST-UP38R:
CCG
CTCGAGTTAAGAGTCAGAGCTGGTGATTGAGAAAATCC。
The primer of amplification GST-UP39 encoding sox (the UP39 coding gene sequence is a sequence 29 in the sequence table) is right: GST-UP39F:
G
GAATTCTAATTTTCTCAATCACCAGCTCTGACTCTCAAGCTATGGG;GST-UP39R:
CCG
CTCGAGTTAACCCACACGACCCATAGCTTGA。
GST-UP32, GST-UP33, GST-UP34, GST-UP36, GST-UP38, GST-UP39 directly anneal synthetic with two long primers, GST-UP31, GST-UP35, GST-UP37 are template with PGEX-4T-2, obtain with conventional PCR method amplification.
The pcr amplification result is shown in Fig. 2 C, 2D; Amplified the specificity purpose fragment of the about 60bp size of encoding sox of GST-UP32, GST-UP33, GST-UP34, GST-UP36, GST-UP38, GST-UP39, the encoding sox that amplification obtains GST-UP31, GST-UP35, GST-UP37 is the big or small specificity purpose fragment of about 330bp.
According to the method for the step 2 in the step 1 recombinant vectors of construction expression GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 respectively, the carrier that just will set out is replaced pET-28a (+) by PGEX-4T-2.Evaluation shows correct recombinant vectors called after PGEX-UP31, PGEX-UP32, PGEX-UP33, PGEX-UP34, PGEX-UP35, PGEX-UP36, PGEX-UP37, PGEX-UP38, PGEX-UP39.Colibacillus engineering according to the described method construction expression of the step 2 of step 1 GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 target protein; And abduction delivering GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 and carry out SDS-PAGE and detect the Recombinant Protein Expression situation, the screening efficient expression strain.
Protein induced expression qualification result shows that gene recombination bacterium through after inducing, has the protein expression band of increase at about 27KDa~28KDa place shown in D among C, Fig. 3 among Fig. 3, consistent with target protein molecular weight size.
With reference to the method for the step 3 of step 1 GST-UP31, GST-UP32, GST-UP33, GST-UP34, GST-UP35, GST-UP36, GST-UP37, GST-UP38, GST-UP39 being carried out Western blot detects; Western blot result is shown in C among Fig. 4; The result shows that the specificity association reaction has taken place for reorganization GST-UP32 albumen and monoclonal antibody A1H10; The specificity association reaction has taken place in GST-UP35 albumen and monoclonal antibody B3D9; The specificity association reaction has taken place in GST-UP38 albumen and monoclonal antibody A3C10; Show that the corresponding epi-position of monoclonal antibody A1H10 explanation monoclonal antibody is GST-UP32, the corresponding epi-position of monoclonal antibody B3D9 is GST-UP35, and the corresponding epi-position of monoclonal antibody A3C10 is GST-UP38.
Four, EUSA (ELISA) method is confirmed the epi-position of monoclonal antibody A1H10, B3D9, A3C10
Simultaneously; Confirm the epi-position of monoclonal antibody A1H10, B3D9, A3C10 with EUSA (ELISA) method; To encapsulate elisa plate respectively through fusion epi-position Protein G ST-UP32, GST-UP35, the GST-UP38 of GSTrap 4B affinity column purifying, to detect the epi-position that monoclonal antibody A1H10, B3D9, A3C10 are directed against.The concrete operations step is following:
1, the recombinant protein sample is prepared:
The colibacillus engineering of the expression GST-UP32 of above-mentioned structure, GST-UP35, GST-UP38 target protein is rule 37 ℃ of activation 16-20h in containing on the corresponding antibiotic LB flat board; Choose mono-clonal and be inoculated in the 5ml LB substratum, 37 ℃ are shaken bacterium and spend the night; Be transferred in fresh LB substratum with 1: 100 (weight ratio) inoculum size next day, and 37 ℃ are shaken bacterium to OD600 ≈ 1.0, adds IPTG (final concentration 1mM) inducing culture 3-4h; Collect thalline, every liter of bacterium liquid is resuspended with the solution of the STE (10mM Tris HCl pH8.0,150m M NaCl, 1mM EDTA, pH 8.0) of 50mL precooling approximately; The ultrasonication thalline, 15000g, the centrifugal collection supernatant of 10min; Merge epi-position albumen through GSTrap 4B affinity column purifying; Specifically be that an amount of Triton x-100 of adding is 1% to final concentration in supernatant, h) 0.45 μ m filter membrane syringe filtering, 4 ℃ of preservations of supernatant are subsequent use; In the 8mL supernatant, add 1mL with precooling 1X PBS (140mM NaCl, 2.7mM KCl, 10mMNa
2HPO4,1.8mM KH
2PO4, pH 7.3) washed GST resin, shake its adhesion protein of command of execution 0.5h gently.The solution that will contain gst fusion protein injects the good chromatography column of balance; When the solution that contains fusion rotein all gets in the post; With the precooling PBS washing of 30 times of volumes, add the gsh elutriant (pH8.0 among the gsh of 10mM, the Tris-HCl of 50mM) of the freshly prepared 15mM of 1mL, leave standstill 10min after having hanged gently; Collect elutriant, repeat twice of wash-out; Get the effluent that contains gst fusion protein (PGEX-4T-2 expressing protein purifying) of equivalent respectively, the target protein of washings and wash-out carries out SDS-PAGE with analysis purposes albumen; Collection contains the wash-out part of target protein; Through PBS dialysis or remove the free gsh, sample carries out gathering gel photograph behind the SDS-PAGE, analyzes with BandScan5.0 software then, and detecting the fusion rotein purity that surperficial purifying obtains is more than 90%.
2, confirm the epi-position of monoclonal antibody A1H10, B3D9, A3C10 with EUSA (ELISA) method
1) antigen coated: with coating buffer is the suspension of 3 μ g/mL with antigen (step 1 obtain albumen) dilution respectively, adds elisa plate, and negative control (being the gst fusion protein of purifying) is set in the 100ul/ hole simultaneously, and 4 ℃ encapsulate and spend the night;
2) washing: wash each hole of elisa plate 3 times with washings PBST, each 5 minutes, drain;
3) sealing: every hole adds each the 200 μ L of PBST solution that contain 5% skim-milk, puts 37 ℃ and hatches 2h;
4) add monoclonal antibody A1H10, B3D9, the A3C10 that suitably dilutes (1: 400-1: 1000 times) with insulation liquid (the PBST solution that contains 0.5% skim-milk), 100 μ l/ holes, each extent of dilution respectively adds two holes.Put 37 ℃ and hatch 2h, washing :) with step 2;
5) add enzyme conjugates (two is anti-): add reacting hole, every hole 100 μ L with being incubated the anti-mouse two anti-suitably dilutions (1: 50000) of liquid with horseradish peroxidase-labeled.Put 37 ℃ and hatch 1h, washing: same step (2);
6) colour developing: add chromogenic substrate solution, every hole 100 μ L, room temperature lucifuge colour developing 5-10min;
7) termination reaction: add stop buffer 2M/L H
2SO
4, every hole 50 μ L;
8) measure the OD value: join the OD value of detector with enzyme, the record result in each reacting hole of 492nm wavelength mensuration;
9) result judges: with the GST OD of purifying
492MV merges epi-position albumen OD as negative control
492>=2.1 times of negative control values (P/N>=2.1) are regarded as the epitope that monoclonal antibody is directed against.
Above-mentioned reaction result is consistent with Western blot result; As shown in Figure 5; Show that the specificity association reaction has taken place for monoclonal antibody A1H10, B3D9, A3C10 and fusion epi-position Protein G ST-UP32, GST-UP35, GST-UP38, instruction book clonal antibody A1H10, B3D9, the pairing epi-position of A3C10 are respectively GST-UP32, GST-UP35, GST-UP38.
The epitope that embodiment 2, synthetic epitope polypeptide are directed against with further conclusive evidence monoclonal antibody A1H10, B3D9, A3C10
1, epitope peptide is synthetic
To determined monoclonal antibody identification epi-position among the embodiment 1; Adopt the synthetic epitope polypeptide of chemical synthesis (sending BeiJing ZhongKe inferior photo bio ltd to synthesize); Called after UP32 (aminoacid sequence is a sequence 31 in the sequence table), UP35 (aminoacid sequence is a sequence 34 in the sequence table), UP38 (aminoacid sequence is a sequence 37 in the sequence table) purity are more than 90% respectively, and resultant quantity is 4mg.
2, the ELISA method is confirmed the epitope that monoclonal antibody A1H10, B3D9, A3C10 are directed against
3 epitope polypeptide UP32 of synthetic, UP35, UP38 (10 μ g/ml) are encapsulated elisa plate (100ul/ hole) respectively, to detect the epi-position that A1H10, B3D9, A3C10 monoclonal antibody are directed against.The concrete operations step is with the step 4 of embodiment 1.
Reaction result is as shown in Figure 6; Show that the specificity association reaction has taken place for monoclonal antibody A1H10, B3D9, A3C10 and fusion epi-position Protein G ST-UP32, GST-UP35, GST-UP38, instruction book clonal antibody A1H10, B3D9, the pairing epi-position of A3C10 are respectively UP32, UP35, UP38.
In order to detect the specific antibody that whether produces the epitope that identifies to the present invention among the clinical infection H.pylori patients serum; We encapsulate elisa plate (100ul/ hole) respectively with fusion epitope peptide (3 μ g/ml) GST-UP32, GST-UP35, GST-UP38 and embodiment 2 synthetic epitope peptides (10 μ g/ml) UP32, UP35, the UP38 of embodiment 1 preparation; With this laboratory collection and with S001 helicobacter Pylori urease detection kit (colloidal gold method; Beijing Kang Mei days letter Bioisystech Co., Ltd) be accredited as 3 parts of UreB male patients serums and resist (1: 100) to carry out elisa assay with 2 portions of normal human serums as one, the concrete operations step is with the step 4 of embodiment 1.
Reaction result is as shown in Figure 7; Merge epi-position albumen and synthetic epitope peptide and all positive reaction has taken place with 3 parts of helicobacter pylori infection patients serums; All do not react with 2 portions of normal human serums; The antibody that has produced among the helicobacter pylori infection patient to epitope peptide of the present invention is described, this development for multivalence epitope vaccine and diagnostic reagent provides new thinking.
The polyclonal antiserum of embodiment 4, epitope antigen is to synthetic peptide and the proteic identification of natural UreB
1, the preparation of mouse-anti serum
1) animal immune
Choose the 6-8 female BALB/C mice of SPF level in age in week, fusion epi-position Protein G ST-UP32, GST-UP35 and GST-UP38 purified in the subcutaneous multi-point injection embodiment 1 in back carry out immunity, and 3 times immunizing antigen dosage only is 100 μ g/.During first immunisation antigen is added subcutaneous multi-point injection after the emulsification of equivalent complete Freund's adjuvant (CFA) thorough mixing, every at a distance from 2 weeks added equivalent incomplete Freund's adjuvant (IFA) emulsification again with antigen after twice of booster immunization.Set up simultaneously only inject the PBS damping fluid (pH7.0,50mmol/L) with GST protein immunization group as the contrast immune group, immune programme for children is identical, every group of 5 mouse.Back 10 days ear edge vein exploitating bloods of 3 immunity detect antiserum titre, reach comparatively ideal titre after, finish back 14 days in immune programme for children, get blood and collect immunity back polyclonal antiserum.
2) indirect elisa method detects antibody titer
The detection that antagonist is tired adopts indirect elisa method to carry out.GST-UP32, GST-UP35, GST-UP38 fusion rotein with purifying are diluted to 3 μ g/ml with coating buffer, encapsulate in enzyme plate, every hole 100 μ l, and 4 ℃ encapsulate and spend the night.Add different extent of dilution antiserum(antisera) to be checked next day; Normal mouse serum with dilution in 1: 100 be contrast, and two to resist be the HRP mark sheep anti-mouse igg that dilutes at 1: 50000, and chromogenic substrate is O-Phenylene Diamine (OPD); Colour developing is the result measure at wavelength 490nm place with ELIASA, and P/N is positive greater than 2.1.
The result shows; After three immunity; The antibody titer of each experimental group can reach 1: 25600-1: 51200, and the PBS control group does not merge the epi-position reaction with any one basically, explains that the present invention makes up the fusion epi-position albumen HI of excitating organism well.
2, the ELISA method detects polyclonal antiserum and synthetic peptide of different epi-positions and the proteic identification of natural UreB
1) preparation of protein sample
(1) cultivation of helicobacter pylori
The cultivation of helicobacter pylori international standard bacterial strain NCTC I 1637 (available from the state-run standard type culture collection institute (NCTC) of Britain), helicobacter pylori (Helicobacter pylori) 26695 is with the step 1) in the step 1 of embodiment 1.
(2) preparation of helicobacter pylori NCTC I 1637,26695 whole bacterial protein samples
Scrape helicobacter pylori international standard bacterial strain NCTC I 1637 or helicobacter pylori (Helicobacter pylori) 26695 thalline with meat soup from helicobacter pylori solid culture plate, 4 ℃, the centrifugal 10min of 5000g collects thalline; Less salt PBS damping fluid (pH7.0 with precooling; 50mmol/L) wash 3 times, be 4 ℃ at every turn, the centrifugal 10min of 5000g; Use at last less salt PBS (pH7.0,50mmol/L) resuspended.Ice-bath ultrasonic 10min makes cell thoroughly broken.Then the solution room temperature is placed 0.5h, abundant solubilising protein, 8000g is centrifugal, and 20min removes insolubles.Collect supernatant, be whole bacterial protein solution.
2) enzyme-linked immunosorbent assay detects polyclonal antiserum and the synthetic proteic identification of the natural UreB of peptide of different epi-positions
Reaction result is shown in Fig. 8 A, 8B, and the result finds that the mouse-anti serum of immunity can be discerned the synthetic peptide of corresponding epi-position well, also can react with natural UreB simultaneously.
3, the proteic western blot of polyclonal antiserum and natural UreB analyzes
With the capable SDS-PAGE electrophoresis of above-mentioned ready helicobacter pylori 26695 whole bacterial protein samples; Change film; Then with embodiment 1 in behind purified fusion epi-position Protein G ST-UP32, GST-UP35 and the GST-UP38 immune mouse antiserum(antisera) carry out immunoblotting assay; With the fusion epi-position albumen of purifying and the UreB albumen UreBM of brachymemma (be the polypeptide of 106-377 position on the UreB albumen, according to the method expression and purification of embodiment 1, the amplimer of its encoding sox is F:
C
GAGCTCAATCTTAGCGTAGGTCC (
SacI); R:CCC
AAGCTTCCAAGTTCTAGTGATAA (
The Hind III); Utilize this primer; With helicobacter pylori (Helicobacterpylori) 26695 genomes is template, expands the target gene fragment, inserts to make up between SacI and the Hind III restriction enzyme site of pET28a (+) carrier to obtain recombinant vectors again; Express after recombinant vectors transformed BL21; Purifying just can obtain being used for the UreBM of positive control) as positive control, the while, as negative control, antiserum(antisera) diluted all the other concrete operations steps with embodiment 1 by 1: 200 times with BSA.
The result is shown in Fig. 8 C; Positive reaction has taken place in the UreB albumen UreBM of the fusion epi-position albumen of antiserum(antisera) and purifying and brachymemma; And with the UreaB of natural helicobacter pylori 26695 specific antigen-antibody reaction has taken place also, and do not seen that with BSA positive reaction takes place, explained by the antiserum(antisera) that merges the preparation of epi-position protein immunization BALB/e mouse and can discern natural UreB albumen; Further specifying the epi-position that we identify out is effective epi-position, can be used as the candidate molecules of epiposition vaccine.
The extract that contains urease activity comes from the centrifugal supernatant of the broken thing of helicobacter pylori NCTC 11637 full bacterium of above-mentioned preparation.Getting the extract that contains urease is diluted among the 25 μ l PBS (pH7.0); Respectively with the embodiment 4 that is diluted in 25 μ l PBS (pH7.0) equally in the preparation GST-UP32, GST-UP35 and GST-UP38 polyclonal antiserum, monoclonal antibody A1H10, B3D9, A3C10 hatch altogether in elisa plate, 4 ℃ are spent the night.Get and contain 500mM urea, 0.02% phenol red and 50mM phosphate buffered saline buffer (pH6.8) 50 μ l 0.1mM DTT are added on enzyme and join in the hole, measure the OD value at 560nm place behind the incubated at room 5h.Simultaneously with the how anti-mouse serum of anti-GST, with PBS mice immunized serum among the embodiment 4 as contrast.Inhibiting rate (%)=(the OD value behind the OD value-Jia antibody of no antibody)/(the OD value of no antibody) * 100.
Test-results is as shown in Figure 9, compares with control group, and monoclonal antibody A1H10, B3D9, A3C10 have significant inhibitory effect to urease; When dosage reached 25 μ g, inhibiting rate all can reach 70%, and GST-UP32, GST-UP35 and GST-UP38 polyclonal antiserum also have certain restraining effect to urease; When the antibody dosage that adds was 30 μ g, inhibiting rate all can reach 50%, and this inhibition has dose-dependently; Along with the increase that adds antibody dosage, inhibiting rate is in rising trend.
Provable according to above test, the present invention utilizes the segmentation truncation method to make up segmentation antigen and has confirmed the epitope that each monoclonal antibody was directed against with western blot method.Behind the epi-position immune animal that the present invention identifies out; The specific humoral immune response of excitating organism effectively; Confirmed that they have good immunogenicity, and the antiserum(antisera) that produces has certain urease activity restraining effect, and can avoid producing the conformational epitope specific antibody; Enhancing is to the inhibition of helicobacter pylori infection and remove effect, to playing good pushing effect in the research of the research and development of corresponding vaccine, pathogenesis and the clinical diagnosis.Simultaneously, the antiserum(antisera) that epi-position of the present invention produces can react with the urease of natural helicobacter pylorus bacteria strain, shows that epi-position of the present invention can be applied to the causal organism diagnosis of albumen epi-position.
Sequence table
<160>38
<210>1
<211>390
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>1
atgaaaaaga ttagcagaaa agaatatgtt tctatgtatg gccctactac aggcgataaa 60
gtgagattgg gcgatacaga cttgatcgct gaagtagaac atgactacac catttatggc 120
gaagagctta aattcggtgg cggtaaaacc ctgagagaag gcatgagcca atccaacaac 180
cctagcaaag aagaattgga tctaatcatc actaacgctt taatcgtgga ttacaccggt 240
atttataaag cggatattgg tattaaagat ggcaaaatcg ctggcattgg taaaggcggt 300
aacaaagaca tgcaagatgg cgttaaaaac aatcttagcg taggtcctgc tactgaagcc 360
ttagccggtg aaggtttgat cgtaactgct 390
<210>2
<211>420
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>2
aatcttagcg taggtcctgc tactgaagcc ttagccggtg aaggtttgat cgtaactgct 60
ggtggtattg acacacacat ccacttcatt tcaccccaac aaatccctac agcttttgca 120
agcggtgtaa caaccatgat tggtggcgga actggtcctg ctgatggcac taatgcgact 180
actatcactc caggcagaag aaatttaaaa tggatgctca gagcggctga agaatattct 240
atgaacttag gtttcttggc taaaggtaac gcttctaacg acgcgagctt agtcgatcaa 300
attgaagctg gtgcgattgg ctttaaaatc cacgaagact ggggcaccac tccttctgca 360
atcaatcatg cgttagatgt tgcagacaaa tacgatgtgc aagtcgctat ccacacagac 420
<210>3
<211>441
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>3
atcaatcatg cgttagatgt tgcagacaaa tacgatgtgc aagtcgctat ccacacagac 60
actttgaatg aagccggttg cgtggaagac actatggcag ctattgccgg acgcactatg 120
cacactttcc acactgaagg tgctggcggc ggacacgctc ctgatattat taaagtagct 180
ggtgaacaca acattcttcc cgcttccact aaccccacta tccctttcac tgtgaataca 240
gaagcagaac acatggacat gcttatggtg tgccaccact tggataaaag cattaaagaa 300
gatgttcagt tcgctgattc aaggatccgc cctcaaacca ttgcggctga agacactttg 360
catgacatgg ggattttctc aatcaccagc tctgactctc aagctatggg tcgtgtgggt 420
gaagttatca ctagaacttg g 441
<210>4
<211>648
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>4
attttctcaa tcaccagctc tgactctcaa gctatgggtc gtgtgggtga agttatcact 60
agaacttggc aaacagctga caaaaacaaa aaagaatttg gccgcttgaa agaagaaaaa 120
ggcgataacg acaacttcag gatcaaacgc tacttgtcta aatacaccat taacccagcg 180
atcgctcatg ggattagcga gtatgtaggt tctgtagaag tgggcaaagt ggctgacttg 240
gtattgtgga gtcccgcatt ctttggcgta aaacccaaca tgatcatcaa aggcgggttc 300
attgcgttga gtcaaatggg tgacgcgaac gcttctatcc ctaccccaca accagtttat 360
tacagagaaa tgttcgctca tcatggtaaa gccaaatacg atgcaaacat cacttttgtg 420
tctcaagcgg cttatgacaa aggcattaaa gaagaattag ggcttgaaag acaagtgttg 480
ccggtaaaaa attgcagaaa catcactaaa aaagacatgc aattcaacga cactaccgct 540
cacattgaag tcaatcctga aacttaccat gtgttcgtgg atggcaaaga agtaacttct 600
aaaccagcca ataaagtgag cttggcgcaa ctctttagca ttttctag 648
<210>5
<211>130
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>5
Met Lys Lys Ile Ser Arg Lys Glu Tyr Val Ser Met Tyr Gly Pro Thr
1 5 10 15
Thr Gly Asp Lys Val Arg Leu Gly Asp Thr Asp Leu Ile Ala Glu Val
20 25 30
Glu His Asp Tyr Thr Ile Tyr Gly Glu Glu Leu Lys Phe Gly Gly Gly
35 40 45
Lys Thr Leu Arg Glu Gly Met Ser Gln Ser Asn Asn Pro Ser Lys Glu
50 55 60
Glu Leu Asp Leu Ile Ile Thr Asn Ala Leu Ile Val Asp Tyr Thr Gly
65 70 75 80
Ile Tyr Lys Ala Asp Ile Gly Ile Lys Asp Gly Lys Ile Ala Gly Ile
85 90 95
Gly Lys Gly Gly Asn Lys Asp Met Gln Asp Gly Val Lys Asn Asn Leu
100 105 110
Ser Val Gly Pro Ala Thr Glu Ala Leu Ala Gly Glu Gly Leu Ile Val
115 120 125
Thr Ala
130
<210>6
<211>140
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>6
Asn Leu Ser Val Gly Pro Ala Thr Glu Ala Leu Ala Gly Glu Gly Leu
1 5 10 15
Ile Val Thr Ala Gly Gly Ile Asp Thr His Ile His Phe Ile Ser Pro
20 25 30
Gln Gln Ile Pro Thr Ala Phe Ala Ser Gly Val Thr Thr Met Ile Gly
35 40 45
Gly Gly Thr Gly Pro Ala Asp Gly Thr Asn Ala Thr Thr Ile Thr Pro
50 55 60
Gly Arg Arg Asn Leu Lys Trp Met Leu Arg Ala Ala Glu Glu Tyr Ser
65 70 75 80
Met Asn Leu Gly Phe Leu Ala Lys Gly Asn Ala Ser Asn Asp Ala Ser
85 90 95
Leu Val Asp Gln Ile Glu Ala Gly Ala Ile Gly Phe Lys Ile His Glu
100 105 110
Asp Trp Gly Thr Thr Pro Ser Ala Ile Asn His Ala Leu Asp Val Ala
115 120 125
Asp Lys Tyr Asp Val Gln Val Ala Ile His Thr Asp
130 135 140
<210>7
<211>147
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>7
Ile Asn His Ala Leu Asp Val Ala Asp Lys Tyr Asp Val Gln Val Ala
1 5 10 15
Ile His Thr Asp Thr Leu Asn Glu Ala Gly Cys Val Glu Asp Thr Met
20 25 30
Ala Ala Ile Ala Gly Arg Thr Met His Thr Phe His Thr Glu Gly Ala
35 40 45
Gly Gly Gly His Ala Pro Asp Ile Ile Lys Val Ala Gly Glu His Asn
50 55 60
Ile Leu Pro Ala Ser Thr Asn Pro Thr Ile Pro Phe Thr Val Asn Thr
65 70 75 80
Glu Ala Glu His Met Asp Met Leu Met Val Cys His His Leu Asp Lys
85 90 95
Ser Ile Lys Glu Asp Val Gln Phe Ala Asp Ser Arg Ile Arg Pro Gln
100 105 110
Thr Ile Ala Ala Glu Asp Thr Leu His Asp Met Gly Ile Phe Ser Ile
115 120 125
Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Val Gly Glu Val Ile Thr
130 135 140
Arg Thr Trp
145
<210>8
<211>215
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>8
Ile Phe Ser Ile Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Val Gly
1 5 10 15
Glu Val Ile Thr Arg Thr Trp Gln Thr Ala Asp Lys Asn Lys Lys Glu
20 25 30
Phe Gly Arg Leu Lys Glu Glu Lys Gly Asp Asn Asp Asn Phe Arg Ile
35 40 45
Lys Arg Tyr Leu Ser Lys Tyr Thr Ile Asn Pro Ala Ile Ala His Gly
50 55 60
Ile Ser Glu Tyr Val Gly Ser Val Glu Val Gly Lys Val Ala Asp Leu
65 70 75 80
Val Leu Trp Ser Pro Ala Phe Phe Gly Val Lys Pro Asn Met Ile Ile
85 90 95
Lys Gly Gly Phe Ile Ala Leu Ser Gln Met Gly Asp Ala Asn Ala Ser
100 105 110
Ile Pro Thr Pro Gln Pro Val Tyr Tyr Arg Glu Met Phe Ala His His
115 120 125
Gly Lys Ala Lys Tyr Asp Ala Asn Ile Thr Phe Val Ser Gln Ala Ala
130 135 140
Tyr Asp Lys Gly Ile Lys Glu Glu Leu Gly Leu Glu Arg Gln Val Leu
145 150 155 160
Pro Val Lys Asn Cys Arg Asn Ile Thr Lys Lys Asp Met Gln Phe Asn
165 170 175
Asp Thr Thr Ala His Ile Glu Val Asn Pro Glu Thr Tyr His Val Phe
180 185 190
Val Asp Gly Lys Glu Val Thr Ser Lys Pro Ala Asn Lys Val Ser Leu
195 200 205
Ala Gln Leu Phe Ser Ile Phe
210 215
<210>9
<211>90
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>9
gatggcgtta aaaacaatct tagcgtaggt cctgctactg aagccttagc cggtgaaggt 60
ttgatcgtaa ctgctggtgg tattgacaca 90
<210>10
<211>75
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>10
ggtggtattg acacacacat ccacttcatt tcaccccaac aaatccctac agcttttgca 60
agcggtgtaa caacc 75
<210>11
<211>90
<212>DNA
<213>11
<400>11
agcggtgtaa caaccatgat tggtggcgga actggtcctg ctgatggcac taatgcgact 60
actatcactc caggcagaag aaatttaaaa 90
<210>12
<211>105
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>12
actatcactc caggcagaag aaatttaaaa tggatgctca gagcggctga agaatattct 60
atgaacttag gtttcttggc taaaggtaac gcttctaacg acgcg 105
<210>13
<211>105
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>13
gcttctaacg acgcgagctt agtcgatcaa attgaagctg gtgcgattgg ctttaaaatc 60
cacgaagact ggggcaccac tccttctgca atcaatcatg cgtta 105
<210>14
<211>90
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>14
cctcaaacca ttgcggctga agacactttg catgacatgg ggattttctc aatcaccagc 60
tctgactctc aagctatggg tcgtgtgggt 90
<210>15
<211>30
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>15
Asp Gly Val Lys Asn Asn Leu Ser Val Gly Pro Ala Thr Glu Ala Leu
1 5 10 15
Ala Gly Glu Gly Leu Ile Val Thr Ala Gly Gly Ile Asp Thr
20 25 30
<210>16
<211>25
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>16
Gly Gly Ile Asp Thr His Ile His Phe Ile Ser Pro Gln Gln Ile Pro
1 5 10 15
Thr Ala Phe Ala Ser Gly Val Thr Thr
20 25
<210>17
<211>30
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>17
Ser Gly Val Thr Thr Met Ile Gly Gly Gly Thr Gly Pro Ala Asp Gly
1 5 10 15
Thr Asn Ala Thr Thr Ile Thr Pro Gly Arg Arg Asn Leu Lys
20 25 30
<210>18
<211>35
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>18
Thr Ile Thr Pro Gly Arg Arg Asn Leu Lys Trp Met Leu Arg Ala Ala
1 5 10 15
Glu Glu Tyr Ser Met Asn Leu Gly Phe Leu Ala Lys Gly Asn Ala Ser
20 25 30
Asn Asp Ala
35
<210>19
<211>35
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>19
Ala Ser Asn Asp Ala Ser Leu Val Asp Gln Ile Glu Ala Gly Ala Ile
1 5 10 15
Gly Phe Lys Ile His Glu Asp Trp Gly Thr Thr Pro Ser Ala Ile Asn
20 25 30
His Ala Leu
35
<210>20
<211>30
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>20
Pro Gln Thr Ile Ala Ala Glu Asp Thr Leu His Asp Met Gly Ile Phe
1 5 10 15
Ser Ile Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Val Gly
20 25 30
<210>21
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>21
agcggtgtaa caaccatgat tggtggcgga actggtcctg ctgat 45
<210>22
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>22
ggtggcggaa ctggtcctgc tgatggcact aatgcgacta ctatc 45
<210>23
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>23
ggcactaatg cgactactat cactccaggc agaagaaatt taaaa 45
<210>24
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>24
actatcactc caggcagaag aaatttaaaa tggatgctca gagcg 45
<210>25
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>25
tggatgctca gagcggctga agaatattct atgaacttag gtttc 45
<210>26
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>26
atgaacttag gtttcttggc taaaggtaac gcttctaacg acgcg 45
<210>27
<211>42
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>27
cctcaaacca ttgcggctga agacactttg catgacatgg gg 42
<210>28
<211>45
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>28
actttgcatg acatggggat tttctcaatc accagctctg actct 45
<210>29
<211>48
<212>DNA
< 213>helicobacter pylori (Helicobacter pylori)
<400>29
attttctcaa tcaccagctc tgactctcaa gctatgggtc gtgtgggt 48
<210>30
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>30
Ser Gly Val Thr Thr Met Ile Gly Gly Gly Thr Gly Pro Ala Asp
1 5 10 15
<210>31
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>31
Gly Gly Gly Thr Gly Pro Ala Asp Gly Thr Asn Ala Thr Thr Ile
1 5 10 15
<210>32
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>32
Gly Thr Asn Ala Thr Thr Ile Thr Pro Gly Arg Arg Asn Leu Lys
1 5 10 15
<210>33
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>33
Thr Ile Thr Pro Gly Arg Arg Asn Leu Lys Trp Met Leu Arg Ala
1 5 10 15
<210>34
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>34
Trp Met Leu Arg Ala Ala Glu Glu Tyr Ser Met Asn Leu Gly Phe
1 5 10 15
<210>35
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>35
Met Asn Leu Gly Phe Leu Ala Lys Gly Asn Ala Ser Asn Asp Ala
1 5 10 15
<210>36
<211>14
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>36
Pro Gln Thr Ile Ala Ala Glu Asp Thr Leu His Asp Met Gly
1 5 10
<210>37
<211>15
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>37
Thr Leu His Asp Met Gly Ile Phe Ser Ile Thr Ser Ser Asp Ser
1 5 10 15
<210>38
<211>16
<212>PRT
< 213>helicobacter pylori (Helicobacter pylori)
<400>38
Ile Phe Ser Ile Thr Ser Ser Asp Ser Gln Ala Met Gly Arg Val Gly
1 5 10 15
Claims (10)
1. a peptide species, the polypeptide of forming by the aminoacid sequence shown in the sequence in the sequence table 37.
2. the encoding sox of the described polypeptide of claim 1.
3. encoding sox according to claim 2 is characterized in that: said encoding sox is the DNA of sequence 28 in the sequence table.
4. the application of the described polypeptide of claim 1 in the immunological reagent of preparation prevention or treatment helicobacter pylori infection.
5. application according to claim 4 is characterized in that: said immunological reagent is the epiposition vaccine preparation.
6. according to claim 4 or 5 described application, it is characterized in that: said immunological reagent is the poly epiposition vaccine preparations that join more.
7. the application of the described polypeptide of claim 1 in the active medicine of preparation inhibition helicobacter Pylori urease.
8. the application of the described polypeptide of claim 1 in preparation helicobacter pylori vitro detection reagent.
9. detect, prevent or treat the immunological reagent of helicobacter pylori infection, its activeconstituents comprises the described polypeptide of claim 1.
10. suppress the active medicine of helicobacter Pylori urease, its activeconstituents comprises the described polypeptide of claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101822522A CN101863965B (en) | 2010-05-21 | 2010-05-21 | Helicobacter pylori urease B antigenic epitope polypeptide and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2010101822522A CN101863965B (en) | 2010-05-21 | 2010-05-21 | Helicobacter pylori urease B antigenic epitope polypeptide and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101863965A CN101863965A (en) | 2010-10-20 |
CN101863965B true CN101863965B (en) | 2012-06-06 |
Family
ID=42955919
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2010101822522A Active CN101863965B (en) | 2010-05-21 | 2010-05-21 | Helicobacter pylori urease B antigenic epitope polypeptide and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101863965B (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102276697B (en) * | 2011-07-22 | 2013-03-13 | 中国人民解放军第三军医大学 | Helicobacter pylori antigen HLA restricted immuno-dominant epitope peptide and application thereof |
CN106421768A (en) * | 2016-10-31 | 2017-02-22 | 中国人民解放军第三军医大学 | Helicobacter pylori multi-subunit vaccine based on CD4+T cellular immunity and preparing method |
CN106480003B (en) * | 2016-10-31 | 2019-09-10 | 中国人民解放军第三军医大学 | The combination of helicobacter pylori dominant antigen and screening technique based on CD4+T cellular immunity |
CN113896775A (en) * | 2021-08-25 | 2022-01-07 | 河北医科大学第四医院 | Specific immunogenic peptide fragment of helicobacter pylori |
CN114262366B (en) * | 2021-12-24 | 2023-06-23 | 中国人民解放军军事科学院军事医学研究院 | B cell epitope polypeptide HP11 of helicobacter pylori HspA and application thereof |
CN114262383B (en) * | 2021-12-24 | 2023-06-27 | 中国人民解放军军事科学院军事医学研究院 | Antigen epitope polypeptide of helicobacter pylori heat shock protein A and application thereof |
CN116068170B (en) * | 2022-09-28 | 2023-09-15 | 北京金沃夫生物工程科技有限公司 | Test paper and kit for detecting Helicobacter pylori |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1807452A (en) * | 2006-01-28 | 2006-07-26 | 中国人民解放军第三军医大学 | Helicobacter Pylori urease B subunit Th epitope peptide, its coding DNA, vaccine and uses |
CN101033468A (en) * | 2007-02-05 | 2007-09-12 | 中国人民解放军第三军医大学 | Helicobacter pylori urease B subunit B cell antigen epitope polypeptide, identification method and application |
CN101062015A (en) * | 2007-05-22 | 2007-10-31 | 中国药科大学 | Urease epitope fusion peptide liposome bacterin for preventing the helicobacter pylori infecting |
-
2010
- 2010-05-21 CN CN2010101822522A patent/CN101863965B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1807452A (en) * | 2006-01-28 | 2006-07-26 | 中国人民解放军第三军医大学 | Helicobacter Pylori urease B subunit Th epitope peptide, its coding DNA, vaccine and uses |
CN101033468A (en) * | 2007-02-05 | 2007-09-12 | 中国人民解放军第三军医大学 | Helicobacter pylori urease B subunit B cell antigen epitope polypeptide, identification method and application |
CN101062015A (en) * | 2007-05-22 | 2007-10-31 | 中国药科大学 | Urease epitope fusion peptide liposome bacterin for preventing the helicobacter pylori infecting |
Non-Patent Citations (2)
Title |
---|
J.P.Burnie et al.The application of epitope mapping in the development of a new serological test for Helicobacter pylori infection.《Journal of Immunological Methods》.1996,第194卷(第1期),85-94. * |
陶好霞等.幽门螺杆菌尿素酶B单克隆抗体的制备与鉴定.《生物技术通讯》.2007,第18卷(第2期),246-248. * |
Also Published As
Publication number | Publication date |
---|---|
CN101863965A (en) | 2010-10-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101863963B (en) | Helicobacter pylori antigen epitope polypeptide and application thereof | |
CN101863965B (en) | Helicobacter pylori urease B antigenic epitope polypeptide and application thereof | |
CN101863964B (en) | Helicobacter pylori urease B antigen epitope polypeptide and application thereof | |
US6613331B1 (en) | Vaccine against Lyme disease | |
CN104844712B (en) | Streptococcus pneumoniae protein antigen and its preparation method and application | |
CN101955545B (en) | Multi-target recombination gene and application of protein thereof in preventing and treating infection of helicobacter pylori | |
US11572392B2 (en) | Mutant fragments of OspA and methods and uses relating thereto | |
CN100535116C (en) | Helicobacter pylori urease B subunit B cell antigen epitope polypeptide, identification method and application | |
CN112979826B (en) | Encephalitis B virus nanoparticle vaccine and preparation method and application thereof | |
CN101891805A (en) | Human enterovirus 71 type specific polypeptide and application thereof | |
Kolybo et al. | Immunobiology of diphtheria. Recent approaches for the prevention, diagnosis, and treatment of disease | |
CN101293098A (en) | Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine | |
CN100519583C (en) | SARS neutralization antibody and application | |
CN102558306A (en) | Antigen epitope for preventing and treating trichinosis, composition thereof and application thereof | |
CN101948546B (en) | Fusion protein SAmB as well as coding gene and applications thereof | |
CN102151332A (en) | Helicobacter pylori epitope vaccine, design method thereof, preparation method thereof and application thereof | |
CN107961370A (en) | Multivalent pneumococcal conjugate vaccines and preparation method thereof | |
JPH04504422A (en) | Rickettsial antigens for vaccines and diagnostics | |
CN102532271A (en) | Brucella B cell epitope and monoclonal antibody and application thereof | |
CN102432673A (en) | Brucella bp26 protein epitope, monoclonal antibody and application thereof | |
Gao et al. | Expression of Hc fragment from Clostridium botulinum neurotoxin serotype B in Escherichia coli and its use as a good immunogen | |
CN103450353B (en) | Application of protein AIG_01780 in Rickettsia rickettsii resistant immune protection | |
CN102406929A (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
CN103276009A (en) | Construction and expression for campylobacter jejuni cytolethaldistending toxin expression vectors, and preparation for monoclonal antibody | |
CN107365367A (en) | A types FMDV VP1 Protein Epitopes gene polypeptide and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20101020 Assignee: Beijing Jinwofu Bio-Engineering Technology Co., Ltd. Assignor: Bioengineering Inst., Academy of Military Medical Sciences, PLA Contract record no.: 2015990000688 Denomination of invention: Helicobacter pylori urease B antigen epitope polypeptide and application thereof Granted publication date: 20120606 License type: Exclusive License Record date: 20150724 |
|
LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model |