CN101665776A - Benzazole and methylindol degradation strain LPC24 - Google Patents
Benzazole and methylindol degradation strain LPC24 Download PDFInfo
- Publication number
- CN101665776A CN101665776A CN200910063067A CN200910063067A CN101665776A CN 101665776 A CN101665776 A CN 101665776A CN 200910063067 A CN200910063067 A CN 200910063067A CN 200910063067 A CN200910063067 A CN 200910063067A CN 101665776 A CN101665776 A CN 101665776A
- Authority
- CN
- China
- Prior art keywords
- lpc24
- strain
- indoles
- skatole
- benzazole
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to a benzazole and methylindol degradation microorganism, in particular to a benzazole and methylindol degradation strain LPC24, which is characterized by being pseudomonas.putida LPC24 CCTCC NO:M 209099. The colonial morphology is as follows: the bacterial colony is off-white, regularly circular, opaque, viscous, smooth in surface and convex in center as well as neat in edge, and is a sphere bulge; the physiological feature is as follows: the strain is in a straight or slightly-bent bar shape, (0.7-1.1)*(2.0-4.0) micrometers, is arranged in one or pairing way, and is Gram-negative; main biochemical characters are as follows: the strain integrates anaerobic, is chemoheterotrophic bacteria, utilizes nitrate, is positive in oxidase, produces arginine dihydrolase and urease and is movable without producing spores; and the optimum growth temperature is 25-37DEG C. The invention has better capacity of removing benzazole and methylindol in the poultry wastewater.
Description
Technical field
The present invention relates to a kind of indoles and skatole degraded microorganism.
Background technology
Indoles and skatole are the heteroaromatic hydrocarbon compounds of foul smelling smell main in the livestock and poultry farm waste water, and they are decomposed in animal body by tryptophane and produce.These two kinds of compounds appear in the factory effluent of medical treatment product, sterilant, sterilizing agent, agricultural chemical industry articles for use equally.The large-scale production of these chemical substances and application have widely caused soil, surface water and phreatic pollution, and human body and animal health have been caused serious threat.Indoles and skatole can be absorbed by human body and animal enter blood, produces deleterious intermediate product and influence the generation of varies in the blood behind bioactivation, even produce haemolysis.There are some researches show that the rising of animal body inner estrogen ketone concentration is directly related with skatole content.In addition, skatole still is a kind of pneumotoxin.The plant tissue that is exposed under the indoles environment shows Hypopigmentation owing to the anthraquinone synthetic influences.There are toxic effect in indoles and skatole to many microorganisms equally.They all have biological quite widely restraining effect to bacterium, simultaneously to the also toxic effect of cud cilium microorganism.
Because the refractory organics and the bio-toxicity thereof of indoles and skatole, the bacterium of this compounds of degrading are difficult to separate.Though forefathers did some about the work of mixing microorganisms Research on degradation, report is also seldom seen in the degraded of indoles or skatole about pure bacterium.
Summary of the invention
The object of the present invention is to provide a strain indoles and skatole degradation bacteria strains LPC24, it has the ability of indoles and skatole in the good removal livestock breeding wastewater.
A strain indoles provided by the present invention and skatole degradation bacteria strains LPC24, be pseudomonas putida (Psedomonas.putida) LPC24 CCTCC NO:M 209099, Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCC NO:M 209099 have been preserved in on May 6th, 2009.
The colonial morphology of one strain indoles and skatole degradation bacteria strains LPC24 is: bacterium colony is rice white (aged bacterium is beige), rule is circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterial strain physiological characteristic: be straight or little curved shaft-like, 0.7～1.1 μ m * 2.0～4.0 μ m, single or paired arrangement, Gram-negative; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria can utilize nitrate, and oxidase positive produces arginine dihydrolase and urase, and spore, 25～37 ℃ of optimum growth temperatures are not given birth in motion.
Described livestock and poultry mainly contain pig, ox, sheep, donkey, rabbit, chicken, duck, goose etc.
The invention has the beneficial effects as follows: from the active sludge of the anaerobic reactor of livestock breeding wastewater, screen a strain and containing the new bacterial strain that has the certain growth ability under skatole and the indoles condition.One strain indoles and skatole degradation bacteria strains LPC24 have the ability of indoles and skatole in the good removal livestock breeding wastewater, and this bacterial strain can make the removal efficient of indoles and skatole improve 20-30%.
Description of drawings
Fig. 1 be a strain indoles and skatole degradation bacteria strains LPC24 PCR product agarose electrophoresis figure (1: nuclear DNA, 2: amplified production, M:Marker).
Fig. 2 is the Electronic Speculum picture of a strain indoles and skatole degradation bacteria strains LPC24.
Fig. 3 is a strain indoles and the degradation efficiency figure of skatole degradation bacteria strains LPC24 in the artificial wastewater of containing 0.5mM indoles and skatole.
Embodiment
One, the screening method of a strain indoles and skatole degradation bacteria:
(1), material is prepared:
1, experiment waste water (livestock breeding wastewater) is taken from Hubei Province, Ezhou, Hubei Province original seed pig farm sewage draining exit, active sludge is taken from environment institute of China Geological Univ. Wuhan special water treating lab, in the anaerobic reactor of a processing livestock breeding wastewater (experiment waste water is taken from Hubei Province, Ezhou, Hubei Province original seed pig farm sewage draining exit in the anaerobic reactor).
2, substratum:
Liquid MSM substratum (g/L): (NH
4)
2SO
4, 0.33; NaNO
3, 0.85; K
2HPO
4, 0.79; KH
2PO
4, 0.20; CaCl
2, 0.05; MgCl
2, 0.50; FeCl
2, 0.01, H
2O 1000mL; PH is 7.2; Adopt skatole and indoles after the filtration sterilization behind the autoclaving, make that the concentration of skatole and indoles is 1.0mM in the liquid MSM substratum.
Solid MSM substratum (g/L): (NH
4)
2SO
4, 0.33; NaNO
3, 0.85; K
2HPO
4, 0.79; KH
2PO
4, 0.20; CaCl
2, 0.05; MgCl
2, 0.50; FeCl
2, 0.01, H
2O 1000mL; Agar 15g, pH are 7.2; Adopt skatole and indoles after the filtration sterilization behind the autoclaving, make that the concentration of skatole and indoles is 1.0mM in the liquid MSM substratum.
The LB liquid nutrient medium is: peptone 10.0g, yeast extract 5.0g, NaCl 10.0g, distilled water 1000mL, pH7.0.
The LB solid medium is: peptone 10.0g, yeast extract 5.0g, NaCl 10.0g, distilled water 1000mL, agar 15g, pH7.0.
3, laboratory apparatus and equipment:
State China SHA-B constant temperature oscillator,
SHH150G illumination bio-incubator,
Horizontal pressure steam sterilizer------Shanghai Medical Nuclear Instrument Factory,
WMX-1 type microwave seal is cleared up COD tacheometer/-----Shantou City engineering main office of being surrounded by sea,
722S spectrophotometer-----Prism Optical Technology Co,
Opticmicroscope-----Olympus company limited,
PH meter etc.-----Hana company limited,
Bechtop,
Air dry oven,
The JEM-100CX11 transmission electron microscope,
PTC200 type PCR instrument,
Electrophoresis apparatus and electrophoresis chamber,
Gel ultraviolet visualizer,
DDS-11 type conductivity meter,
(2), the screening and separating of bacterial strain and purifying:
1), primary dcreening operation: adopt direct coating method
Get the experiment waste water (livestock breeding wastewater) that is moved in the active sludge 1g{ reactor in the anaerobic reactor of steady running more than three months and be taken from original seed pig farm, Hubei Province, Ezhou sewage draining exit }, add the 50mL sterile distilled water, speed with 5000 rev/mins is centrifugal, and supernatant liquor is removed in centrifugal back; Add the 50mL sterile distilled water again, centrifugal with 5000 rev/mins speed, so repetitive operation is three times, obtains throw out;
Then throw out is diluted to 100mL with sterilized water, obtains bacteria suspension; Get above-mentioned bacteria suspension 20 μ L then and coat the skatole that contains 1.0mM and the solid MSM substratum of indoles, cultivate a week for 30 ℃, select flat board (promptly scribbling the plate of solid MSM substratum) and go up single bacterium colony enlarged culturing in liquid MSM substratum of different shape, go forward side by side one the step be coated with separation, { purifying, separation: a little is rule on flat board to get culture (bacterium colony on the LB flat board) with aseptic transfering loop through 3-5 purifying, separation; When transfering loop was mobile backward on LB solid culture primary surface, the bacterium liquid on the transfering loop diluted gradually, and individual cells is scattered here and there on the line of being drawn at last, through cultivating, each cell grows up to a bacterium colony, promptly obtains the single bacterium colony behind the purifying }, obtain the slate of different colonial morphologies at last; Single bacterium colony of picking slate is in the LB liquid nutrient medium, and 30 ℃ of constant temperature culture are spent the night, and must separate bacteria suspension, obtain the primary dcreening operation bacteria suspension;
2), postsearch screening: get primary dcreening operation bacteria suspension 1mL, centrifugal 5 minutes of 5000 rev/mins speed is abandoned supernatant, resuspended with sterilized water, add 100mL and contain in the liquid MSM substratum of 1.0mM skatole and indoles, 30 ℃ of constant temperature culture 7 days detect the removal efficient of indoles, skatole in the substratum; Choose and remove the bacteria suspension of efficient, get multiple sieve bacteria suspension 20 μ L and be applied to solid MSM substratum, 30 ℃ of one weeks of constant temperature culture day, observe also record bacterial growth situation and colonial morphology greater than 50% bacterial strain; Obtain the bacterial strain (bacterial strain LPC24) that a strain is numbered LPC24, i.e. a strain indoles and skatole degradation bacteria strains LPC24.
Two, the evaluation of indoles and skatole degradation bacteria strains LPC24:
1, to the evaluation of a strain indoles and skatole degradation bacteria strains LPC24:
One strain indoles and skatole degradation bacteria strains LPC24 are carried out the evaluation of Physiology and biochemistry and the evaluation of 16S rRNA molecule, determined the kind of bacterial strain LPC24 from molecular level.
16S rRNA sequential analysis is mainly according to following steps:
1) extract bacterium nuclear DNA,
A) collection bacterium: choose single colony inoculation with autoclaved toothpick and in LB liquid pipe, cultivated 15 hours, get its bacteria suspension 1mL centrifugal 5min of 8000rpm in the centrifuge tube of 1.5mL, abandon supernatant liquor.
B) add STE 1mL and wash once, the resuspended bacterium of vibrating, the centrifugal 5min of 8000rpm abandons supernatant liquor.
C) add 600 μ LTE, the resuspended bacterium of thermal agitation, the SDS 65 μ L of adding 10%, 65 ℃ of water-bath 5-10min.
D) add equal-volume phenol chloroform extracting three times.
E) carefully draw supernatant liquor, add the 3MNaAc of isopyknic Virahol and 1/10 volume, the centrifugal 10min of 12000rpm.Thoroughly abandon supernatant.
F) DNA precipitation is washed once with 70% ethanol, and it is standby to be dissolved in 20 μ LTE after air-dry.
TE damping fluid: 10mmol/L Tris-Cl (pH8.0); 1mmol/L EDTA-Na2 (pH8.0);
STE damping fluid: 0.1mol/L NaCl; 10mmol/L Tris-Cl (pH8.0); 1mmol/L EDTA (pH8.0);
2) pcr amplification of 16S rRNA gene,
The pcr amplification primer is synthetic with reference to people's such as Weisburg method.
P1: forward primer 5 ' AGAGTTTGATCCTGGCTCAG3 '
P2: reverse primer 5 ' GGTTACCTTGTTACGACTT3 '
In 50 μ L reaction volumes, add 1 μ L template DNA (0.1 μ g), 0.5 μ L P1 and P2 (final concentration is 0.5 μ M), 1 μ LdNTP (every kind of NTP0.2mM), 0.5 μ LTaq polysaccharase (2U) and 5 μ L, 10 * PCR damping fluid.The pcr amplification condition is: 94 ℃ of pre-sex change 5min; At 94 ℃ of sex change 30s, 61-65 ℃ of annealing 30s, 72 ℃ are extended 1min, circulate 30 times; Last 72 ℃ are extended 10min eventually.
3) purifying of PCR product reclaims
After the PCR product carried out electrophoresis with 1% sepharose, under ultraviolet lamp, cut and contain desire and reclaim segmental gel, put into the 1.5mL centrifuge tube and add 2 times of volume TE, 65 ℃ of water-baths add the extracting of equal-volume water-saturated phenol and get the upper strata water after once centrifugal and use that phenol-chloroform-the primary isoamyl alcohol extracting once again after 10 minutes, reset and add 10mol/L ammonium acetate and 2 times of volume dehydrated alcohol precipitations of 0.1 times of volume in the collection, centrifugal, wash precipitation once with 70% ethanol, be dissolved in an amount of sterilization distilled water after air-dry.
4) complete sequence determination of 16S rDNA and analysis
The PCR order-checking is synthetic with reference to people's methods such as Hiraishi with forward and reverse primer.
P-f：CACGACGTTGTAAAACGACAGTTTGATCCTGGCTC；
P-r：GGATAACAATTTCACACAGGAAGGAGGTGATCCAGCC。
Add 1 μ L template DNA (＜0.1 μ g), 30 circulations of pcr amplification (94 ℃ of 1min, 55 ℃ of 30s, 72 ℃ of 2min).Adopt dyestuff terminator termination reaction in the ABI PRISM sequencing kit.Then, on Applied Biosystem 373A dna sequencing instrument, check order.The 16S rDNA sequence that records adopts BLAST software and the comparative analysis of GenBank database, finally determines the kind of this bacterium from molecular level.
2,16S rRNA sequencing:
The present invention adopts the method for 16SrRNA sequencing and analysis is carried out the evaluation of molecular level to bacterium.Nuclear DNA with bacterium is a template, is primer with the universal primer of the pcr amplification of 16S rRNA gene, carries out pcr amplification, obtains the amplified band that length is 1431bp (detecting with 1% agarose gel electrophoresis), as shown in Figure 1.After the PCR product is purified, measure its complete sequence.
＜110〉China Geological Univ. Wuhan
＜120〉a strain indoles and skatole degradation bacteria strains LPC24
<160>1431
<210>1
<211>1431bp
<212>DNA
＜213〉pseudomonas putida (Pseudomonas putida)
<400>1
CCGTGGTAAC?CGTCCTCCCG?AAGGTTAGAC?TAGCTACTTC?TGGTGCAACC?CACTCCCATG 60
GTGTGACGGG?CGGTGTGTAC?AAGGCCCGGG?AACGTATTCA?CCGCGACATT?CTGATTCGCG 120
ATTACTAGCG?ATTCCGACTT?CACGCAATCG?AGTTGCAGAC?TGCGATCCGG?ACTACGATCG 180
GTTTTGTGAG?ATTAGCTCCA?CCTCGCGGCT?TGGCAACCCT?CTGTACCGAC?CATTGTAACA 240
CGTGTGTAGC?CCAGGCCGTA?AGGGCCATGA?TGACTTGACG?TCATCCCCAC?CTTCCTCCGG 300
TTTGTCACCG?GCAGTCTCCT?TAAAGTGCCC?ACCATTACGT?GCTGGTAACT?AAGGACAAGG 360
GTTGCGCTCG?TTACGGGACT?TAACCCAACA?TCTCACGACA?CGAGCTGACG?ACAGCCATGC 420
AGCACCTGTG?TCAGAATTCC?CGAAGGCACC?AATCCATCTC?TGGAAAGTTC?TCTGCATGTC 480
AAGGCCTGGT?AAGGTTCTTC?GCGTTGCTTC?CAATTAAACC?ACATGCTCCA?CCGCTTGTGC 540
GGGCCCCCGT?CAATTCATTT?GAGTTTTAAC?CTTGCGGCCG?TACTCCCCAG?GCGGTCAACT 600
TAATGCGTTA?GCTGCGCCAC?TAAAATCTCA?AGGATTCCAA?CGGCTAGTTG?ACATCGTTTA 660
CGGCGTGGAC?TACCAGGGTA?TCTAATCCTG?TTTGCTCCCC?CACGCTTTCG?CACCTCAGTG 720
TCAGTATCAG?TCCAGGTGGT?CGCCTTCGCC?ACTGGTGTTC?CTTCCTATAT?CTACGCATTT 780
CACCGCTACA?CAGGAAATTC?CACCACCCTC?TACCGTACTC?TAGCTTGCCA?GTTTTGGATG 840
CAGTTCCCAG?GTTGAGCCCG?GGGCTTTCAC?ATCCAACTTA?ACAAACCACC?TACGCGCGCT 900
TTACGCCCAG?TAATTCCGAT?TAACGCTTGC?ACCCTCTGTA?TTACCGCGGC?TGCTGGCACA 960
GAGTTAGCCG?GTGCTTATTC?TGTCGGTAAC?GTCAAAACAG?CAAGGTATTA?ACTTACTGCC 1020
CTTCCTCCCA?ACTTAAAGTG?CTTTACAATC?CGAAGACCTT?CTTCACACAC?GCGGCATGGC 1080
TGGATCAGGC?TTTCGCCCAT?TGTCCAATAT?TCCCCACTGC?TGCCTCCCGT?AGGAGTCTGG 1140
ACCGTGTCTC?AGTTCCAGTG?TGACTGATCA?TCCTCTCAGA?CCAGTTACGG?ATCGTCGCCT 1200
TGGTGAGCCA?TTACCCCACC?AACTAGCTAA?TCCGACCTAG?GCTCATCTGA?TAGCGCAAGG 1260
CCCGAAGGTC?CCCTGCTTTC?TCCCGTAGGA?CGTATGCGGT?ATTAGCGTTC?CTTTCGAAAC 1320
GTTGTCCCCC?ACTACCAGGC?AGATTCCTAG?GCATTACTCA?CCCGTCCGCC?GCTGAATCAA 1380
GGAGCAAGCT?CCCGTCATCC?GCTCGACTTG?CATGTGTTAG?GCCTGCCGCC?A 1431
Three, colony morphology characteristic and physio-biochemical characteristics:
Colonial morphology to bacterial strain LPC24 has carried out careful observation, this colonial morphology: bacterium colony is rice white (aged bacterium is beige), rule is circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterial strain physiological characteristic: be straight or little curved shaft-like, 0.7～1.1 μ m * 2.0～4.0 μ m, single or paired arrangement, Gram-negative; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria can utilize nitrate, and oxidase positive produces arginine dihydrolase and urase, and spore, 25～37 ℃ of optimum growth temperatures are not given birth in motion.Bacterium is apparent to see transmission electron microscope Fig. 2.
Four, bacterial strain LPC24 is new bacterial strain:
Adopt the BLAST analytical method that 16S rRNA gene order and the comparative analysis of GenBank database of bacterial strain LPC24 are found that the homology of bacterial strain LPC24 and pseudomonas putida (Pseudomonas putida) is up to 99.0%.
The Physiology and biochemistry and the Molecular Identification result of comprehensive bacterial strain, bacterial strain LPC24 called after pseudomonas putida (Pseudomonasputida) LPC24.Pseudomonas putida (Pseudomonas putida) LPC24 was new bacterial strain, had been preserved in Chinese typical culture collection center (being called for short CCTCC), preserving number: CCTCC NO:M 209099 on May 6th, 2009.
The present invention isolates this strain bacterium from the active sludge of livestock breeding wastewater anaerobic reactor, and finds the degraded indoles that it is stronger and the function of skatole.This has widened people to the applied research thinking of pseudomonas putida (Pseudomonas putida) in its function aspects, and for degraded contains indoles and skatole class waste water provides useful bacterium source and technology, has stronger actual application value.
Five, the application of bacterial strain LPC24:
(1), the single bacterium colony of picking pseudomonas putida (Psedomonas.putida) LPC24, overnight incubation in liquid MSM substratum, by pseudomonas putida (Psedomonas.putida) LPC24 after cultivating: the volume ratio that contains indoles and skatole waste water (as livestock breeding wastewater) is 0.5-2: 100 get pseudomonas putida (Psedomonas.putida) LPC24 is inoculated in and contains in indoles and the skatole waste water (as livestock breeding wastewater), 30-35 ℃ of constant temperature culture, the pH value is 6.0-8.0, reacts 3-5 days.
Described liquid MSM substratum is: (NH
4)
2SO
4, 0.33g; NaNO
3, 0.85g; K
2HPO
4, 0.79g; KH
2PO
4, 0.20g; CaCl
2, 0.05g; MgCl
2, 0.50g; FeCl
2, 0.01g; H
2O 1000mL; PH is 7.2; Adopt skatole and indoles after the filtration sterilization behind the autoclaving, make that the concentration of skatole and indoles is 1.0mM (being mmol/L) in the liquid MSM substratum.
(2), bacterial strain LPC24 is to the degradation capability of indoles, skatole:
In order to investigate the degradation capability of bacterial strain, studied in artificial wastewater MSM the ability of degradation by bacteria indoles, skatole to indoles, skatole.Get artificial wastewater MSM{ artificial wastewater MSM (g/L): (NH
4)
2SO
4, 0.33; NaNO
3, 0.85; K
2HPO
4, 0.79; KH
2PO
4, 0.20; CaCl
2, 0.05; MgCl
2, 0.50; FeCl
2, 0.01, pH is 7.2; It is that 1.0mM}100mL adds in the Erlenmeyer flask of 250mL that adding skatole and indoles make its final concentration, bacteria suspension (the bacteria suspension preparation: use transfering loop picking LPC24 bacterium colony in the LB of 10mL liquid nutrient medium that adds bacterial strain LPC24,30 ℃ jolt cultivation 12 hours) 1mL, 30 ℃, static cultivation 18d regularly detect the amount (see figure 3) that remains indoles, skatole.The result shows.This bacterial strain can be degraded the indoles of 0.5mM more than 99% in 10 days, degraded more than 99% the skatole of 0.5mM in 19 days.
In order to investigate this bacterial strain, studied this bacterial strain and be added in the livestock breeding wastewater anaerobic reactor degradation efficiency of indoles and skatole in the middle indoles of actual treatment livestock breeding wastewater and the ability of skatole.Bacteria suspension 10mL (the bacteria suspension preparation: use transfering loop picking LPC24 bacterium colony in the LB of 10mL liquid nutrient medium that in the reactor of long-term (steady running is more than three months) steady running, adds bacterial strain LPC24,30 ℃ jolt cultivation 12 hours), (concentration of skatole is about 1.0mg/L for 1000mL to contain indoles and skatole waste water { experiment waste water (livestock breeding wastewater) is taken from Hubei Province, Ezhou, Hubei Province original seed pig farm sewage draining exit } in the reactor, the concentration of indoles is about 1.5mg/L), 30 ℃, a static week, steady running is 30 days again, during reactor steady running, regularly detect indoles, the removal efficient of skatole, with the control reactor contrast that does not add this bacterial strain, the result shows, the skatole of removing in the livestock breeding wastewater is about 1.0mg/L, and indoles is about 1.5mg/L; The removal efficient of this reactor for treatment indoles and skatole that can make this bacterial strain improves 20-30% (the original clearance of reactor is 70-75%, and adding bacterial strain LPC24 efficiency of post treatment is 96-99%).
Claims (2)
1. a strain indoles and skatole degradation bacteria strains LPC24, it is characterized in that: described bacterial strain is pseudomonas putida (Psedomonas.putida) LPC24 CCTCC NO:M 209099.
2. a strain indoles according to claim 1 and skatole degradation bacteria strains LPC24, it is characterized in that: the colonial morphology of described pseudomonas putida (Psedomonas.putida) LPC24 CCTCC NO:M 209099 is: bacterium colony is rice white, rule is circular, edge is neat, opaque, smooth surface, ball bumps, thick, bacterial strain physiological characteristic: be straight or little curved shaft-like, 0.7～1.1 μ m * 2.0～4.0 μ m, single or paired arrangement, Gram-negative; Main biochemical character: amphimicrobian, chemoheterotrophic bacteria can utilize nitrate, and oxidase positive produces arginine dihydrolase and urase, and spore, 25～37 ℃ of optimum growth temperatures are not given birth in motion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100630679A CN101665776B (en) | 2009-07-06 | 2009-07-06 | Benzazole and methylindol degradation strain LPC24 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100630679A CN101665776B (en) | 2009-07-06 | 2009-07-06 | Benzazole and methylindol degradation strain LPC24 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101665776A true CN101665776A (en) | 2010-03-10 |
| CN101665776B CN101665776B (en) | 2011-08-31 |
Family
ID=41802554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100630679A Expired - Fee Related CN101665776B (en) | 2009-07-06 | 2009-07-06 | Benzazole and methylindol degradation strain LPC24 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101665776B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102876619A (en) * | 2012-10-23 | 2013-01-16 | 上海交通大学 | Pseudomonas putida capable of efficiently degrading estrogen and acquisition and application thereof |
| CN103060218A (en) * | 2011-10-18 | 2013-04-24 | 大连理工大学 | Phenol-degrading bacteria and method for preparing indigo by conversing indole |
-
2009
- 2009-07-06 CN CN2009100630679A patent/CN101665776B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060218A (en) * | 2011-10-18 | 2013-04-24 | 大连理工大学 | Phenol-degrading bacteria and method for preparing indigo by conversing indole |
| CN103060218B (en) * | 2011-10-18 | 2014-04-23 | 大连理工大学 | Phenol-degrading bacteria and method for preparing indigo by conversing indole |
| CN102876619A (en) * | 2012-10-23 | 2013-01-16 | 上海交通大学 | Pseudomonas putida capable of efficiently degrading estrogen and acquisition and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101665776B (en) | 2011-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110819556B (en) | Rhizobium and microbial inoculum and application thereof | |
| CN110699297B (en) | Alcaligenes faecalis subspecies and application thereof | |
| CN104673715B (en) | There is fixed effect to cadmium and enterobacteria and its application of plant growth can be promoted | |
| CN106754578B (en) | Microbial inoculum and the application of one plant of chloramphenicol degradation bacteria strains LMS-CY and its production | |
| CN111733113B (en) | COD (chemical oxygen demand) degrading strain and application thereof | |
| CN106167776A (en) | A kind of can bacillus cereus (Bacillus cereus) TH 35 of heavy metal cadmium and application thereof in activating soil | |
| CN104403965B (en) | A kind of roost rose of Sharon pseudomonad of water body tetracycline pollutant of degrading and its application | |
| CN111100815B (en) | Pseudomonas for degrading PBAT (poly (butylene adipate-co-terephthalate)) plastic and application thereof | |
| CN108977398A (en) | One plant of bacillus megaterium and its application | |
| CN109337825B (en) | Paecilomyces beijing strain LYZ7 and application thereof | |
| CN108841748A (en) | Sinorhizobium nitrogen-fixing bacteria strain H6 and its application | |
| CN102703361B (en) | Facultative anaerobic denitrifying bacterium with self-flocculation capability and purpose thereof | |
| CN101665776A (en) | Benzazole and methylindol degradation strain LPC24 | |
| CN108949639B (en) | Acinetobacter baumannii for degrading aureomycin and application thereof | |
| CN109280631B (en) | Sulfadimidine degrading bacterium S-2 and application thereof | |
| CN106591173A (en) | Bacillus flexus HL-37 capable of activating soil heavy metal cadmium, and applications thereof | |
| CN103011423A (en) | Application of Bacillus cereus DS1 in degradation of organic pollutants in saponin waste water | |
| CN101993838A (en) | Delftia tsuruhatensis strain H1 with chloroaniline degradation capacity and application thereof | |
| CN101817593B (en) | Application of indole and skatole degrading strain LPC24 | |
| CN104498412B (en) | Cohnella sp. capable of degrading agar | |
| CN100400646C (en) | Chlorine resisting strain No.1 and screening process thereof | |
| CN101665792A (en) | Gene of benzazole and methylindol degradation strain LPC24 | |
| CN102899263B (en) | Facultative anaerobic denitrifying bacteria having complete denitrification enzyme systems and use thereof | |
| CN100386428C (en) | Chloride ion resistant strain S616 and its screening method | |
| JP4965175B2 (en) | A new species of the genus Salini vibrio |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110831 Termination date: 20120706 |