CN1793326A - Chlorine resisting strain No.1 and screening process thereof - Google Patents
Chlorine resisting strain No.1 and screening process thereof Download PDFInfo
- Publication number
- CN1793326A CN1793326A CN 200510019751 CN200510019751A CN1793326A CN 1793326 A CN1793326 A CN 1793326A CN 200510019751 CN200510019751 CN 200510019751 CN 200510019751 A CN200510019751 A CN 200510019751A CN 1793326 A CN1793326 A CN 1793326A
- Authority
- CN
- China
- Prior art keywords
- chlorine
- strain
- substratum
- bacteria suspension
- dcreening operation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to chlorine proof microorganism. It is chlorine proof strain No.1. Its features are as follows: it is brevibacterium linens B723-1 CCTCC NO.M205122; its colonial morphologies are creamy white, rule circular, un-transparent, smooth, stiff, and pink after 5M KOH processing; physiological characteristics that young bacterial is irregular baculiform, 0.6-1.2um*1.5-6.0um, single or pairs arrangement, common V shape; old is irregular globular, and gram positive; its main biological and chemical features are concurrently character anaerobic, chemoheterotrophic bacteria, contacting enzyme positive, oxidase negative, producing arginine double hydrolase, lysine decarboxylase, ornithine decarboxylase, and urease, and producing acid from glucose, no moving, no spore; its optimum temperature is 25-37 centigrade degree. It can live in high concentration chloride ion condition, and high effectively degrade high concentration organic pollutant.
Description
Technical field
The present invention relates to a kind of anti-chlorine microorganism and screening method thereof.
Background technology
Common micro-organisms is limited to the tolerance of chlorion, and when chlorine ion concentration was less than 4000mg/L generally speaking, microorganism can grow, and can not be subjected to the obvious suppression effect.But, if chlorine ion concentration greater than 4000mg/L, then chlorion sharply manifests with the raising of chlorine ion concentration inhibition even the toxic action of microorganism, causes common micro-organisms not survive.Yet at occurring in nature, also exist some extraordinary microorganisms, they are containing high-concentration chlorine ion, or even can normal growth in the environment of extreme high-concentration chlorine ion (5000-80000mg/L), and this quasi-microorganism can be called anti-chlorine microorganism.
But, be not the processing that all anti-chlorine microorganisms can be applied to contain high-concentration chlorine ion wastewater, must just can obtain not only can tolerating high-concentration chlorine ion environment, but also the anti-chlorine microorganism of the organic special type of degradable waste water middle and high concentration through strict screening and domestication.
Summary of the invention
No. 1, the chlorine resisting strain and the screening method thereof that the object of the present invention is to provide a strain to handle to contain high-concentration chlorine ion wastewater.
No. 1, chlorine resisting strain provided by the present invention, be extension brevibacterium (Brevibacterium linens) B723-1 CCTCCNO.M205122, Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCC NO.M205122 have been preserved in on October 24th, 2005.
The colonial morphology that No. 1, a described chlorine-resisting strain: bacterium colony is creamy white (aged bacterium is orange), the rule circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterium pinkiness after 5M KOH handles; Physiological characteristic: children bacterium in age is irregular shaft-like, 0.6～1.2 μ m * 1.5～6.0 μ m, and single or paired arrangement, normal V-shaped arrangement, aged bacterium is spherical, has the typical club cycle, Gram-positive; Main biochemical character: strict aerobic, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase and urase, produces small amount of acid from glucose, do not move, do not give birth to spore, 25～37 ℃ of optimum growth temperatures.
The screening method that No. 1, one chlorine-resisting strain:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-1, promptly No. 1, chlorine resisting strain.
Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl
215.6g/L, pH=7.5.
The present invention screens a strain has the certain growth ability under the high-concentration chlorine ion condition new bacterial strain from the saponin waste water pool bottom sludge.And its anti-chlorine ability studied, the result shows that under the high-concentration chlorine ion condition, the anti-chlorine ability that No. 1, chlorine resisting strain is good, widest in area, can be at [Cl
-] have energy for growth preferably during for 5000-80000mg/L.One chlorine-resisting strain has the ability of COD in the good removal saponin waste water for No. 1, can remove the COD 51.85% in the waste water within 72 hours.But the new bacterial strain that the present invention obtains not only can effectively be handled such as extremely unmanageable special waters such as turmeric saponin wastewaters containing existence under the high-concentration chlorine ion environment, but also efficient degradation high concentration organic contaminant.
Description of drawings
Fig. 1-the 1st, bacterial strain B723-1 is growing state figure on liquid SC substratum
Fig. 2-the 1st, and the PCR product agarose electrophoresis figure of bacterial strain B723-1 (1: nuclear DNA, 2: amplified production, M:Marker)
Fig. 3-the 1st, bacterial strain B723-1 colonial morphology figure
Fig. 3-the 2nd, bacterial strain B723-1 bacterial strain Electronic Speculum picture
Fig. 4-the 1st, bacterial strain B723-1 is at high COD difference [Cl
-] efficiency diagram of degrading under the condition
Embodiment
One, the screening method of No. 1, a chlorine-resisting strain:
(1), material is prepared:
1, experiment waste water and pool bottom sludge are taken from the female Home Co., Ltd in Shiyan side, Hubei Province saponin waste water equalizing tank.
2, substratum: SM substratum: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Agar 20g (Gu); CaCl
215.6g/L, pH=7.5.
SC substratum: in the SM substratum, add the chlorion of different concns (90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000,0.5 ten thousand mg/L) according to the experiment needs.
3, laboratory apparatus and equipment:
State China SHA-B constant temperature oscillator,
SHH150G illumination bio-incubator,
Horizontal pressure steam sterilizer-----Shanghai Medical Nuclear Instrument Factory,
WMX-1 type microwave seal is cleared up COD tacheometer/-----Shantou City engineering main office of being surrounded by sea,
722S spectrophotometer-----Prism Optical Technology Co,
Opticmicroscope-----Olympus company limited,
PH meter etc.-----Hana company limited,
Bechtop,
Air dry oven,
The KYKY-1000B scanning electronic microscope,
PTC200 type PCR instrument,
Electrophoresis apparatus and electrophoresis chamber,
Gel ultraviolet visualizer,
DDS-11 type conductivity meter,
(2), the screening and separating of bacterial strain and purifying:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly (as 10 times) purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-1, promptly No. 1, chlorine resisting strain.
Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl
215.6g/L, pH=7.5.
Through preliminary screening and separating for several times purifying, obtain a strain bacterial strain B723-1 at last, promptly No. 1, chlorine resisting strain.Growing state is as Figure 1-1 on the liquid SM substratum that adds the different concns chlorion for No. 1, chlorine resisting strain.
Two, the microorganism strains of anti-chlorine is identified:
1, to the evaluation of the stronger bacterial strain B723-1 of chlorine-resistant property:
The stronger bacterial strain B723-1 of chlorine-resistant property is carried out the evaluation of Physiology and biochemistry and the evaluation of 16S rRNA molecule, determined the kind of chlorine resisting strain from molecular level.
16S rDNA sequential analysis is mainly according to following steps:
1) extract bacterium nuclear DNA,
A) collection bacterium: choose single colony inoculation with autoclaved toothpick and in LB liquid pipe, cultivated 18 hours, get its bacteria suspension 1ml centrifugal 5min of 8000rpm in the centrifuge tube of 1.5ml, abandon supernatant liquor.
B) add STE 1ml and wash once, the resuspended bacterium of vibrating, the centrifugal 5min of 8000rpm abandons supernatant liquor.
C) add 600 μ lTE, the resuspended bacterium of thermal agitation, the SDS 65 μ l of adding 10%, 65 ℃ of water-bath 5-10min.
D) add equal-volume phenol chloroform extracting three times.
E) carefully draw supernatant liquor, add the 3MNaAc of isopyknic Virahol and 1/10 volume, the centrifugal 10min of 12000rpm.Thoroughly abandon supernatant.
F) DNA precipitation is washed once with 70% ethanol, and it is standby to be dissolved in 20 μ lTE after air-dry.
TE damping fluid: 10mmol/L Tris-Cl (pH8.0); 1mmol/L EDTA-Na2 (pH8.0),
STE damping fluid: 0.1mol/L NaCl 10mmol/L Tris-Cl (pH8.0) 1mmol/L EDTA (pH8.0),
2) pcr amplification of 16S rDNA gene,
The pcr amplification primer is synthetic with reference to people's such as Weisburg method.
P1: forward primer 5 ' AGAGTTTGATCCTGGCTCAG3 '
P2: reverse primer 5 ' GGTTACCTTGTTACGACTT3 '
In 50 μ L reaction volumes, add 1 μ L template DNA (0.1 μ g), 0.5 μ L P1 and P2 (final concentration is 0.5 μ M), 1 μ LdNTP (every kind of NTP0.2mM), 0.5 μ LTaq polysaccharase (2U) and 5 μ L, 10 * PCR damping fluid.The pcr amplification condition is: 94 ℃ of pre-sex change 5min; At 94 ℃ of sex change 30s, 61-65 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 30 times; Last 72 ℃ are extended 10min eventually.
3) recovery of PCR product
After the PCR product carried out electrophoresis with 1% sepharose, under ultraviolet lamp, cut and contain desire and reclaim segmental gel, put into the 1.5ml centrifuge tube and add 2 times of volume TE, 65 ℃ of water-baths add the extracting of equal-volume water-saturated phenol and get the upper strata water after once centrifugal and use that phenol-chloroform-the primary isoamyl alcohol extracting once again after 10 minutes, reset and add 10mol/L ammonium acetate and 2 times of volume dehydrated alcohol precipitations of 0.1 times of volume in the collection, centrifugal, wash precipitation once with 70% ethanol, be dissolved in an amount of sterilization distilled water after air-dry.
4) complete sequence determination of 16S rDNA and analysis
The PCR order-checking is synthetic with reference to people's methods such as Hiraishi with forward and reverse primer.
P-f：CACGACGTTGTAAAACGACAGTTTGATCCTGGCTC；
P-r：GGATAACAATTTCACACAGGAAGGAGGTGATCCAGCC。
Add 1 μ L template DNA (＜0.1 μ g), 30 circulations of pcr amplification (94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 2min).Adopt dyestuff terminator termination reaction in the ABI PRISM sequencing kit.Then, on Applied Biosystem 373A dna sequencing instrument, check order.The 16S rDNA sequence that records adopts BLAST software and the comparative analysis of GenBank database, finally determines the kind of this bacterium from molecular level.
2,16S rDNA sequencing:
The present invention adopts the method for 16S rRNA sequencing and analysis is carried out the evaluation of molecular level to bacterium.Nuclear DNA with bacterium is a template, is primer with the universal primer of the pcr amplification of 16S rRNA gene, carries out pcr amplification, obtains the amplified band that length is 1484bp (detecting with 1% agarose gel electrophoresis), shown in Fig. 2-1.After the PCR product is purified, measure its complete sequence.
＜110〉China Geological Univ. Wuhan
＜120〉No. 1, chlorine resisting strain and screening method thereof
<160>1484
<210>1
<211>1484bp
<212>DNA
＜213〉extension brevibacterium (Brevibacterium linens)
<220>
<221>misc_feature
<222>
<400>1
Taccttgtta?cgacttagtc?ccaatcacca?gtcccaccct?agacggcccc?ctccacaagg 60
gttgggacac?cggcttcggg?tgttaccgac?tttcgtgact?tgacgggcgg?tgtgtacaag 120
gcccgggaac?gtattcaccg?cagcgttgct?gatctgcgat?tactagcgac?tccgacttca 180
cgtagtcgaa?ttgcagacta?cgatccgaac?tgagactggc?tttaagggat?tcgcttaccc 240
tcacgggttc?gcctctctct?gtaccagcca?ttgtagcatg?cgtgaagccc?aagacataaa 300
gggcatgatg?atttgacgtc?atccccacct?tcctccgagt?tgaccccggc?agtctcctat 360
gagttcccac?catcacgtgc?tggcaacata?gaacgagggt?tgcgctcgtt?gcgggactta 420
acccaacatc?tcacgacacg?agctgacgac?aaccatgcac?cacctgtaca?ccagctccaa 480
agagaagaac?tgtttccaga?acggtccagt?gtatgtcaag?ccttggtaag?gttcttcgcg 540
ttgcatcgaa?ttaatccgca?tgctccgccg?cttgtgcggg?cccccgtcaa?ttcctttgag 600
ttttagcctt?gcgaccgtac?ttccccaggc?ggggcactta?atgcgttagc?tacggcgcgg 660
aagaacgtgg?aatgtccccc?acacctagtg?cccaacgttt?acggcatgga?ctaccagggt 720
atctaatcct?gktcgctccc?catgctttcg?ctcctcagtg?tcagttacag?cccagagtcc 780
gcttcgccac?cgggtgttct?cctgatatct?gcgcatttca?ccgctacacc?aggaattcca 840
gacttcccta?ctgcactcta?gtcagccgta?cccactgcac?gcgcaacgtt?aagcgttgcg 900
tttccacagc?agacgtgacc?aaccactacg?agctctttac?gcccaataat?tccggacaac 960
gctcgtaccc?tacgtattac?cgcggctgct?ggcacgtagt?tagccggtac?ttcttctgca 1020
ggtaccgtca?ctttcgcttc?ttccctgctg?aaagcggttt?acaacccgaa?ggccgtcatc 1080
ccgcacgctg?cgtcgctgca?tcagggtttc?ccccattgtg?caatattccc?cactgctgcc 1140
tcccgtagga?gtctgggccg?tgtctcagtc?ccagtgtggc?cggtcgccct?ctcaggccgg 1200
ctacccgtcg?tcgccttggt?aggccattac?cccaccaaca?agctgatagg?ccgcgagccc 1260
atccccgatc?gaaaaacttt?ccaccaccca?acatgcgtca?ggaggtcata?tccggtatta 1320
gacccagttt?cccaggctta?tcccgaaatc?aggggcaggt?tactcacgtg?ttactcaccc 1380
gttcgccact?catccaccaa?cagcaagctg?tcggcttcag?cgttcgactt?gcatgtgtta 1440
agcacgcagc?cagcgttcgt?cctgagccag?gatcaaactc?taat 1484
Three, colony morphology characteristic and physio-biochemical characteristics:
Colonial morphology to bacterial strain B723-1 has carried out careful observation, the results are shown in Figure 3-1.To the apparent scanning electron microscopic observation of also having done of bacterium, the results are shown in Figure 3-2 simultaneously.The colonial morphology of bacterial strain B723-1: bacterium colony is creamy white (aged bacterium is orange), the rule circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterium pinkiness after 5M KOH handles; Physiological characteristic: children bacterium in age is irregular shaft-like, 0.6～1.2 μ m * 1.5～6.0 μ m, and single or paired arrangement, normal V-shaped arrangement, aged bacterium is spherical, has the typical club cycle, Gram-positive; Main biochemical character: strict aerobic, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase and urase, produces small amount of acid from glucose, do not move, do not give birth to spore, 25～37 ℃ of optimum growth temperatures.
Four, bacterial strain B723-1 is new bacterial strain:
Adopt the BLAST analytical method that 16S rRNA gene order and the comparative analysis of GenBank database of bacterial strain B723-1 are found that the homology of bacterial strain B723-1 and extension brevibacterium (Brevibacterium linens) is up to 99.0%.
The Physiology and biochemistry and the Molecular Identification result of comprehensive bacterial strain, bacterial strain B723-1 called after extension brevibacterium (Brevibacterium linens) B723-1.Consult pertinent data, still do not have organic wastewater with difficult degradation thereby under the relevant high-concentration chlorine ion condition of brevibacterium sp and the report of its anti-chlorine capability study.Extension brevibacterium (Brevibacterium linens) B723-1 was new bacterial strain, had been preserved in Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCC NO.M205122 on October 24th, 2005.
The present invention's screening and separating from the saponin waste water pool bottom sludge of Shiyan, Hubei Province goes out this strain bacterium, and finds the function that it has better degrading high concentration chlorion difficult degradation saponin waste water.This has widened people to the applied research thinking of extension brevibacterium (Brevibacteriumlinens) in its function aspects, and provides useful bacterium source and technology for degraded contains the high-concentration chlorine ion saponin waste water, has stronger actual application value.
Five, the application of No. 1, chlorine resisting strain:
(1), the single bacterium colony of picking extension brevibacterium (Brevibacterium linens) B723-1, overnight incubation in the SM substratum, by extension brevibacterium (Brevibacterium linens) B723-1 after cultivating: the volume ratio that contains high-concentration chlorine ion wastewater (as mixing saponin waste water) is 0.5-2: 100 get extension brevibacterium (Brevibacterium linens) B723-1 is inoculated in and contains in high-concentration chlorine ion (5000-80000mg/L) waste water (as mixing saponin waste water), 20-40 ℃ of constant temperature culture, jolting speed is 100-180rpm, the pH value is 7-8, reacts 24-72 hour; Described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Agar 20g (Gu); CaCl
215.6g/L, pH=7.5.
(2), bacterial strain B723-1 is to the saponin waste water degradation capability:
Get saponin and produce composite waste, the dilution certain multiple, making its COD is 5400mg/L, [Cl
-] be: 20,000 mg/L.Get saponin composite waste 50ml and add respectively in the Erlenmeyer flask of 250ml, add the bacteria suspension 1ml of bacterial strain B723-1 respectively, 30 ℃, 150rpm, pH value=7.1-7.5, shaking table vibration 3d calculates COD and the Cl of bacterial strain to waste water
-The removal situation, bacterial strain B723-1 removes the excellent in efficiency of COD, is 51.8%.
(3), chlorine ion concentration is to the influence of B723-1 degraded saponin waste water ability:
In order to investigate bacterial strain when high concentration COD (17136mg/L), under different chlorine ion concentrations,, in waste water, add CaCl to the removal effect of COD
29240.2,17988.6,25734.2,35860.4,44803.1mg/L the adjusting chlorine ion concentration is respectively:.Chlorine resisting strain B723-1 removal effect result such as Fig. 4-1.
From Fig. 4-1 as can be seen, as [Cl
-During]=9420mg/L, reaction times is 24h, bacterial strain B723-1 can reach 42.16% to the clearance of COD, but along with the reaction times prolongs, bacterial strain B723-1 can not increase the clearance of COD, can be utilized by microorganism in a short period of time by the degradable substance of biological utilisation in this explanation waste water, have not biodegradable material in the saponin waste water; As 9240.2mg/L＜[Cl
-]＜25734.2mg/L, the reaction times is when being 24h, bacterial strain B723-1 slightly descends during [Cl-]=9420mg/L to the clearance of COD, but along with the prolongation in reaction times, its final degradation efficiency is still better.There is a lag phase in time in this explanation chlorine ion concentration is removed COD to chlorine resisting strain in saponin waste water ability.
Claims (4)
1, No. 1, a chlorine-resisting strain, it is characterized in that described bacterial strain is extension brevibacterium (Brevibacterium linens) B723-1 CCTCC NO.M205122.
2. No. 1, a chlorine-resisting strain according to claim 1, it is characterized in that: the colonial morphology that No. 1, chlorine resisting strain: bacterium colony is creamy white, the rule circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterium pinkiness after 5M KOH handles; Physiological characteristic: children bacterium in age is irregular shaft-like, 0.6～1.2 μ m * 1.5～6.0 μ m, and single or paired arrangement, normal V-shaped arrangement, aged bacterium is spherical, has the typical club cycle, Gram-positive; Main biochemical character: strict aerobic, chemoheterotrophic bacteria, the catalase positive, oxidase negative produces arginine dihydrolase, lysine decarboxylase, ornithine decarboxylase and urase, produces small amount of acid from glucose, do not move, do not give birth to spore, 25～37 ℃ of optimum growth temperatures.
3. the screening method that No. 1, a chlorine-resisting strain as claimed in claim 1 is characterized in that:
1), primary dcreening operation: preparation primary dcreening operation bacteria suspension: take by weighing at the bottom of the saponin waste water equalizing tank pond that sewage 1mL is inoculated in the autoclaved SM substratum in bed mud sample 1g or the saponin waste water equalizing tank, 30 ℃-37 cultured continuously were carried out enrichment in 30 days, the primary dcreening operation bacteria suspension; Get primary dcreening operation bacteria suspension 20 μ l and coat solid SM substratum; In single bacterium colony enlarged culturing in liquid SM substratum of picking different shape on the primary dcreening operation flat board, the step of going forward side by side is coated with separation, through repeatedly purifying, separation, obtains the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the SM substratum, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension;
2), postsearch screening: bacteria suspension is sieved in preparation again: in 100ml concentration is the liquid SM substratum of chlorion of 90,000,80,000,70,000,60,000,50,000,40,000,30,000,20,000,10,000 or 0.5 ten thousand mg/L, the isolate suspension 50 μ l that add the primary dcreening operation isolate, 30 ℃ of constant temperature joltings 5-7 days must be sieved bacteria suspension again; Get multiple sieve bacteria suspension 20 μ l and be applied to solid SM substratum, 30 ℃ constant temperature culture 1-2 days, observe also record bacterial growth situation and colonial morphology; Obtain the bacterial strain that a strain is numbered bacterial strain B723-1, promptly No. 1, chlorine resisting strain.
4. the screening method that No. 1, a chlorine-resisting strain according to claim 3 is characterized in that: described SM substratum is: peptone 10g; Extractum carnis 5g; Distilled water 1000ml; Gu shape agar 20g; CaCl
215.6g/L, pH=7.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100197519A CN100400646C (en) | 2005-11-04 | 2005-11-04 | Chlorine resisting strain No.1 and screening process thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100197519A CN100400646C (en) | 2005-11-04 | 2005-11-04 | Chlorine resisting strain No.1 and screening process thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1793326A true CN1793326A (en) | 2006-06-28 |
| CN100400646C CN100400646C (en) | 2008-07-09 |
Family
ID=36804976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100197519A Expired - Fee Related CN100400646C (en) | 2005-11-04 | 2005-11-04 | Chlorine resisting strain No.1 and screening process thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100400646C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106635882A (en) * | 2016-10-28 | 2017-05-10 | 中国科学院海洋研究所 | Calcium carbonate producing actinomycetes and application thereof |
| CN107502579A (en) * | 2017-09-28 | 2017-12-22 | 山东省城市供排水水质监测中心 | A kind of method for screening and separating of chlorine-resistant bacterium and its one plant of obtained land gordonella |
-
2005
- 2005-11-04 CN CNB2005100197519A patent/CN100400646C/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106635882A (en) * | 2016-10-28 | 2017-05-10 | 中国科学院海洋研究所 | Calcium carbonate producing actinomycetes and application thereof |
| CN107502579A (en) * | 2017-09-28 | 2017-12-22 | 山东省城市供排水水质监测中心 | A kind of method for screening and separating of chlorine-resistant bacterium and its one plant of obtained land gordonella |
| CN107502579B (en) * | 2017-09-28 | 2020-03-24 | 山东省城市供排水水质监测中心 | Screening and separating method for chlorine-resistant bacteria and Gordonia terranei strain obtained by screening and separating method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100400646C (en) | 2008-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108220169B (en) | Separation screening and identification method of strain for degrading polystyrene | |
| CN1807594A (en) | Separation and authentication method for denitrifying bacteria with anaerobic ammoxidation activity | |
| CN111100815B (en) | Pseudomonas for degrading PBAT (poly (butylene adipate-co-terephthalate)) plastic and application thereof | |
| CN110616178B (en) | Alcaligenes faecalis phenol subspecies screening culture method | |
| CN110699297A (en) | Alcaligenes faecalis phenol subspecies and application thereof | |
| CN1793326A (en) | Chlorine resisting strain No.1 and screening process thereof | |
| CN111440749A (en) | Pseudomonas pseudoalcaligenes sp.H3, screening method and application | |
| CN113249276B (en) | Bacillus cereus and application thereof | |
| CN1793327A (en) | No.3 Chlorine resisting strain and screening process thereof | |
| CN1900272A (en) | Chlorine resistant strain V430 and its screening method | |
| CN1792888A (en) | Application of chlorine resisting strain No.1 | |
| CN1840654A (en) | Chloride ion resistant strain S616 and its screening method | |
| CN1792889A (en) | Application of chlorine resisting strain No.3 | |
| CN1618953A (en) | Sphingol monospore bacterial strain and its application in anthraquinone dye waste water decolour | |
| CN1896016A (en) | Use of chlorine-resisting strain S616 | |
| CN1594539A (en) | Specific strain for degrading organic waste water of medicine production and its construction method | |
| CN1944630A (en) | Streptomyces vietnamensis | |
| CN101665776A (en) | Benzazole and methylindol degradation strain LPC24 | |
| CN1280408C (en) | Self floculation hydrogen producing bacteria and its sieving method | |
| CN1900283A (en) | Gene of chlorine tolerance strain V430 | |
| CN1896242A (en) | Gene of chlorine-resisting strain S616 | |
| CN1904032A (en) | Xanthan gum degradation bacteria, its fermentation method and application | |
| CN102952767B (en) | Pseudomonas psychrophila HA-4 low-temperature sulfamethoxazole degrading bacteria as well as screening method and application thereof | |
| CN111187735B (en) | Pseudo-cladoniums 203 as well as culture method and application thereof | |
| CN100340660C (en) | Hainan micromonosporin with antibiotic generation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080709 Termination date: 20101104 |