CN1249240C - Expression vector pBVTB, its construction method and use in HCV vaccin research - Google Patents

Abstract

The present invention discloses an expression vector pBVTB with the property of immunological adjuvant. The expression vector pBVTB with the property of immunological adjuvant comprises most sequences of plasmid pBV 220 and a quantity of small molecular immunological adjuvant genes. The present invention also discloses a pBVTB preparation process by a gene engineering method and the application of combining pBVTB and HCV high conservative T cell epitope genes in the research of hepatitis C vaccine.

Description

Expression vector pBVTB and construction process thereof and the application in the HCV vaccine research

Technical field

The present invention relates to a kind of expression vector pBVTB, also relate to this construction of carrier and be combined in application in the HCV vaccine research with immunological adjuvant characteristic.

Background technology

In vaccine research, adjuvant has played very important booster action, seeks suitable immunological adjuvant, with the enhancement antigen specific immune response, is one of focus of studying in the world.Traditional freund adjuvant is an adjuvant the most frequently used in the present experimentation on animals, but because of side effect obviously is difficult to human vaccine, and some use adjuvant, adsorb as aluminium hydroxide, phospholipid liposomes etc. effectively enhancing immunity are replied, cell immune response that more can not excitating organism.Therefore, the research of adjuvant, the particularly effectively immunoreactive immunological adjuvant of activated cell research are very important for the preventative and therapeutic vaccine research of many chronic viral diseases such as AIDS, third liver etc.

We know the immunoreactive T cell of mediated cell differentiation and maturation in thymus gland, and thymus gland therefrom can obtain multiple thymus gland parahormone as the endocrine organ of human body, and they play important regulatory role in immune response.The now existing Zadaxin that much experimental results show that can effective stimulus T proliferation of lymphocytes, regulates the secretion of broad variety cytokine, strengthens the killing activity of NK cell, also can promote the expression of mhc class ii antigen in various kinds of cell.

(Thymosin Alpha-1 TA1) is 28 peptides to thymosin, and sequence is msdaavdtsseittkdlkekkevveeae.It is reported that TA1 and IFN-α unite the curative ratio that use can significantly improve chronic hepatitis C, and do not find any significant side effects (Kullavanuaya P et al.J Med Assoc Thai, 2001 medium-term and long-term observation of therapeutic process; 84:462) in HCV treatment research, entered III phase clinical stage, also entered II phase clinical study (Ancell CD et al.Am J Health Syst Pharm, 2001 at HBV as a kind of new drug TA1; 58:879).TA1 mainly regulates immunity system by strengthening the T cell function, can obviously improve the body's immunological function disorder, except that carrying out antiviral therapy, can also strengthen as the immunological adjuvant of cancer therapy vaccine vaccine action effect (Bianco-Batlles D et al.Cell Mol Biol, 2001:47:157).

One 5 peptides are arranged in the thymopoietin (Thymopoietin), and (Thymopentin Tp5) has whole activity of thymopoietin, and its sequence is: rkdvy.It is to lymphocytic proliferating cycle, and surface antigen differentiation etc. all has certain influence (Bodey B et al.Int J Immunopharmacol, 2000; 22:261); But the enhancing body immunologic balance all demonstrates certain curative effect (Gonser S etal.J Recept Signal Transduct Res, 1999 in the research of multiple disease; 19:155).

In addition, research shows that also these two kinds of Zadaxin all can promote the generation of Th1 cytokines such as IL-2, IFN-γ, and suppresses secretion (Andreone P et al.J ViralHepat, 2001 of Th2 cytokines such as IL-4, IL-10; 8:194, Braga M et al.J Surg Res, 1996; 62:197) thisly come the mechanism of enhancing body provide protection, in modern vaccination research, will exert far reaching influence by regulating release of cytokines.

B cytokine former (Probursin) stimulates the T cell development the same with thymine, can stimulate the B cell enlargement.Previously be separated to a kind of little peptide that can irritate the growth of B cell in the birds yolk sac, be called capsule element (Bursin), also be separated to 14 peptides that contain the bursin identical sequence afterwards in the marrow stromal cell of mammal (bovine), it is former to be called the B cytokine.Except that the bursin sequence, former promotes growth statin (Somatostatin) and the phagolysis enhancing hormone tuftsin sequence of also containing of B cytokine, can activate the B cell activity, and ctl response is also had certain promoter action, its sequence is ffwktkprkhggrr.It is reported ability (ZhangHW et al.Shi Yan Sheng Wu Xue Bao, 1995 that this type of material can also enhancing body be resisted virus infection; 28:111).

General DR allelotrope epi-position (Pan-allelic DR epitope, PADRE) energy and human and the combination of the different DR molecule of multiple animal are offered in cell surface, and then activate the CD4+T helper, performance immunoregulation effect (Eileen DF et al.Vaccine, 1999; 17:1201).There are some researches show again that recently PADRE is auxiliary antibody reaction (Jeff A et al.The Journal of Immunology, 2000 in vivo also; 164:1625).Therefore, in adjuvant, add this general epi-position, can fully activate the initiating effect of CD4+ mediation immunity, especially in therapeutic vaccine research, do not resemble the consistence that requires immune epitope and infect epitope when taking place the preventative vaccine.Therefore, PADRE possesses some essential characteristics as immunological adjuvant, and its sequence is akfvaawtlkaaa.

In sum, these small molecules effector substances can promote the growth and the differentiation of immunocyte, humoral immunization and cell immune response to body, can both play comprehensive regulating effect, this is for many chronic viral diseases and tumor vaccine research, and is all necessary.

Hepatitis C is typical case's representative that chronic viral infects, and infects the patient of back more than 60% and is chronicity, and liver cirrhosis takes place easily, and in close relations with hepatocellular carcinoma.The whole world has 1.75 hundred million people to infect HCV is arranged according to estimates, at the infection rate of some developing country even on the rise, and third liver be different from hepatitis A and hepatitis B be, so far also there are not practicable prevention and treatment means, therefore press for a kind of safe and effective vaccine of development, come infecting of control disease.

Estimate the validity of vaccine traditionally with the power of humoral immune reaction, however the high titre neutrality antibody that exists in the body, and though can effectively resist virus infection, for invading in the host cell, and the virus of duplicating breeding but is difficult to play a role.The removing of pathogenic agent is most important in cell-mediated immunity, particularly cytotoxic T cell (CTL) activity, pair cell.Therefore, infect, more and more come into one's own based on the research of the new type functional vaccine that activates the body t cell immune response at the such chronic viral of HCV.The aminoacid sequence of HCV structural protein C district and Nonstructural Protein such as NS3, NS4 and NS5 is relatively conservative, most CD4+ and CD8+T cell epitope all are distributed in these zones, so be expected to filter out in the HCV different genotype difficult problem that epi-positions of high conservative all solves the reaction intercrossing.

Evaluation about epi-position is the focus that people study always, along with deepening continuously of research work, utilize synthetic overlapping peptide or epi-position self motif characteristics etc., the investigator has obtained many important HCVT cell epitopes, has wherein much also proved to evoke extensive, enduring t cell immune response.Except that the HCV epi-position of HLA-B40 restricted type yet there are no the report, all existing report of epi-position of restricted types such as widely distributed HLA-A24, HLA-A2, HLA-B7 in the population of China.By sequence comparison widely, should therefrom filter out high conservative t cell epitope, rationally contact again, be connected into the expression vector pBVTB that we make up as immunogen with immunologic adjuvant function, to help to develop new type functional vaccine based on t cell immune response, be expected to walk around HCV this difficulty that highly makes a variation, in the HCV vaccine development, make a breakthrough.

Summary of the invention

For a kind of efficient fusion prokaryotic expression carrier pBVTB with immunological adjuvant character is provided, the present invention is on the basis of immunological adjuvant progress in recent years, select some immunocyte to be had the small molecules type adjuvant of activation, utilize its gene constructed expression carrier and antigen molecule epi-position to carry out amalgamation and expression.Such fusion molecule possesses the dual function of immunogen and immunological adjuvant.

PBVTB carrier of the present invention is that total length is the closed loop plasmid of 3893bp.It inserts synthetic small molecules adjuvant assortment of genes structure and forms between former multiple clone site EcoRI of expression vector pBV220 and BamHI." CCGG " 4 base pairs, pBVTB has comprised the insertion sequence of remaining 3662bp sequence of pBV220 and 231bp between pBV220 carrier multiple clone site EcoRI and BamHI.In addition, pBVTB also contains multiple clone site BamHI, SalI, PstI, the HindIII of pBV220, rrna transcription termination signal rrnB, ammonia benzyl resistant gene (AmpR), aporepressor gene cIts857, and P _RP _LPromotor etc.

Small molecules adjuvant gene of the present invention mainly comprises thymosin, thymopoietin TP-5, the B cytokine is former and Universal T-cell epitopes PADRE.When these four kinds of active small moleculars are connected, should consider to add suitable connecting arm,, combine with corresponding acceptor molecule and to play a role so that the adjuvant molecule fully launches.We adopt G-G-G as connecting arm in design, and this can give molecule with flexibility, and G is a small molecules simultaneously, and the processing of also being convenient to epitope is offered.In addition, we have inserted restriction enzyme site XhoI " CTCGAG " and XbaI " TCTAGA " (with reference to Chinese patent application: expression vector pBVIL1 and construction process thereof and purposes, application number 00100695.9) in the combination of this fragment gene.With first " A " among the GAATCC of EcoRI point of contact is the 1st, lays respectively at carrier 12 3-128 position and 127-132 position by count along the pin direction two restriction enzyme site XhoI and XbaI.Because carrier pBVTB of the present invention has cIts857 aporepressor gene and the P of pBV220 equally _RP _LPromotor, thereby have the characteristic that thermal induction is expressed, promptly in the time of 42 ℃, the external source segment of inserting pBVTB can amalgamation and expression with small molecules adjuvant gene.

PBVTB of the present invention has identical polyclone restriction enzyme site with the pBVIL1 that this laboratory made up in the past, can be advantageously used in gene clone and antigen presentation equally.Include restriction enzyme site XhoI and XbaI in the small molecules adjuvant gene of pBVTB carrier, single goal gene can insert and express easily.Similar with pBVIL1, after also can utilizing XbaI and SpeI enzyme to cut, pBVTB can form the characteristics of complementary sticky end, by designing special general connection primer, can be in the back of existing goal gene, increase new gene fragment, utilize this principle equally, choose and XhoI sticky end complementary enzyme SalI mutually, also can be implemented in the imagination that new gene is added in the goal gene front.The concrete steps of this process can be with reference to Chinese patent application: expression vector pBVIL1 and construction process thereof and purposes, application number 00100695.9.

Compare by literature search on a large scale and sequence, the present inventor has obtained a series of restrictive HCV t cell epitopes of multiple MHC that have, and the homology difference of these epi-positions in different HCV types and strain isolated sequence,, polyvalent HCV therapeutic vaccine efficient for preparing provides the candidate antigen gene.Relevant report according to a large amount of HCV t cell epitopes; the present invention therefrom optimizes 19 protective epitope's polypeptide; derive from the genomic different zones of HCV respectively; these epi-positions are verified all to have better immunogenicity; and consider that t cell immune response has the restrictive characteristics of MHC; our selected epi-position includes multiple MHC Limit Type, and this has improved the fraction of coverage (see Table 1) of epitope gene in the crowd to a great extent.

Some characteristics of with good grounds again population of China self, account for population of China large percentage (about 35%) as the HLA-B40 restricted type, and the epi-position of this type that do not appear in the newspapers in the document, so contrary immunogenicity strategy (Pamer EG et al.Nature, 1991 that we propose according to Pamer; 353:852) it is predicted, the characteristics that its particular combination motif is arranged according to the epi-position of different Limit Types, HLA-B40 epi-position binding motif meets such general formula " EI/F-----X ", be that second of epi-position is L-glutamic acid, the 3rd is Isoleucine or phenylalanine, the 9th X represents polare Aminosaeren or uncharged amino acid (Paul EH etal.Journal of Immunology, 1993; 151:5966).Search in HCV polyprotein precursor with self-editing program in BASIC, obtain 3 sequences (seeing Table 2) that meet this general formula altogether, its activity remains to verify that further this work has certain help to the coverage rate of further expansion epitope gene in population of China.

The HCV/T cell epitope situation of table 1 bibliographical information

Title	The position	Sequence	Type
				C-1 C-2 C-3 NS3-1 NS4-1 NS4-2 TY-1 TY-2 TY-3 TY-4 TY-5 TY-6 TY-7 TZ-1 TZ-2 TZ-3 TZ-4 A24	Core(aa21-44) Core(aa73-92) Core(157-176) NS3(1248-61) NS4(1767-86) NS4(1907-26) Core(aa35-44) Core(132-140) NS3(1073-81) NS4(1807-16) NS5(2594-602) NS5(2152-60) Core(88-96) NS1/E(632-41) NS3(1396-404) Core(169-177) NS3(1359-67) A24(1031-1039)	DVKFPGGGQIVGGVYLLPRR GRTWAQPGYPWPLYGNEGC VLEDGVNYATGNLPGC SF SI GYKVLVLNPSVAAT NFISGIQYLAGLSTLPGNPA GPGEGAVQWMNRLIAFASRG YLLPRRGPRL DLMGYIPLV CINGVCWTV LLFNILGGWV ALYDVVSTL HEYPVGSQL NEGLGWAGW RMYVGGVEHR LIFCHSKKK LPGCSFSIF HPNIEEVAL AYSQQTRGL	CD4+ CD4+ CD4+ CD4+ CD4+ CD4+ HLA-A2 HLA-A2 HLA-A2 HLA-A2 HLA-A2 HLA-A2 HLA-B44 HLA-A3 HLA-A3 HLA-B7 HLA-B35 HLA-A24

Table 2. may become the sequence of the restrictive epi-position of MHC-B40 through prediction

Title	The position	Sequence	Type
				B40-1 B40-2 B40-3	B40-1(886-894) B40-2(1371-1379) B40-3(1555-1563)	FEITKILLA GEIPFYGKA LEFWESVFT	HLA-B40 HLA-B40 HLA-B40

Influence the validity of t cell epitope vaccine in the crowd except that the MHC restricted type is various, the epi-position variation is another main difficult problem that present HCV vaccine research faces.For this reason, we retrieve 55 HCV full length gene sequences from the GENEBANK database, through after converting aminoacid sequence to, compile with code (table 3) again, are used for making up HCV genes encoding full-length proteins database, called after HCVS.All can intercept respective section in this database to above selected t cell epitope compares, obtain its homology situation in different HCV sequences, thereby can eliminate variation greatly and be not inconsistent sequence with the epi-position characteristics, for further proof list bit function has dwindled scope.By relatively reaching in a large number the conservative property of epi-position in different sequences carried out statistical study (table 4).Be HCV t cell epitope vaccine research, the foundation of selecting is provided, the certain method foundation also is provided.

The title and the code of the HCV full-length gene order that can find among the table 3.GeneBank

H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 H15 H16 H17 H18

HPVHCVN AF009606 AF011751 AF011752 AF046866 AF054247 AF054248 AF054249 AF054250 D84262 D84263 D84264 D84265 D89815 HC16362 HC45476 HCD409 HCD85516

H19 H20 H21 H22 H23 H24 H25 H26 H27 H28 H29 H30 H31 H32 H33 H34 H35 H36

HCD872 HCHCPO HCJK046E2 HCJK049E1 HCJRNA HCU01214 HCV12083 HCV1480 HCVCENS 1 HCVJK1G HCV4APOLY HCVPOLYP HPC1B2 HPC1B3 HPC1B4 HPC1B5 HPCCGAA HPCCGPA

H37 H38 H39 H40 H41 H42 H43 H44 H45 H46 H47 H48 H49 H50 H51 H52 H53 H54 H55

HPCGENANT HPCHCJ1 HPCHCVTR 1 HPCHK6 HPCIB1 HPCJ8G HPCJCG HPCJ483 HPCJ491 HPCJTA HPCJTB HPCP1 HPCPLYPR HPCPOLP HPCPP HPCRNA HPCUNKCDS PCY1B6 S62220

The present invention through a large amount of homologys has relatively selected and a series ofly can be different MHC types t cell epitope that offered, high conservative, and we have therefrom selected 8 its titles of epi-position to be: NS3-1; TY-2; TY-4; TZ-2; TZ-3; TZ-4; A24; B40-3.According to Livingston BD etc. (Vaccine, 2001, report 19:4652-4660), the amino acid and the epi-position of next-door neighbour's epi-position 3 ' end are processed closely related in cell, and with basic aminoacids (K, R), contain Amine amino acid (N, Q), (C, G A) wait to well small molecules amino acid.So, above-mentioned a plurality of epi-positions are done following connection according to this result, connected with-NG-, when first of indivedual next epi-position are N or small molecules, can reduce by an amino acid.After rationally connecting, be cloned into expression vector pBVTB, be used to make up the t cell epitope vaccine of new function.

The conservative property statistic analysis result of selected 21 t cell epitopes of table 4.

Seq Name	NCS	NCS/TS％	NCA	TA	NCA/TA％
						C-1 C-2 C-3 NS3-1 NS4-1 NS4-2 TY-1 TY-2 TY-3 TY-4 TY-5 TY-6 TY-7 TZ-1 TZ-2 TZ-3 TZ-4 A24 B40-1 B40-2 B40-3	43 7 31 46 38 44 44 41 19 39 31 5 20 37 50 52 21 20 26 45 14	78.18 12.72 56.36 83.63 69.09 80.00 80.00 74.54 34.54 70.90 56.36 9.090 36.36 67.27 90.90 94.54 38.18 36.36 47.27 81.81 25.45	1082 1009 1052 761 1079 1086 535 478 421 517 428 350 459 512 489 492 448 456 433 484 448	1210 1210 1210 770 1210 1210 550 495 495 550 495 495 495 550 495 495 495 495 495 495 495	98.36 91.72 95.63 98.83 98.09 98.72 97.27 96.56 85.05 94.00 86.46 70.70 92.72 93.09 98.78 99.39 90.50 92.12 87.47 97.77 90.50

^*NCS＝NO Change Sequences TS＝Total Sequences

NCA＝No Change aa Residues TA＝Total aa Residues

The Multi-Epitope Fusion Protein of utilizing carrier pBVTB of the present invention to express has immunogen and adjuvant double effects concurrently, selected small molecules type adjuvant mostly derives from human body gene, what have has obtained very ten-strike in clinical study, they are as immunoregulatory effector, humoral immunization and cellular immunization to body all can play effective regulating effect, particularly can promote the cell immune response of Th1 type, the vaccine research of many chronic diseases is all had certain benifit.In addition, the present invention has multiple MHC Limit Type through a series of high conservative HCV t cell epitope that screening on a large scale obtains, and can cover most of crowds, bring into play the important effect of its T cellular immunization, research also will produce far-reaching influence to the HCV therapeutic vaccine; And the cloning site of foreign gene has complementary endonuclease activity on the carrier, the insertion that can carry out a plurality of genes easily be connected, help the reasonably optimizing and the transformation of vaccine antigen gene, thereby the present invention is with a wide range of applications in the vaccine research field.

Description of drawings

Fig. 1 is structure and the restriction enzyme site figure of expression vector pBVTB

Fig. 2 is for inserting the synthetic synoptic diagram of the required primer of adjuvant gene

Fig. 3 is the small molecular protein SDS-PAGE synoptic diagram of carrier pBVTB abduction delivering

Obtain the bacterial strain of expression for pBVTB 1, No. 4; No. 3 is unloaded plasmid pBV220; 2, No. 5 is the bacterial strain that does not obtain expression.

Fig. 4 cuts for the enzyme of pBVTB and identifies and PCR evaluation synoptic diagram

Marker selects the DL2 of TaKaRa company, 000 for use; Be plasmid pBVTB EcoR I and BamH I double digestion qualification result No. 1; No. 2 is the PCR qualification result.

Fig. 5 is the The sequencing results of pBVTB

Fig. 6 epi-position homology is 1 (high conservative MHCI quasi-molecule restricted epitope) relatively for example

Fig. 7 epi-position homology is 2 (high conservative mhc class ii molecule restricted epitopes) relatively for example

Fig. 8 epi-position homology is 3 (high variation MHC restricted epitopes) relatively for example

Fig. 9 is the synthetic synoptic diagram of multi-epitope gene TE required primer when synthetic

Figure 10 epitope gene TE is at the amalgamation and expression synoptic diagram of pBVTB

No. 1 is the molecular weight reference protein of molecular weight 1.7 ten thousand, 3-6 number bacterial strain for epitope gene TE acquisition expression, and the arrow indication is for expressing target protein, and molecular weight is about 1.8 ten thousand; No. 2 is the bacterial strain that does not obtain expression; M represents molecular weight MARKER.

Figure 11 cuts for the enzyme of pBVTB/TE fusion expression plasmid and identifies and PCR evaluation synoptic diagram

Marker selects the DL2 of TaKaRa company, 000 for use; Be plasmid PBVTB/TE XhoI and XbaI double digestion qualification result No. 1; No. 2 is the PCR qualification result.

Embodiment

Present embodiment is understood the present invention in more detail, but is not to limit the present invention by any way.

One, the structure of expression vector pBVTB

1, determines the immunological adjuvant molecular sequences

We select thymosin, TP-5, the immunological adjuvant of four active small molecular conducts of Probursin and PADRE and immunogen amalgamation and expression, adopt G-G-G as connecting arm, in the gene order combination, insert clone restriction enzyme site XhoI and XbaI simultaneously, for sterically hindered and fragment processing, respectively add two G (sequence of restriction enzyme site is represented with italic) in front and back, the aminoacid sequence after the connection is as follows.

MsdaavdtsseittkdlkekkevveeaengggrkdyyGGLEGSRGGffwktkprkh ggrrgggakfvaawtlkaaa, totally 76 amino-acid residues.

2, design of primers

Because selected adjuvant gene is small-molecule active substance, thus chemical synthesis adopted, according to the needs of each synthetic gene, six primers below having designed.

F1 (primer 1)

gaaaagaaggaggtcgtagaagaagctgaaaacggtggtggtcgtaaagacgtatacggtggtctcgag

F2 (primer 2)

atgagcgacgctgctgtagatactagctctgagattactactaaagacctgaaagaaaagaaggaggtc

R1 (primer 3)

acgaccaccgtgtttacgaggtttagttttccagaagaaaccacctctagaaccctcgagaccaccgta

R2 (primer 4)

ttaagcagcagctttcagagtccaagccgctacgaatttagcaccaccaccacgacgaccaccgtgttt

5 ' (primer 5)

gcgaattcatgagcgacgctgct

3 ' (primer 6)

gcggatccttaagcagcagcttt

Wherein 5 ' and 3 ' end primer is mainly introduced restriction enzyme site to goal gene and can be used as universal primer, all entrusts Shanghai to give birth to worker's biotechnology company limited after the gene fragment order design and synthesizes.

3, the PCR method obtains goal gene

Obtain goal gene with three step PCR synthesis methods:

The first step amplification system is: 10 * Buffer, 5 μ l, and each 1 μ l of synthetic gene fragment (20pmol/ μ l) R1, F1,4dNTPs (2.5mM) 4 μ l, Taq archaeal dna polymerase (5U/ μ l) 0.5 μ l adds water to 50 μ l.(Taq archaeal dna polymerase, Buffer, dNTPs all available from Tacara Bioisystech Co., Ltd).Pcr amplification reaction: 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, totally 5 circulations.

Second step and the 3rd step amplification are all diluted 10 times with previous step PCR product and are carried out as template.Amplification system is the same, and just primer second goes on foot PCR and selects R2, F2 for use, and the 3rd step was selected 5 ' and 3 ' end primer for use.Pcr amplification reaction: 94 ℃ 1 minute, 55 ℃ 1 minute, 72 ℃ 1 minute, gained goal gene called after TB behind three pcr amplifications of totally 30 circulations.

The PCR product purification is with PCR product purification test kit in a small amount (magnificent Shun bio-engineering corporation produce) by specification method purifying.

4, TB inserts pBV220

Double digestion: the TB of above-mentioned purifying and the plasmid pBV220 (Chinese patent application " expression vector pBVIL1 and construction process thereof and purposes; application number 00100695.9 " discloses its detail file) that extracts with alkaline denaturation, use EcoR I and BamH I double digestion respectively.The PCR product of 30 μ l purifying and 10 μ l plasmids are carried out enzyme respectively cut, the enzyme system of cutting also has 10 * damping fluid (H), 4 μ l, the EcoRI2 μ l of 10u/ μ l, and the BamHI2 μ l of 10u/ μ l adds water to cumulative volume 40 μ l, 37 ℃ of water-baths 8 hours.Enzyme is cut the after product rubber tapping and is reclaimed the purpose fragment, and concrete grammar is referring to magnificent Shun's test kit specification sheets.

Insert to connect: get 1.5ml sterilization Eppendorf pipe and add plasmid pBV220 and each 1 μ l of TB behind the double digestion, 10 * T4DNA connects damping fluid 1 μ l, and T4DNA ligase enzyme (12u/ μ l) 1 μ l adds sterilization distilled water to 15 μ l, and 16 ℃ are spent the night.

5, transform and express:

Asepticly get 100 μ l competent cells (the HB101 bacterial strain is by " molecular cloning "-Science Press, the CaCl of second edition ₂The method preparation, this bacterial strain can be buied by commercial sources), in ice bath, add and connect product 8 μ l, rotate gently, in ice bath, placed 30 minutes with the mixing content, transfer to immediately in 42 ℃ of water-baths and left standstill 2 minutes, every then pipe adds the not LB substratum of added with antibiotic of 0.5ml, and 37 ℃ of water-baths are after 15 minutes, 30 ℃ of shaking table jogs 45 minutes; Get 200 μ l and transform thalline, evenly coat on the Agar Plating that contains 100mg/ml ammonia benzyl, dry up about 10 minutes, be inverted overnight incubation for 37 ℃ at Bechtop.

Picking colony is about 10 from flat board, be inoculated in respectively and contain in the 100mg/ml ammonia benzyl LB substratum (5ml/ pipe), 32 ℃ of shaking table overnight incubation, get 150 μ l incubated overnight bacterium transferred speciess next day to containing (2ml/ pipe) in the ammonia benzyl LB substratum, cultivated 3 hours for 32 ℃, 42 ℃ of shaking bath inducing culture 4 hours, because of expressed goal gene molecular weight is lower than 10,000, adopt improved SDS-polyacrylamide gel electrophoresis to analyze micromolecule polypeptide (Shi Jihong etc., 2000 the 21st the 6th phases of volume of The Fourth Military Medical University's journal) and see Fig. 3.

6. the evaluation of carrier

Get and obtain the bacterial strain of expressing, the extraction plasmid enzyme restriction is identified, cut with EcoRI and BamHI enzyme, system and condition are ditto described, are template with the plasmid simultaneously, select primer 5 ' and 3 ' to carry out pcr amplification, the results are shown in Figure 4 with what 1.5% agarose gel electrophoresis was identified then, therefrom can see, enzyme is cut with PCR and has all been obtained and the consistent band of expection clip size, and sequencing result proves also that the TB gene has inserted correctly and sees Fig. 5 among the pBV220 that promptly pBVTB successfully constructs.

Two, epitope gene is cloned into expression vector pBVTB

1, the acquisition of epitope gene

Selected epitope gene sees Table 5, with-NG-is connecting arm series connection reasonable in design, the design primer entrusts Shanghai living worker's biotechnology company limited synthetic.Then by the PCR stepwise synthesis.Concrete steps can be referring to embodiment one.

Table 5. selects the tabulation of epitope gene situation

Title	The position	Sequence	Type
				NS3-1 TY-2 TY-4 TZ-2 TZ-3 TZ-4 B40-3 A24	NS3(1248-61) Core(132-140) NS4(1807-16) NS3(1396-404) Core(169-177) NS3(1359-67) B40-3(1555-1563) A24(1031-1039)	GYKVLVLNPSVAAT DLMGYIPLV LLFNILGGWV LIFCHSKKK LPGCSFSIF HPNIEEVAL LEFWESVFT AYS QQTRGL	CD4+ HLA-A2 HLA-A2 HLA-A3 HLA-B7 HLA-B35 HLA-B40 HLA-A24

Multi-epitope gene TE synthesizes required primer sequence

F3 (primer 7)

cgctcgagggtgacctgatgggttacatccctctggtaaacggttacaaagtactggtactg

F2(primer 8)

aaagtactggtactgaacccttctgtagctgctactaacggtctgcctggttgctctttctct

F1 (primer 9)

ggttgctctttctctatcttcaacggtctgctgttcaacatcctgggtggttgggtaaacggt

R3 (primer 10)

cgtctagaaccgttcagagctacttcttcgatgttagggtgaccgttagtgaatac

R2 (primer 11)

accgttagtgaatacagattcccagaactccagaccgttcagaccacgagtctgctgagagta

R1 (primer 12)

agtctgctgagagtaagcgtttttttttttagagtggcagaagatcagaccgtttacccaacc

2, the insertion of epitope gene

The epitope gene called after TE that the amplification back obtains, TE behind the purifying and the plasmid pBVTB that extracts with alkaline denaturation, use XhoI and XbaI double digestion respectively, make gene after enzyme is cut be connected with plasmid, transform, express and be the pBVTB/TE expression plasmid and see Figure 10 then, concrete operations are all described with embodiment one.

3, the evaluation of expression plasmid

Equally the bacterium of having expressed being extracted plasmid identifies with XhoI and XbaI double digestion, plasmid with purifying is a template simultaneously, F3 when synthesizing with the TE fragment and R3 are that primer carries out the PCR evaluation, see Figure 11, can see and all obtain the band consistent with the purpose clip size, consistent through the order-checking detection with goal gene, prove that expression plasmid is correct.

Sequence table

＜110〉Institute of Basic Medical Sciences, Academy of Military Medical Sciences, PLA

＜120〉expression vector pBVTB and construction process thereof and the application in the HCV vaccine research

<130>

<160>19

<170>PatentIn version 3.1

<210>1

<211>28

<212>PRT

＜213〉synthetic

<400>1

Met Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp

1 5 10 15

Leu Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu

20 25

<210>2

<211>5

<212>PRT

＜213〉synthetic

<400>2

Arg Lys Asp Val Tyr

1 5

<210>3

<211>14

<212>PRT

＜213〉synthetic

<400>3

Phe Phe Trp Lys Thr Lys Pro Arg Lys His Gly Gly Arg Arg

1 5 10

<210>4

<211>13

<212>PRT

＜213〉synthetic

<400>4

Ala Lys Phe Val Ala Ala Trp Thr Leu Lys Ala Ala Ala

1 5 10

<210>5

<211>9

<212>PRT

＜213〉synthetic

<400>5

Phe Glu Ile Thr Lys Ile Leu Leu Ala

1 5

<210>6

<211>9

<212>PRT

＜213〉synthetic

<400>6

Gly Glu Ile Pro Phe Tyr Gly Lys Ala

1 5

<210>7

<211>9

<212>PRT

＜213〉synthetic

<400>7

Leu Glu Phe Trp Glu Ser Val Phe Thr

1 5

<210>8

<211>69

<212>DNA

＜213〉synthetic

<400>8

gaaaagaagg aggtcgtaga agaagctgaa aacggtggtg gtcgtaaaga cgtatacggt 60

ggtctcgag 69

<210>9

<211>69

<212>DNA

＜213〉synthetic

<400>9

atgagcgacg ctgctgtaga tactagctct gagattacta ctaaagacct gaaagaaaag 60

aaggaggtc 69

<210>10

<211>69

<212>DNA

＜213〉synthetic

<400>10

acgaccaccg tgtttacgag gtttagtttt ccagaagaaa ccacctctag aaccctcgag 60

accaccgta 69

<210>11

<211>69

<212>DNA

＜213〉synthetic

<400>11

ttaagcagca gctttcagag tccaagccgc tacgaattta gcaccaccac cacgacgacc 60

accgtgttt 69

<210>12

<211>23

<212>DNA

＜213〉synthetic

<400>12

gcgaattcat gagcgacgct gct 23

<210>13

<211>23

<212>DNA

＜213〉synthetic

<400>13

gcggatcctt aagcagcagc ttt 23

<210>14

<211>62

<212>DNA

＜213〉synthetic

<400>14

cgctcgaggg tgacctgatg ggttacatcc ctctggtaaa cggttacaaa gtactggtac 60

tg 62

<210>15

<211>63

<212>DNA

＜213〉synthetic

<400>15

aaagtactgg tactgaaccc ttctgtagct gctactaacg gtctgcctgg ttgctctttc 60

tct 63

<210>16

<211>63

<212>DNA

＜213〉synthetic

<400>16

ggttgctctt tctctatctt caacggtctg ctgttcaaca tcctgggtgg ttgggtaaac 60

ggt 63

<210>17

<211>56

<212>DNA

＜213〉synthetic

<400>17

cgtctagaac cgttcagagc tacttcttcg atgttagggt gaccgttagt gaatac 56

<210>18

<211>63

<212>DNA

＜213〉synthetic

<400>18

accgttagtg aatacagatt cccagaactc cagaccgttc agaccacgag tctgctgaga 60

gta 63

<210>19

<211>63

<212>DNA

＜213〉synthetic

<400>19

agtctgctga gagtaagcgt tttttttttt agagtggcag aagatcagac cgtttaccca 60

acc 63

Claims (2)

1. expression vector pBVTB with immunological adjuvant characteristic, the total length that it is characterized in that comprising small molecules adjuvant gene is the closed loop plasmid of 3893 base pairs, wherein the small molecules adjuvant is thymus gland α 1, thymopoietin TP-5, former and the Universal T-cell epitopes PADRE of B cytokine, their aminoacid sequence is respectively SEQ No.1, SEQ No.2, SEQ No.3, SEQ No.4, the assortment of genes of above-mentioned small molecules adjuvant comprises " CCGG " 4 base pairs between multiple clone site EcoRI and BamHI between former multiple clone site EcoRI of expression vector pBV220 and BamHI.

2. the application of the described expression vector pBVTB of claim 1 in vaccine research.

Images