CN1793327A - No.3 Chlorine resisting strain and screening process thereof - Google Patents

No.3 Chlorine resisting strain and screening process thereof Download PDF

Info

Publication number
CN1793327A
CN1793327A CN 200510019753 CN200510019753A CN1793327A CN 1793327 A CN1793327 A CN 1793327A CN 200510019753 CN200510019753 CN 200510019753 CN 200510019753 A CN200510019753 A CN 200510019753A CN 1793327 A CN1793327 A CN 1793327A
Authority
CN
China
Prior art keywords
chlorine
substratum
strain
bacteria suspension
dcreening operation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 200510019753
Other languages
Chinese (zh)
Other versions
CN100400647C (en
Inventor
鲍建国
王焰新
刘慧�
张彩香
信欣
李耀辰
刘双
李平
张莉君
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China University of Geosciences
Original Assignee
China University of Geosciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China University of Geosciences filed Critical China University of Geosciences
Priority to CNB2005100197538A priority Critical patent/CN100400647C/en
Publication of CN1793327A publication Critical patent/CN1793327A/en
Application granted granted Critical
Publication of CN100400647C publication Critical patent/CN100400647C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to chlorine proof microorganism. It is chlorine proof strain No.3. Its features are as follows: it is staphylococcus sciuri B723-3 CCTCC NO.M205121; its colonial morphologies are big colony spot, off-white, regular circular, un-transparent, smooth, stiff; its physiological characteristics are spheroid, diameter 0.5-1.5um, single, pairs, or irregular stack shape, gram positive; its main biological and chemical features are concurrently character anaerobic, chemoheterotrophic bacteria, contacting enzyme positive, oxidase negative, producing arginine double hydrolase and urease, and producing acid from D-cellobiose, D-rock candy, D- mannitol, D-ribose, levulose, and sucrose, no moving, no spore; its optimum temperature is 30-37 centigrade degree. It can live in high concentration chloride ion condition, and high effectively degrade high concentration organic pollutant.

Description

No. 3, chlorine resisting strain and screening method thereof
Technical field
The present invention relates to a kind of anti-chlorine microorganism and screening method thereof.
Background technology
Common micro-organisms is limited to the tolerance of chlorion, and when chlorine ion concentration was less than 4000mg/L generally speaking, microorganism can grow, and can not be subjected to the obvious suppression effect.But, if chlorine ion concentration greater than 4000mg/L, then chlorion sharply manifests with the raising of chlorine ion concentration inhibition even the toxic action of microorganism, causes common micro-organisms not survive.Yet at occurring in nature, also exist some extraordinary microorganisms, they are containing high-concentration chlorine ion, or even can normal growth in the environment of extreme high-concentration chlorine ion (5000-80000mg/L), and this quasi-microorganism can be called anti-chlorine microorganism.
But, be not the processing that all anti-chlorine microorganisms can be applied to contain high-concentration chlorine ion wastewater, must just can obtain not only can tolerating high-concentration chlorine ion environment, but also the anti-chlorine microorganism of the organic special type of degradable waste water middle and high concentration through strict screening and domestication.
Summary of the invention
No. 3, the chlorine resisting strain and the screening method thereof that the object of the present invention is to provide a strain to handle to contain high-concentration chlorine ion wastewater.
No. 3, chlorine resisting strain provided by the present invention was Staphylococcus sciuri (Staphylococcus sciuri) B723-3, had been preserved in Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCCNO.M205121 on October 24th, 2005.
The colonial morphology that No. 3, chlorine resisting strain: bacterium colony bacterial plaque big (5mm), be beige, rule is circular, edge is neat, opaque, smooth surface, dimpling, thickness; Physiological characteristic: sphere, diameter 0.5~1.5 μ m, single, paired or irregular heap shape, Gram-positive; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase and urase etc., produces acid from D-cellobiose, D-rock sugar, D-N.F,USP MANNITOL, D-ribose, fructose, sucrose, do not move, do not give birth to spore, 30~37 ℃ of optimum growth temperatures.
The screening method that No. 3, one chlorine-resisting strain:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-3, promptly No. 3, chlorine resisting strain.
Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl 215.6g/L, pH=7.5.
The present invention screens a strain has the certain growth ability under the high-concentration chlorine ion condition new bacterial strain from the saponin waste water pool bottom sludge.And its anti-chlorine ability studied, the result shows that under the high-concentration chlorine ion condition, the anti-chlorine ability that No. 3, chlorine resisting strain is good, scope is wide, can be at [Cl -] have energy for growth preferably during for 5000-80000mg/L.One chlorine-resisting strain has the ability of COD in the good removal saponin waste water for No. 3, can remove the COD 56.3% in the waste water within 72 hours.But the new bacterial strain that the present invention obtains not only can effectively be handled such as extremely unmanageable special waters such as turmeric saponin wastewaters containing existence under the high-concentration chlorine ion environment, but also efficient degradation high concentration organic contaminant.
Description of drawings
Fig. 1-the 1st, bacterial strain B723-3 is growing state figure on liquid SC substratum
Fig. 2-the 1st, and the PCR product agarose electrophoresis figure of bacterial strain B723-3 (1: amplified production, 2: nuclear DNA, M:Marker)
Fig. 3-the 1st, bacterial strain B723-3 colonial morphology figure
Fig. 3-the 2nd, bacterial strain B723-3 bacterial strain Electronic Speculum picture
Fig. 4-the 1st, the reaction times is to the figure that influences of COD clearance
Fig. 4-the 2nd, inoculum size is to the figure that influences of COD clearance
Fig. 4-the 3rd, pH value in reaction is to the figure that influences of COD clearance
Fig. 4-the 4th, shaking speed is to the figure that influences of COD clearance
Embodiment
One, the screening method of No. 3, a chlorine-resisting strain:
(1), material is prepared:
1, waste water and pool bottom sludge are taken from the female Home Co., Ltd in Shiyan side, Hubei Province saponin waste water equalizing tank.
2, substratum: SM substratum: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Agar 20g (Gu); CaCl 215.6g/L, pH=7.5.
SC substratum: in the SM substratum, add the chlorion of different concns (90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000,0.5 ten thousand mg/L) according to the experiment needs.
3, laboratory apparatus and equipment:
State China SHA-B constant temperature oscillator,
SHH150G illumination bio-incubator,
Horizontal pressure steam sterilizer-----Shanghai Medical Nuclear Instrument Factory,
WMX-1 type microwave seal is cleared up COD tacheometer/-----Shantou City engineering main office of being surrounded by sea,
722S spectrophotometer-----Prism Optical Technology Co,
Opticmicroscope-----Olympus company limited,
PH meter etc.-----Hana company limited,
Bechtop,
Air dry oven,
The KYKY-1000B scanning electronic microscope,
PTC200 type PCR instrument,
Electrophoresis apparatus and electrophoresis chamber,
Gel ultraviolet visualizer,
DDS-11 type conductivity meter,
(2), the screening and separating of bacterial strain and purifying:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly (as 10 times) purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-3, promptly No. 3, chlorine resisting strain.
Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl 215.6g/L, pH=7.5.
Through preliminary screening and separating for several times purifying, obtain a strain bacterial strain B723-3 at last, promptly No. 3, chlorine resisting strain.Growing state is as Figure 1-1 on liquid SC substratum for bacterial strain B723-3.
Two, the microorganism strains of anti-chlorine is identified:
1, to the evaluation of the stronger bacterial strain B723-3 of chlorine-resistant property:
The stronger bacterial strain B723-3 of chlorine-resistant property is carried out the evaluation of Physiology and biochemistry and the evaluation of 16S rRNA molecule, determined the kind of chlorine resisting strain from molecular level.
16S rDNA sequential analysis is mainly according to following steps:
1) extract bacterium nuclear DNA,
A) collection bacterium: choose single colony inoculation with autoclaved toothpick and in LB liquid pipe, cultivated 18 hours, get its bacteria suspension 1ml centrifugal 5min of 8000rpm in the centrifuge tube of 1.5ml, abandon supernatant liquor.
B) add STE 1ml and wash once, the resuspended bacterium of vibrating, the centrifugal 5min of 8000rpm abandons supernatant liquor.
C) add 600 μ lTE, the resuspended bacterium of thermal agitation, the SDS 65 μ l of adding 10%, 65 ℃ of water-bath 5-10min.
D) add equal-volume phenol chloroform extracting three times.
E) carefully draw supernatant liquor, add the 3MNaAc of isopyknic Virahol and 1/10 volume, the centrifugal 10min of 12000rpm.Thoroughly abandon supernatant.
F) DNA precipitation is washed once with 70% ethanol, and it is standby to be dissolved in 20 μ lTE after air-dry.
TE damping fluid: 10mmol/L Tris-Cl (pH8.0); 1mmol/L EDTA-Na2 (pH8.0),
STE damping fluid: 0.1mol/L NaCl 10mmol/L Tris-Cl (pH8.0) 1mmol/L EDTA (pH8.0),
2) pcr amplification of 16S rDNA gene,
The pcr amplification primer is synthetic with reference to people's such as Weisburg method.
P1: forward primer 5 ' AGAGTTTGATCCTGGCTCAG3 '
P2: reverse primer 5 ' GGTTACCTTGTTACGACTT3 '
In 50 μ L reaction volumes, add 1 μ L template DNA (0.1 μ g), 0.5 μ L P1 and P2 (final concentration is 0.5 μ M), 1 μ LdNTP (every kind of NTP0.2mM), 0.5 μ LTaq polysaccharase (2U) and 5 μ L, 10 * PCR damping fluid.The pcr amplification condition is: 94 ℃ of pre-sex change 5min; At 94 ℃ of sex change 30s, 61-65 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 30 times; Last 72 ℃ are extended 10min eventually.
3) recovery of PCR product
After the PCR product carried out electrophoresis with 1% sepharose, under ultraviolet lamp, cut and contain desire and reclaim segmental gel, put into the 1.5ml centrifuge tube and add 2 times of volume TE, 65 ℃ of water-baths add the extracting of equal-volume water-saturated phenol and get the upper strata water after once centrifugal and use that phenol-chloroform-the primary isoamyl alcohol extracting once again after 10 minutes, reset and add 10mol/L ammonium acetate and 2 times of volume dehydrated alcohol precipitations of 0.1 times of volume in the collection, centrifugal, wash precipitation once with 70% ethanol, be dissolved in an amount of sterilization distilled water after air-dry.
4) complete sequence determination of 16S rDNA and analysis
The PCR order-checking is synthetic with reference to people's methods such as Hiraishi with forward and reverse primer.
P-f:CACGACGTTGTAAAACGACAGTTTGATCCTGGCTC;
P-r:GGATAACAATTTCACACAGGAAGGAGGTGATCCAGCC。
Add 1 μ L template DNA (<0.1 μ g), 30 circulations of pcr amplification (94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 2min).Adopt dyestuff terminator termination reaction in the ABI PRISM sequencing kit.Then, on Applied Biosystem 373A dna sequencing instrument, check order.The 16S rDNA sequence that records adopts BLAST software and the comparative analysis of GenBank database, finally determines the kind of this bacterium from molecular level.
2,16S rDNA sequencing:
The present invention adopts the method for 16SrRNA sequencing and analysis is carried out the evaluation of molecular level to bacterium.Nuclear DNA with bacterium is a template, is primer with the universal primer of the pcr amplification of 16S rRNA gene, carries out pcr amplification, obtains the amplified band that length is 1515bp (detecting with 1% agarose gel electrophoresis), shown in Fig. 2-1.After the PCR product is purified, measure its complete sequence.
<110〉China Geological Univ. Wuhan
<120〉No. 3, chlorine resisting strain and screening method thereof
<160>1515
<170>
<210>1
<211>1515bp
<212>DNA
<213〉Staphylococcus sciuri (Staphylococcus sciuri)
<220>
<221>misc_feature
<222>
<400>1
agtttgatcc?tggctcagga?tgaacgctgg?cggcgtgcct?aatacatgca?agtcgagcga 60
acagatgaga?agcttgcttc?tctgatgtta?gcggcggacg?ggtgagtaac?acgtgggtaa 120
cctacctata?agactgggat?aactccggga?aaccggggct?aataccggat?aatattttga 180
accgcatggt?tcaatagtga?aagacggttt?cggctgtcac?ttatagatgg?acccgcgccg 240
tattagctag?ttggtaaggt?aacggcttac?caaggcgacg?atacgtagcc?gacctgagag 300
ggtgatcggc?cacactggaa?ctgagacacg?gtccagactc?ctacgggagg?cagcagtagg 360
gaatcttccg?caatgggcga?aagcctgacg?gagcaacgcc?gcgtgagtga?tgaaggtctt 420
cggatcgtaa?aactctgttg?ttagggaaga?acaaatttgt?tagtaactga?acaagtcttg 480
cggtacctaa?ccagaaagcc?acggctaact?acgtgccagc?agccgcggta?atacgtaggt 540
ggcaagcgtt?atccggaatt?attgggcgta?aagcgcgcgt?aggcggtttc?ttaagtctga 600
tgtgaaagcc?cacggctcaa?ccgtgggagg?gtcattggaa?actggggaaa?cttgagtgca 660
gaaaaaggag?agtggaattc?catgtgtagc?ggtgaaatgc?gcagaagata?tggaggaacc 720
cccagtggcg?aaagcggctc?tctggtctgt?aactgacgct?gatgtgcgaa?agcgtgggga 780
tcaaacagga?ttagataccc?tggtagtcca?cgccgtaaac?gatgagtgct?agtgttaggg 840
ggtttccgcc?ccttagtgct?gcagctaacg?cattaagcac?tccgcctggg?gagtacgacc 900
gcaaggttga?aactcaaagg?aattgacggg?gacccgcaca?agcggtggag?catgtggttt 960
aattcgaagc?aacgcgaaga?accttaccaa?atcttgacat?cctttgaccg?ctctagagat 1020
agagtcttcc?ccttcggggg?acaaagtgac?aggtggtgca?tggttgtcgt?cagctcgtgt 1080
cgtgagatgt?tgggttaagt?cccgcaacga?gcgcaaccct?taagcttagt?tgccatcatt 1140
aagttgggca?ctctaggttg?actgccggtg?acaaaccgga?ggaaggtggg?gatgacgtca 1200
aatcatcatg?ccccttatga?tttgggctac?acacgtgcta?caatggataa?tacaaagggc 1260
agcgaatccg?cgaggccaag?caaatcccat?aaaattattc?tcagttcgga?ttgtagtctg 1320
caactcgact?acatgaagct?ggaatcgcta?gtaatcgtag?atcagcatgc?tacggtgaat 1380
acgttcccgg?gtcttgtaca?caccgcccgt?cacaccacga?gagtttgtaa?cacccgaagc 1440
cggtggagta?accttttagg?agctagccgt?cgaaggtggg?acaaatgatt?ggggtgaagt 1500
cgtaacaagg?taacc 1515
Three, colony morphology characteristic and physio-biochemical characteristics:
Colonial morphology to the bacterial strain B723-3 microorganism strains of anti-chlorine has carried out careful observation, the results are shown in Figure 3-1.To the apparent scanning electron microscopic observation of also having done of bacterium, the results are shown in Figure 3-2 simultaneously.
The colonial morphology that No. 3, one chlorine-resisting strain: bacterium colony bacterial plaque big (5mm), be beige, rule is circular, edge is neat, opaque, smooth surface, dimpling, thickness; Physiological characteristic: sphere, diameter 0.5~1.5 μ m, single, paired or irregular heap shape, Gram-positive; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase and urase etc., produces acid from D-cellobiose, D-rock sugar, D-N.F,USP MANNITOL, D-ribose, fructose, sucrose, do not move, do not give birth to spore, 30~37 ℃ of optimum growth temperatures.
Four, bacterial strain B723-3 is new bacterial strain:
Adopt the BLAST analytical method that 16S rRNA gene order and the comparative analysis of GenBank database of bacterial strain B723-3 are found that the homology of bacterial strain B723-3 and Staphylococcus sciuri (Staphylococcus sciuri) is the highest, is 99.0%.
The Physiology and biochemistry and the Molecular Identification result of comprehensive bacterial strain, bacterial strain B723-3 called after Staphylococcus sciuri (Staphylococcus sciuri) B723-3.Consult pertinent data, do not have still that the grape ball belongs to organic wastewater with difficult degradation thereby under the relevant high-concentration chlorine ion condition and the report of its anti-chlorine capability study.Staphylococcus sciuri (Staphylococcus sciuri) B723-3 was new bacterial strain, had been preserved in Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCC NO.M205121 on October 24th, 2005.
The present invention's screening and separating from the saponin waste water pool bottom sludge of Shiyan, Hubei Province goes out this strain bacterium, and finds the function that it has better degrading high concentration chlorion difficult degradation saponin waste water.This has widened people to the applied research thinking of Staphylococcus sciuri (Staphylococcussciuri) in its function aspects, and provides useful bacterium source and technology for degraded contains the high-concentration chlorine ion saponin waste water, has stronger actual application value.
Five, the application of No. 3, chlorine resisting strain:
(1), the single bacterium colony of picking Staphylococcus sciuri (Staphylococcus sciuri) B723-3, overnight incubation in the SM substratum, by Staphylococcus sciuri (Staphylococcus sciuri) B723-3 after cultivating: the volume ratio that contains high-concentration chlorine ion wastewater (as mixing saponin waste water) is 0.5-2: 100 get Staphylococcus sciuri (Staphylococcus sciuri) B723-3 is inoculated in and contains in the high-concentration chlorine ion wastewater (as mixing saponin waste water), 20-40 ℃ of constant temperature culture (30~37 ℃ of optimum tempss), jolting speed is 100-180rpm, the pH value is 7-8, reacts 24-72 hour; Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Agar 20g (Gu); CaCl 215.6g/L, pH=7.5.
(2), degradation factors test:
The degradation capability of bacterial strain B723-3 is relevant with environmental factorss such as inoculum size, duration of oscillation, rotating speed, pH values, change reaction times, vibration rotating speed, pH, inoculum size, determine the degraded top condition of degrading high concentration chlorion saponin waste water, the practical application of handling high-concentration chlorine ion wastewater for microbial method provides useful process parameter.In the multilevel experiment of following single factor, except that changing the factor of being studied, all the other are all undertaken by following condition: the single bacterium colony of picking bacterial strain B723-3, in the LB substratum before overnight incubation, get 1mL and be inoculated in ([Cl in the 100ml mixing saponin waste water -] about 20,000 mg/L, initial COD:5400mg/L), 30 ℃ of constant temperature culture, jolting speed are 150rpm, pH value is 7.5, reacts 72 hours COD values in the mensuration waste water.
1) influence in reaction times
Get in the Erlenmeyer flask of waste water 50ml adding 250ml, add bacteria suspension through the bacterial strain B723-3 of preceding cultivation.Detected the COD value of waste water every 24 hours, test-results Fig. 4-1.
From Fig. 4-1 as can be seen: the increase with degradation time increases bacterial strain B723-3 to the clearance of high-concentration chlorine ion saponin waste water COD, and when the reaction times reached 72h, its COD clearance no longer rose.The COD clearance of this moment is 56.3%.
2) influence of inoculum size
The inoculum size that changes substratum is respectively and inserts 0.5,1.0,1.5 among every 100mL in the waste water, the preceding culture of 2.0mL, and all the other conditions are constant, detect its COD clearance.Result such as Fig. 4-2.
From Fig. 4-2 as can be seen, when inoculum size changed between 0.5-2ml, B723-3 did not have considerable change (47.78-56.3%) to the clearance of COD, and when inoculum size was 1ml, its clearance was best.When inoculum size during greater than 1ml, along with the increase that connects the bacterium amount, degradation rate did not improve after 72 hours.This is the certain nutritive substance of growth needs because of bacterial strain, and inoculum size is crossed conference and caused bacterial growth to be suppressed because of vying each other, thereby influences the raising of degradation efficiency.
3) pH influence
The pH value that changes substratum is respectively 5.0,6.0,7.0,8.0,9.0, and all the other conditions are constant, detect its COD clearance.Result such as Fig. 4-3.
From Fig. 4-3 as can be seen, B723-3 descends with first the increasing afterwards of the increase of pH to the clearance of COD, and its highest clearance reaches about 56% when pH is 7-8.Waste water after the centrifugal treating, when finding that pH is 7-8, the wet thallus amount is 5,6 and 9 o'clock apparently higher than pH, as seen during at the inclined to one side alkali of neutrality, helps the growth of bacterial strain at pH.
4) influence of shaking speed
Change that jolting speed is respectively 90,120,150,180rpm, detect its COD value.Result such as Fig. 4-4.
From Fig. 4-4 as can be seen, rotating speed has certain influence to the removal of COD, and B723-3 descends with first the increasing afterwards of the increase of rotating speed to the clearance of COD, and its optimum revolution is 150rpm.This is because when rotating speed increases, has improved the contact rate of microorganism and waste water, causes the clearance of COD to increase, but rotating speed is when being increased to certain speed, and cell is subjected to the effect of shearing force and makes its activity reduction.
(3), bacterial strain B723-3 is to the saponin waste water degradation capability:
Get saponin and produce composite waste, the dilution certain multiple, making its COD is 5400mg/L, [Cl -] be: 20,000 mg/L.Get saponin composite waste 50ml and add respectively in the Erlenmeyer flask of 250ml, add the bacteria suspension 1ml of bacterial strain respectively, 30 ℃, 150rpm, pH value=7.1-7.5, shaking table vibration 3d calculates COD and the Cl of bacterial strain to waste water -The removal situation, bacterial strain B723-3 removes the excellent in efficiency of COD, is 56.3%.
Bacterial strain B723-3 all has the ability of COD in the good removal saponin waste water under the high COD of high-concentration chlorine ion (5000-80000mg/L) (about UASB-1 reactor water inlet COD=17000mg/L) condition, the clearance of its COD is 56.3%.

Claims (4)

1. No. 3, a chlorine-resisting strain, it is characterized in that described bacterial strain is Staphylococcus sciuri (Staphylococcussciuri) B723-3CCTCC NO.M205121.
2. No. 3, a chlorine-resisting strain according to claim 1, it is characterized in that: the colonial morphology of described Staphylococcus sciuri (Staphylococcus sciuri) B723-3: the bacterium colony bacterial plaque is big, be beige, rule is circular, edge is neat, opaque, smooth surface, dimpling, thickness; Physiological characteristic: sphere, diameter 0.5~1.5 μ m, single, paired or irregular heap shape, Gram-positive; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase and urase etc., produces acid from D-cellobiose, D-rock sugar, D-N.F,USP MANNITOL, D-ribose, fructose, sucrose, do not move, do not give birth to spore, 30~37 ℃ of optimum growth temperatures.
3. the screening method that No. 3, a chlorine-resisting strain as claimed in claim 1 is characterized in that:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-3, promptly No. 3, chlorine resisting strain.
4. the screening method that No. 3, a chlorine-resisting strain according to claim 3 is characterized in that: described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl 215.6g/L, pH=7.5.
CNB2005100197538A 2005-11-04 2005-11-04 No.3 Chlorine resisting strain and screening process thereof Expired - Fee Related CN100400647C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100197538A CN100400647C (en) 2005-11-04 2005-11-04 No.3 Chlorine resisting strain and screening process thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100197538A CN100400647C (en) 2005-11-04 2005-11-04 No.3 Chlorine resisting strain and screening process thereof

Publications (2)

Publication Number Publication Date
CN1793327A true CN1793327A (en) 2006-06-28
CN100400647C CN100400647C (en) 2008-07-09

Family

ID=36804977

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100197538A Expired - Fee Related CN100400647C (en) 2005-11-04 2005-11-04 No.3 Chlorine resisting strain and screening process thereof

Country Status (1)

Country Link
CN (1) CN100400647C (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107502579A (en) * 2017-09-28 2017-12-22 山东省城市供排水水质监测中心 A kind of method for screening and separating of chlorine-resistant bacterium and its one plant of obtained land gordonella

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107502579A (en) * 2017-09-28 2017-12-22 山东省城市供排水水质监测中心 A kind of method for screening and separating of chlorine-resistant bacterium and its one plant of obtained land gordonella
CN107502579B (en) * 2017-09-28 2020-03-24 山东省城市供排水水质监测中心 Screening and separating method for chlorine-resistant bacteria and Gordonia terranei strain obtained by screening and separating method

Also Published As

Publication number Publication date
CN100400647C (en) 2008-07-09

Similar Documents

Publication Publication Date Title
CN1683518A (en) High anti-mercury offensive smell pseudomonas strain CHY-7 and use in treating mercury pollution
CN112625942B (en) Aerobic denitrifying bacterium and application thereof
CN108220169B (en) Separation screening and identification method of strain for degrading polystyrene
CN111100815B (en) Pseudomonas for degrading PBAT (poly (butylene adipate-co-terephthalate)) plastic and application thereof
CN110699297A (en) Alcaligenes faecalis phenol subspecies and application thereof
CN109112085B (en) Pseudomonas citrobacter and application thereof
CN1793326A (en) Chlorine resisting strain No.1 and screening process thereof
CN1793327A (en) No.3 Chlorine resisting strain and screening process thereof
CN1876805A (en) Pseudomonas RRj228 helpful for crop growth and microbe preparation containing the same
CN113249276B (en) Bacillus cereus and application thereof
CN1792889A (en) Application of chlorine resisting strain No.3
CN1900272A (en) Chlorine resistant strain V430 and its screening method
CN1840654A (en) Chloride ion resistant strain S616 and its screening method
CN1792888A (en) Application of chlorine resisting strain No.1
CN1896016A (en) Use of chlorine-resisting strain S616
CN105779349A (en) Bacillus cereus strain JZBC1 for dissolving pond dominant dinoflagellate-scrippsiella trochoidea and application thereof
CN115537352B (en) Ornithine-degrading Raoult bacteria for degrading chloramphenicol, microbial inoculum and application thereof
CN1594539A (en) Specific strain for degrading organic waste water of medicine production and its construction method
CN100344749C (en) Saccharomycete and its application
CN1896242A (en) Gene of chlorine-resisting strain S616
CN1900283A (en) Gene of chlorine tolerance strain V430
CN100340660C (en) Hainan micromonosporin with antibiotic generation
CN111187735B (en) Pseudo-cladoniums 203 as well as culture method and application thereof
CN1944630A (en) Streptomyces vietnamensis
CN101665776A (en) Benzazole and methylindol degradation strain LPC24

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080709

Termination date: 20101104