CN1789421A - Wheat WRAB 17 gene promotor and application thereof - Google Patents
Wheat WRAB 17 gene promotor and application thereof Download PDFInfo
- Publication number
- CN1789421A CN1789421A CN 200410098749 CN200410098749A CN1789421A CN 1789421 A CN1789421 A CN 1789421A CN 200410098749 CN200410098749 CN 200410098749 CN 200410098749 A CN200410098749 A CN 200410098749A CN 1789421 A CN1789421 A CN 1789421A
- Authority
- CN
- China
- Prior art keywords
- bit base
- hold
- seq
- gene
- wrab
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a wheat WRAB17 gene promotor and its application, wherein the promotor has one of the following nucleic acid sequences, (1) DNA sequence defined by No.1-2210 base of 5' end of SEQ No:1 in the sequence table, (2) nucleic acid sequence capable of hybridizing with the DNA sequence defined by No.1-2210 base of 5' end of SEQ ID No:1 in the sequence table. The wheat WRAB17 gene promotor can be widely used in the cultivation of inversion-resistant gene plants.
Description
Technical field
The present invention relates to a kind of in the plant biotechnology field can be by the plant promoter of the special abduction delivering of adverse circumstance and application thereof, particularly one section derives from wheat (Triticum aestivum) cryoactivation LEA/RAB proteinoid WRAB17 gene promoter and application thereof.
Background technology
Aspect Plant Biotechnology, expression of exogenous gene intensity, period and tissue specificity usually depend on employed promotor in the host plant.Various promotors commonly used often have very high expression intensity, the 35S promoter of cauliflower mosaic virus for example, and this promotor is because its efficient constitutive expression characteristic is widely used in plant biotechnology field.But, in some cases, as in the research of plant with adverse resistance transgenic engineering, anti-contrary foreign gene is under the regulation and control of 35S promoter, efficiently express always and can cause that the transformed host plant strain growth delays phenomenon (Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K., Twotranscription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domainseparate two cellular signal transduction pathways in drought-andlow-temperature-responsive gene expression, respectively, in Arabidopsis.PlantCell.1998Aug; 10 (8): 1391-406), therefore need a kind of novel promotor to make expression of exogenous gene be subjected to inducing of adverse environmental factor, thereby reduce disadvantageous effect to the host plant growth.
Plant to the perception of adverse circumstance with replied two kinds of approach of the relevant and non-ABA of ABA.The ABA relational approach comprises the transcription factor that is subjected to the adverse circumstance abduction delivering, and their downstream response gene.Can combine regulate gene expression with the conservative frame (PyACGTTGGC) of ABRE as bZIP class transcription factor.MYC or MYB class transcription factor are then discerned the conservative site CANNTG or the PyAACPyPu of downstream gene promoter region.Non-ABA approach comprises the DREB transcription factor that is subjected to the adverse circumstance abduction delivering, the DREB transcription factor is at first cloned in Arabidopis thaliana, DREB1A is arranged, DREB1B, DREB1C, DREB1D and DREB2A, DREB2B, they contain the ERF/AP2 structural domain, can combine with the conservative frame (A/GCCGAC) of DRE specifically, induce its downstream gene as coding wetting ability peptide C OR (cryoactivation, cold-regulated) expression of protein gene etc.These albumen are under adverse environmental factor, and cell membrane and albumen play defencive function.The cryoactivation albumen rd29A promotor of Arabidopis thaliana be studies show that its can be by cold non-irrigated salt and dormin abduction delivering, the abduction delivering that wheat coding cryoactivation albumen WCS120 gene promoter all catches cold in unifacial leaf and dicotyledons has DRE to guard frame at their promoter region.
WRAB17 is a wheat III type LEA/RAB class alkalescence hydrophobic proteins, has 166 amino acid, and its expression is caught a cold and induced.Under the situation of 4 degree deepfreezes, its expression product can accumulate (Tsuda K, Tsvetanov S, TakumiS, Mori N, Atanassov A, Nakamura C., Genes Genet Syst.2000Aug; 75 (4): 179-88.New members of a cold-responsive group-3 Lea/Rab-related Cor gene family fromcommon wheat (Triticum aestivum L.).
The innovation and creation content
The Wheat WRAB 17 gene promotor that the purpose of this invention is to provide a kind of abduction delivering of in plant, being trembled with fear.
Wheat WRAB 17 gene promotor provided by the present invention has one of following nucleotide sequences:
1) SEQ ID № in the sequence table: 1 the dna sequence dna of holding the 1st-2210 bit base to limit from 5 ｀;
2) under the rigorous condition of height can with the SEQ ID № in the sequence table: 1 hold the nucleotide sequence of the dna sequence dna hybridization that the 1st-2210 bit base limit from 5 ｀.
The rigorous condition of described height for hybridization back with contain 0.1 * SSPE (or 0.1 * SSC), the solution of 0.1%SDS washes film under 65 ℃.
Under the rigorous condition of height can with SEQ ID № in the sequence table: 1 hold the nucleotide sequence of the dna sequence dna hybridization that the 1st-2210 bit base limit from 5 ｀, can be the nucleotide sequence of sequence 1 in the sequence table.
The dna sequence dna of sequence 1 is by 2246 based compositions in the sequence table, wherein comprises 5 ' the non-part of translating the district (SEQ ID №: 1 hold the 2211st-2246 bit base from 5 ｀) of the nucleotide sequence (SEQ ID №: 1 hold the 1st-2210 bit base from 5 ｀) of the WRAB17 gene promoter of total length 2210bp and WRAB17 gene that length is 36bp.Be+1 with the transcription initiation site inferred (SEQ ID №: 1 hold the 2211st bit base) from 5 ｀, the TATA frame of this promotor is positioned at-54 districts (SEQ ID №: 1 hold the 2157th the-the 2162nd bit base from 5 ｀) of sequence,-203 (SEQ ID №: 1 hold the 2008th the-the 2013rd bit base) in sequence from 5 ｀, the position of-847 (SEQ ID №: 1 hold the 1364th the-the 1369th bit base from 5 ｀) and-1577 (SEQ ID №: 1 hold the 634th the-the 639th bit base from 5 ｀) has the DNA cis acting factor D RE frame ((A/G) CCGAC) that is subjected to the adverse circumstance abduction delivering respectively, this conservative frame can with start the AP2/EREBP class transcription factor family that the adverse circumstance response gene expresses and combine.-63 (SEQ ID №: 1 hold the 2148th the-the 2153rd bit base) in sequence from 5 ｀,-166 (SEQ ID №: 1 hold the 2045th the-the 2050th bit base) from 5 ｀,-178 (SEQ ID №: 1 hold the 2033rd the-the 2038th bit base) from 5 ｀,-215 (SEQ ID №: 1 hold the 1996th the-the 2001st bit base) from 5 ｀,-369 (SEQ ID №: 1 hold the 1842nd the-the 1847th bit base) from 5 ｀,-411 (SEQ ID №: 1 hold the 1800th the-the 1805th bit base) from 5 ｀,-523 (SEQ ID №: 1 hold the 1688th the-the 1693rd bit base) from 5 ｀,-1019 (SEQ ID №: 1 hold the 1192nd the-the 1197th bit base) from 5 ｀,-1413 (SEQ ID №: 1 hold the 798th the-the 803rd bit base) from 5 ｀,-1548 (SEQ ID №: 1 hold the 663rd the-the 668th bit base) from 5 ｀,-1572 (SEQ ID №: 1 hold the 639th the-the 644th bit base) from 5 ｀,-1857 (SEQ ID №: 1 hold the 354th the-the 359th bit base) from 5 ｀,-1868 (SEQ ID №: 1 hold the 343rd the-the 348th bit base) from 5 ｀,-1958 (SEQ ID №: 1 hold the 253rd the-the 258th bit base) from 5 ｀,-1981 (SEQ ID №: 1 hold the 230th the-the 235th bit base) from 5 ｀,-2056 (SEQ ID №: 1 hold the 155th the-the 160th bit base) from 5 ｀ ,-2137 (SEQ ID №: 1 hold the 74th the-the 79th bit base from 5 ｀) position has the MYC recognition site (CANNTG) that is subjected to the ABA signals-modulating respectively;-868 (SEQ ID №: 1 hold the 1343rd the-the 1348th bit base from 5 ｀) ,-1332 (SEQ ID №: 1 hold the 879th the-the 884th bit base from 5 ｀) position has MYB recognition site (PyAACPyPu) respectively.The existence of these conserved sequences shows that the WRAB17 gene promoter might be the promotor that is subjected to the adverse circumstance abduction delivering.
The expression cassette that contains Wheat WRAB 17 gene promotor; also belong to protection scope of the present invention; be connected in the nucleotide sequence of coding desired polypeptides as Wheat WRAB 17 gene promotor in functional mode, and the nucleotide sequence of described coding desired polypeptides is connected in the expression cassette that a Transcription Termination nucleotide sequence is constituted.
The expression vector that contains Wheat WRAB 17 gene promotor; clone and host bacterium also belong to protection scope of the present invention; utilize existing molecular biological method can obtain different expression vectors, as pCAMBIA7006::17p (physical map as shown in Figure 4).
The carrier that sets out that is used to make up the expression vector that contains described Wheat WRAB 17 gene promotor can be the carriers such as binary vector of pMRT1207, pMRT1177, pMRT1178, pMRT1179, pMRT1180 or pMRT1181.
Wheat WRAB 17 gene promotor of the present invention is by carrying out functional the connection can being widely used in the cultivation gene plant of anti-the reverse with the goal gene with specific function.Wherein, described transgenic plant can be monocotyledons such as turfgrass, wheat, barley, oat, paddy rice or corn etc., or dicotyledons such as potato, tobacco, cotton, lettuce, tomato, muskmelon, cucumber, pea, oil grain, beet or Sunflower Receptacle etc.
Experiment showed, that through RT-PCR and plant transgene above-mentioned Wheat WRAB 17 gene promotor has the adverse circumstance of being subjected to and induces the characteristic that starts destination gene expression.
The present invention separates and has cloned the wheat cryoactivation LEA/RAB proteinoid WRAB17 gene promoter of adverse circumstance abduction delivering from wheat (Triticum aestivum), this promotor can be by adverse circumstance as cold abduction delivering in plant.Wheat WRAB 17 gene promotor of the present invention will be widely used in cultivates the transgenic plant with stress tolerance, has far-reaching theory significance and reaches practice significance widely.
Description of drawings
Fig. 1 is the physical map of cloning vector pUCm-T::17p
Fig. 2 A is that the RT-PCR of Wheat WRAB 17 under the different cold treatment condition detects collection of illustrative plates
Fig. 2 B is that the RT-PCR of wheat ubiquitin under the different cold treatment condition detects collection of illustrative plates
Fig. 3 is the physical map of pCAMBIA7006
Fig. 4 is the physical map of pCAMBIA7006::17p
Fig. 5 A is for changeing the PCR checking result of pCAMBIA7006::17p Festuca Arundinacea
Fig. 5 B is for changeing the PCR checking result of pCAMBIA7006 Festuca Arundinacea
Fig. 6 coerces down the photo that WRAB17 gene promoter regulation and control gus gene is expressed for transgenic turf grass Festuca Arundinacea syncope due to pathogenic cold
Embodiment
The term that is used for this specification sheets and claims has following implication:
-term " nucleic acid " is meant DNA or RNA;
-term " nucleotide sequence ' ' be meant from 5 ' end and read that it comprises self-replacation type plasmid, infectivity or noninfective gene and DNA or RNA polymkeric substance and functional or non-functional DNA or RNA to the oligomer or the polymkeric substance of the nucleotide base of 3 ' strand of holding or two strands.In being used for the application's Nucleotide symbol, except that specifically mentioning, the left end of strand or double chain nucleotide sequence is 5 ' end;
-term " promotor " or phrase " promoter region nucleotide sequence " are meant identification and the bonded nucleic acid district that is positioned at translation initiation codon upstream, RNA polymerase and other transcription factor;
-" plant promoter " is to start the promotor of transcribing in vegetable cell;
-" abduction delivering promotor " is meant in host living beings brings out the promotor of its downstream of expression with the nucleotide sequence of functional mode connection by specific external environment factor;
-phrase " connects with functional mode " or " functional connection " is meant: one section nucleotide sequence (for example promotor or regulate or functional block) is connected with another section nucleotide sequence (for example another adjusting or functional block or the gene proteic to be expressed to be produced of encoding), make described sequence in the cell of introducing it, genome, carrier or expression cassette, bring into play its original function, promptly make them in such environment, function be arranged.With regard to promotor, promoter sequence is also included within the transcription sequence between transcription initiation site and the translation initiation site;
-term " expression cassette " is meant such nucleotide sequence, and described nucleotide sequence can instruct the nucleotide sequence or the expression of gene of coding polypeptide to be produced in the host living beings compatible with this sequence.Such box comprises other factor that a promotor and transcription termination signal and optional expression are needed or can be used for expressing at least;
-term " carrier " is meant expression system, for example the projectile of DNA bag quilt, based on the transport vehicle of nucleic acid be changed nucleic acid molecule and autonomous self-replacation type cyclic DNA, for example plasmid, clay, phagemid etc. to transport described nucleic acid.Described carrier can or as being incorporated into Autonomous Structure in the host genome by during mitotic division, duplicating by described cytotostatic, perhaps maintain in host's the nucleus or tenuigenin;
-term " plasmid " is meant the autonomous ring-shaped DNA molecule that can duplicate in cell, comprise so-called " expression " plasmid and so-called " non-expression " plasmid.If it is the host of " expression plasmid " that a kind of reconstitution cell culture or microorganism are described to, then this term had both comprised karyomit(e) outer ring-like dna molecular, comprised the DNA that has been incorporated in the host chromosome again.If described plasmid is kept by host cell, then described plasmid or between m period as a kind of Autonomous Structure by described cytotostatic duplicate, perhaps be incorporated in described host's the genome;
-term " frame " is meant the nucleotide sequence of being responsible for regulatory function;
-term " is arranged in " and is meant the position of discriminating element (for example " frame ", restriction site or codon with specific function) at nucleotide sequence.The position that provides with numeral is meant the zero position of described element in described nucleotide sequence, just when specifically mentioning, so that the reading direction of described nucleotide sequence promptly 5 '---3 ' direction is mentioned;
-term " transgenic plant " is meant the plant that obtains by Genetic Manipulative Technology, and comprise the whole strain plant that obtains by these technology, in its genome, integrated this generic operation or express aftergrowth, its offspring and the plant organ of this generic operation, for example root, stem and leaf.Can have different ploidy levels according to transgenic plant of the present invention, can be polyploid, diploid or monoploid.
Embodiment 1, promotor clone and sequential analysis
(1) material processing
Wheat seed with 2% clorox sterilization 20 minutes, behind the distilled water flushing 3 times, is placed on the moistening filter paper of culture dish,, germinate a week in 25 ℃ of dark cultivations.
(2) extracting of genomic dna
With CTAB method (Steiner JJ, Poklemba CJ, Fjellstrom RG, Elliott LF., A rapidone-tube genomic DNA extraction process for PCR and RAPD analyses.NucleicAcids Res.1995 Jul 11; 23 (13): 2569-70) extract wheat cdna group DNA, concrete grammar is as follows: the wheat spire of getting the week of germinateing, with liquid nitrogen grinding, add 5 milliliters in the vegetable material of per 1 gram through the CTAB of 68 ℃ of preheatings solution (with before adding the 10mM mercaptoethanol), 60 ℃ were heated 30 minutes.Add the equal-volume chloroform then: primary isoamyl alcohol, centrifugal 15 minutes of 15000g gets supernatant.The Virahol that in supernatant liquor, adds 2/3 times of volume, mixing stirs out the DNA silk with the entry needle needle point and to place new pipe, adds 75% ethanol again, and washing precipitation and centrifugal tube wall blot ethanol then, and air is dried remaining ethanol, adding TE dissolving DNA.And in-20 ℃ of preservations.
(3) clone of WRAB17 gene DNA fragment and sequential analysis
With PCR (polymerase chain reaction) method amplification WRAB17 gene DNA fragment.The PCR reaction solution contains 1 μ g genomic dna, 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mM dNTP mixture, 1 μ M5 ' primer and 1 μ M3 ' primer, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company).Primer sequence is as follows:
5 ' primer: 5 '-TACCAACACTCCATCAACTTCAAA-3 '
3 ' primer: 5 '-TGAAGGAATAGCGAAACAGAAGG-3 '
In PCR-thermal cycler (Eppendorf company, Germany), carry out PCR circulation with amplification WRAB17 gene DNA fragment according to following scheme: 94 ℃ of pre-sex change 5 minutes; Again 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 1 minute 30 seconds, totally 30 circulations; Last 72 ℃ 10 minutes.About 618bp dna fragmentation that amplification is obtained reclaims this fragment with the scheme that gel reclaims test kit (sky, Beijing latitude Time Technology company limited) and provides by supplier, with (Promega company of pGEM-Teasy vector system, the U.S.) scheme that provides by supplier is cloned this fragment, order-checking (Shanghai Shen You biotech company), compare by cDNA sequence (GenBank accessionnumberAF255053), confirm to be cloned into WRAB17 gene order fragment with WRAB17.
(4) clone of the nucleotide sequence of WRAB17 gene promoter and analysis
With TAIL-PCR method (Liu YG, Whittier RF., Thermal asymmetric interlaced PCR:automatable amplification and sequencing of insert end fragments from P1 andYAC clones for chromosome walking.Genomics.1995 Feb 10; 25 (3): 674-81) amplification WRAB17 gene promoter nucleotide sequence.The PCR reaction solution contains 1 μ g wheat cdna group DNA, 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mM dNTP mixture, 2.5 μ M5 ' primer AD1 and 0.25 μ M3 ' special primer 17-A, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company).Primer sequence is as follows:
AD1：5’AGWGNAGWANCAWAGG?3’
17-A：5’GCGTGATCCTTACCGGCTTC?3’
In PCR instrument (Eppendorf company, Germany), carry out the PCR cyclic amplification reaction according to following scheme: 94 ℃ 4 minutes, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 25 ℃ 3 minutes, slowly be raised to 72 ℃ with 3 fens clock times, 72 ℃ the reaction 2 minutes, more than totally 1 circulation; Afterwards 94 ℃ 30 seconds, 44 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, more than totally 15 circulations; 72 ℃ of end reactions afterwards in 5 minutes.
With after 2000 times of the above-mentioned PCR product dilutions as touching plate, continue new round PCR and react, 3 ' special primer changes the 17-B of 0.25 μ M into, sequence is: 5 ' GCCTCGTCGCCCATCTTT 3 '.Reaction conditions is as follows: 94 ℃ 2 minutes; Afterwards 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 44 ℃ 1 minute, 72 ℃ of totally 15 circulations more than 30 seconds in 2 fens; 72 ℃ of end reactions afterwards in 5 minutes.
With after 2000 times of the above-mentioned PCR product dilutions as touching plate, further continue new round PCR and react, 3 ' special primer changes the 17-C of 0.25 μ M into, sequence is: 5 ' TGAAGTTGATGGAGTGTTGGTACG 3 '.Reaction conditions is as follows: 94 ℃ 2 minutes; Afterwards 94 ℃ 30 seconds, 44 ℃ 1 minute, 72 ℃ 2 minutes, more than totally 20 circulations; 72 ℃ of end reactions afterwards in 7 minutes.
Longly be the DNA band of 887bp through obtaining one after the above-mentioned three-wheel PCR reaction, the scheme that reclaims test kit (sky, Beijing latitude Time Technology company limited) and provide by supplier with gel reclaims this fragment, with (Promega company of pGEM-Teasy vector system, the U.S.) scheme that provides by supplier is cloned this fragment, and order-checking (Shanghai Shen You biotech company).Determine it is the upstream promoter district nucleotide sequence of this gene after the gene order comparative analysis of institute's calling sequence and coding WRAB17.
According to institute's calling sequence, the redesign primer, the TAIL-PCR reaction is taken turns in beginning second, continues amplification WRAB17 gene promoter nucleotide sequence.
The PCR reaction solution contains 1 μ g wheat cdna group DNA, 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mM dNTP mixture, 2.5 μ M5 ' primer AD
2With 0.25 μ M3 ' special primer 17P-A, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company).Primer sequence is as follows:
AD
2：5’NTCGASTWTSGWGTT?3’
17P-A：5’TGAAATTCAGCAGCTAATTTGTAGG?3’
In PCR instrument (Eppendorf company, Germany), carry out the PCR cyclic amplification reaction according to following scheme: 94 ℃ 4 minutes, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 25 ℃ 3 minutes, slowly be raised to 72 ℃ with 3 fens clock times, 72 ℃ the reaction 2 minutes, more than totally 1 circulation; Afterwards 94 ℃ 30 seconds, 44 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 60 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, more than totally 15 circulations; 72 ℃ of end reactions afterwards in 5 minutes.
With after 2000 times of the above-mentioned PCR product dilutions as touching plate, continue new round PCR and react, 3 ' special primer changes the 17P-C of 0.25 μ M into, sequence is: 5 ' CCCCTGTCTCCACCTCTG 3 '.Reaction conditions is as follows: 94 ℃ 2 minutes; Afterwards 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, 94 ℃ 30 seconds, 44 ℃ 1 minute, 72 ℃ 2 minutes 30 seconds, more than totally 15 circulations; 72 ℃ of end reactions afterwards in 5 minutes.
Through obtaining a DNA band that is about to 1.5kb after the above-mentioned two-wheeled PCR reaction, the scheme that reclaims test kit (sky, Beijing latitude Time Technology company limited) and provide by supplier with gel reclaims this fragment, with (Promega company of pGEM-Teasyvector system, the U.S.) scheme that provides by supplier is cloned this fragment, and order-checking (Shanghai Shen You biotech company).It is its 5 ' upstream sequence that institute's calling sequence and last round of PCR product sequence are confirmed as after relatively.
According to institute's calling sequence, the design primer is with the nucleotide sequence of PCR (polymerase chain reaction) method amplification WRAB17 gene promoter.The PCR reaction solution contains 1 μ g wheat cdna group DNA as template DNA, 1.5mM MgCl
2, 20mMTris-HCL (pH8.4), 50mMKCl, 0.8mM dNTP mixture, 1 μ M5 ' primer and 1 μ M3 ' primer, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company), the pfu polysaccharase (Shanghai Shenergy Biocolor BioScience ﹠ Technology Company) of 1 unit.Primer sequence is as follows:
5 ' primer: 5 '-GTTGAATCGTGCTCCCAGTTT-3 '
3 ' primer: 5 '-TTTGAAGTTGATGGAGTGTTGGTA-3 ',
In PCR-thermal cycler (Eppendorf company, Germany), carry out PCR circulation according to following scheme: earlier 94 ℃ 5 minutes; Again 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 3 minutes, totally 30 circulations; Last 72 ℃ 5 minutes.The 2246bp dna fragmentation that amplification is obtained reclaims this fragment with the scheme that gel reclaims test kit (sky, Beijing latitude Time Technology company limited) and provides by supplier, clone this fragment with the scheme that pUCm-T vector system (Shanghai Shenergy Biocolor BioScience ﹠ Technology Company) provides by supplier, obtain cloning vector pUCm-T::17p (Fig. 1).The determining nucleic acid sequence result (Shanghai Shenergy Biocolor BioScience ﹠ Technology Company) of WRAB17 gene promoter shows that the WRAB17 gene promoter has the nucleotide sequence of SEQ ID No.1, total length 2246bp wherein comprises 5 ' the non-part of translating the district (SEQ ID №: 1 hold the 2211st-2246 bit base from 5 ｀) of the nucleotide sequence (SEQ ID №: 1 hold the 1st-2210 bit base from 5 ｀) of the WRAB17 gene promoter of total length 2210bp and WRAB17 gene that length is 36bp.Be+1 with the transcription initiation site inferred (SEQ ID №: 1 hold the 2211st bit base) from 5 ｀, the TATA frame of this promotor is positioned at-54 districts (SEQ ID №: 1 hold the 2157th the-the 2162nd bit base from 5 ｀) of sequence,-203 (SEQ ID №: 1 hold the 2008th the-the 2013rd bit base) in sequence from 5 ｀, the position of-847 (SEQ ID №: 1 hold the 1364th the-the 1369th bit base from 5 ｀) and-1577 (SEQ ID №: 1 hold the 634th the-the 639th bit base from 5 ｀) has the DNA cis acting factor D RE frame ((A/G) CCGAC) that is subjected to the adverse circumstance abduction delivering respectively, this conservative frame can with start the AP2/EREBP class transcription factor family that the adverse circumstance response gene expresses and combine.-63 (SEQ ID №: 1 hold the 2148th the-the 2153rd bit base) in sequence from 5 ｀,-166 (SEQ ID №: 1 hold the 2045th the-the 2050th bit base) from 5 ｀,-178 (SEQIDNo:1 holds the 2033rd the-the 2038th bit base from 5 ｀),-215 (SEQ ID №: 1 hold the 1996th the-the 2001st bit base) from 5 ｀,-369 (SEQ ID №: 1 hold the 1842nd the-the 1847th bit base) from 5 ｀,-411 (SEQ ID №: 1 hold the 1800th the-the 1805th bit base) from 5 ｀,-523 (SEQ ID №: 1 hold the 1688th the-the 1693rd bit base) from 5 ｀,-1019 (SEQ ID №: 1 hold the 1192nd the-the 1197th bit base) from 5 ｀,-1413 (SEQ ID №: 1 hold the 798th the-the 803rd bit base) from 5 ｀,-1548 (SEQ ID №: 1 hold the 663rd the-the 668th bit base) from 5 ｀,-1572 (SEQ ID №: 1 hold the 639th the-the 644th bit base) from 5 ｀,-1857 (SEQ ID №: 1 hold the 354th the-the 359th bit base) from 5 ｀,-1868 (SEQ ID №: 1 hold the 343rd the-the 348th bit base) from 5 ｀,-1958 (SEQ ID №: 1 hold the 253rd the-the 258th bit base) from 5 ｀,-1981 (SEQ ID №: 1 hold the 230th the-the 235th bit base) from 5 ｀,-2056 (SEQ ID №: 1 hold the 155th the-the 160th bit base) from 5 ｀,-2137 (SEQ ID №: 1 hold the 74th the-the 79th bit base from 5 ｀) position has the MYC recognition site (CANNTG) that is subjected to the ABA signals-modulating respectively,-868 (SEQ ID №: 1 hold the 1343rd the-the 1348th bit base from 5 ｀) ,-1332 (SEQ ID №: 1 hold the 879th the-the 884th bit base from 5 ｀) position has MYB recognition site (PyAACPyPu) respectively.The existence of these conserved sequences shows that the WRAB17 gene promoter is the promotor that is subjected to the adverse circumstance abduction delivering.
The RT-PCR of WRAB17 gene expression characteristic in wheat detects under embodiment 2, the different environment stress
(1) material processing
Get wheat seed with 2% clorox sterilization 20 minutes, behind the distilled water flushing 3 times, on filter paper moistening in the culture dish, in 4 ℃ of dark cultivations 1 day, 25 ℃ move in the vermiculite after germinateing 3 days, and 25 ℃ are continued to sprout about weeks.Place 4 ℃, deepfreeze, and took out-70 ℃ of preservations at 0,4,14 hour respectively.
(2) extracting of wheat RNA
With the wheat lines of-70 ℃ of preservations of liquid nitrogen grinding, add 1ml TRIZOL RNA extracting solution (ancient cooking vessel state biotech company) in the vegetable material of every 0.1g, and carry out the extraction of total RNA by the scheme that supplier provides.(Prmega America) digests by the scheme that supplier provides, and removing remaining DNA, detects the concentration of RNA in each sample with spectrophotometer (Eppendorf company, Germany), and is adjusted to the concentration unanimity with TE with the DNase enzyme with the RNA that obtains.
(3) RT-PCR detects the WRAB17 expression of gene
Getting the total RNA of 1 μ g is that the scheme that the reverse transcription primer provides by supplier is carried out the RT reaction with reverse transcription test kit (precious biotechnology (Dalian) company limited) with oligo (dT) 20.Get 1 μ l after 10 times of dilutions of products therefrom and carry out the PCR reaction.The PCR reaction solution contains 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mMdNTP mixture, 1 μ M5 ' primer 17-1 and 1 μ M3 ' primer 17-2, and the Taq polysaccharase of 1 unit (Shanghai Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).Primer sequence is as follows:
5 ' primer 17-1:5 '-TACCAACACTCCATCAACTTCAAA-3 '
3 ' primer 17-2:5 '-TGAAGGAATAGCGAAACAGAAGG-3 '
According to following scheme the PCR-thermal cycler (Eppendorf, carry out the PCR circulation in Germany) with amplification WRAB17 cDNA fragment: earlier 94 ℃ 5 minutes; Again 94 ℃ 1 minute, 58 ℃ 30 seconds, 72 ℃ 30 seconds, totally 30 circulations; With 72 ℃ 10 minutes.
Simultaneously, ubiquitin is as quantitative criterion in amplification, and the PCR reaction solution is the same, and primer is changed to 1 μ M5 ' primer U-5 and 1 μ M3 ' primer U-3, and primer sequence is as follows:
5 ' primer U-5:5 ' TATTTGTGAAGACCCTCACC 3 '
3 ' primer U-3:5 ' GTTCACCAAAGCTGCTCC 3 '
The PCR reaction conditions is as follows: earlier 94 ℃ 5 minutes; Again 94 ℃ 1 minute, 50 ℃ 30 seconds, 72 ℃ 30 seconds, totally 30 circulations; With 72 ℃ 10 minutes.
The result is shown in Fig. 2 A and Fig. 2 B, surface WRAB17 gene in the cold processing and the wheat leaf blade of handling 4 hours of trembling with fear has a small amount of expression, the cold rna content of handling wheat WRAB gene after 14 hours obviously raises, and simultaneously, remains unchanged as the rna level of the ubiquitin of quantitative contrast always.Experimental result explanation WRAB17 gene expression dose catches cold and induces, and the WRAB17 gene promoter might be cold evoked promoter in wheat.Among Fig. 2 A and Fig. 2 B, 1. cold the processing 14 hours, 2. cold the processing 4 hours, 3. without any processing, DNA ladder M.100bp.
A. plant expression vector construction
(1) structure of negative control pCAMBIA7006
The structure of plant expression vector carries out according to a conventional method.Lack any promoter sequence but have gus gene (β-glucuronidase, Jefferson RA, The GUS reporter gene system.Nature.1989 Dec14; 342 (6251): 837-8) the plasmid pCAMBIA7006 of sequence is as negative control.It is derived from plasmid pCAMBIA1301 (CAMBIA biotech company, Australia), and has removed the CaMV 35S promoter.PCAMBIA1301 plasmid DNA with 1ng is a template, and the 5 ' primer of 0.25 μ M and 0.25 μ M3 ' primer carry out the PCR reaction, and primer sequence is as follows:
5 ' primer: 5 '-TTCCTGCAGACTAGTAAGCTTCACGGGGGACTCTTGACCAT-3 '
3 ' primer: 5 '-AGCAGCGGAGGGGTTGGA-3 '
Also contain 1.5mM MgCl in the reaction solution
2, 20mM Tris-HCL (pH8.4), 50mM KCl, 0.8mM dNTP mixture, and the pfu polysaccharase (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) of 0.5 unit.In PCR-thermal cycler (Eppendorf company, Germany), carry out PCR circulation according to following scheme: earlier 95 ℃ 2 minutes; Then 94 ℃ 30 seconds, 56 ℃ 45 seconds, 72 ℃ 2 minutes 30 seconds, totally 30 circulations; Last 72 ℃ 10 minutes.The 2552bp dna fragmentation that amplification is obtained is through the phenol of routine: behind chloroform extracting and the ethanol sedimentation, digested 1 hour in 37 ℃ with restriction enzyme Pst I (precious biotechnology (Dalian) company limited) and Sph I (precious biotechnology (Dalian) company limited).The scheme that reclaims test kit (sky, Beijing latitude Time Technology company limited) and provide by supplier with dna gel is separated on 0.8% sepharose and is reclaimed and longly is the dna fragmentation of 2469bp, and this is the gus gene sequence that has nopaline synthase terminator.
In parallel laboratory test, get 5 μ g plasmid pCAMBIA, 1301 usefulness restriction enzyme Pst I (precious biotechnology (Dalian) company limited) and Sph I (precious biotechnology (Dalian) company limited) in 37 ℃ of digestion 1 hour.The scheme that reclaims test kit (sky, Beijing latitude Time Technology company limited) and provide by supplier with dna gel is separated on 0.8% sepharose and is reclaimed the long dna fragmentation of 8619bp that is, this is for having removed Lac Z reporter gene, the skeleton structure of former pCAMBIA 1301 plasmids of CaMV 35S promoter and gus gene.
Get above-mentioned two kinds of gels and reclaim each about 0.2 μ g of fragment, in 16 ℃ of connections 12 hours, transformed into escherichia coli DH5 α cut evaluation through colony screening and enzyme, obtains plasmid pCAMBIA7006 (Fig. 3) with the T4DNA ligase enzyme.
(2) structure of the plant expression vector of WRAB17 gene promoter
Getting 5 μ g plasmid pCAMBIA7006 digested 1 hour in 37 ℃ with restriction enzyme Pst I (precious biotechnology (Dalian) company limited).Simultaneously, the pUCm-T::17p plasmid 5 μ g that get in embodiment 1 step (4) digested 1 hour in 37 ℃ with restriction enzyme Pst I (precious biotechnology (Dalian) company limited), the scheme that reclaims test kit (sky, Beijing latitude Time Technology company limited) and provide by supplier with dna gel is separated on 0.8% sepharose and is reclaimed and longly is the dna fragmentation of 2246bp, and this is the WRAB17 gene promoter sequence.This fragment is connected with spending the night in 16 ℃ with the T4 ligase enzyme through the pCAMBIA7006 plasmid fragment of Pst I digestion, transformed into escherichia coli DH5 α, cut evaluation through colony screening and enzyme, obtain plasmid pCAMBIA7006::17p (Fig. 4), in this plasmid, the expression of WRAB17 gene promoter regulation and control gus gene.
B. agrobacterium mediation converted turfgrass Festuca Arundinacea
(1) cultivation of root Agrobacterium
The negative control plasmid pCAMBIA7006, the plant expression vector pCAMBIA7006::17p of WRAB17 gene promoter that make up are transformed Agrobacterium respectively, and the Agrobacterium bacterial classification is LBA4404.The Agrobacterium-mediated Transformation bacterial strain that obtains was cultivated 2 days on the YEB substratum, with little spoon bacterium is scraped at liquid and break up in the culture medium altogether, left standstill 2 hours, shake up the back and adjust bacterial concentration to OD
600Be 0.1.
Every liter of YEB medium component is as follows: extractum carnis (Beijing bispin microbiological culture media products factory) 5g, peptone (Oxoid company) 5g, yeast extract (Oxoid company) 10g, sucrose (Beijing Yili Fine Chemicals Co., Ltd.) 5g, sal epsom 0.5g (Beijing benefit Li Jingxihuaxuepinchang) and agar (Beijing Yili Fine Chemicals Co., Ltd.) 15g, pH7.2.
(2) inducing culture of tall grass (Festuca arundinacea Schreb.) callus
1, callus induction
Choose tall grass (the Festuca arundinacea Schreb.) seed of mature and plump, in distilled water, soak after 4 hours under the room temperature and peel off kind of a skin, put into distilled water again and continue soaked overnight.Soaked peeling seed crosses twice with 70% alcohol earlier, again with 30% clorox sterilization 30 minutes, aseptic water washing three times.Under aseptic condition,, callus inducing medium will be inserted again after the embryo crosscut into two respectively with embryo complete peeling from the seed that disinfects.Inoculum density: 100/ware, plate diameter 75mm.
Every liter of callus inducing medium composed as follows: on the basis of MS minimum medium, add auxin substance 2,4 dichlorophenoxyacetic acid (2,4-D, Sigma, the U.S.) 5mg, pH5.8.
2, callus subculture
Use above-mentioned callus of induce substratum, per two to three weeks are changeed ware once with callus.Change callus to be transferred to the callus state behind twice in the ware and to adjust on the substratum, one carries out Agrobacterium behind the fortnight infects.
Every liter of callus state is adjusted the composed as follows of substratum: add auxin substance 2,4 dichlorophenoxyacetic acid (2,4-D, Sigma, the U.S.) 1mg, 6-benzyl aminopurine (Sigma, the U.S.) 0.5mg, pH5.8 on the basis of MS minimum medium.
3, the Agrobacterium of callus is infected
Placing callus through the resuspended bacterial concentration that leaves standstill is OD
600Infected 10 minutes in=0.1 the LBA4404 root Agrobacterium bacterium liquid, remove bacterium liquid, on aseptic filter paper, callus is dried (about 5 minutes), place the common culture medium that is covered with one deck aseptic filter paper, 25 ℃ of dark cultivations 3 days.Used altogether culture medium be step-callus inducing medium.
4, the screening of resistant calli
Cultivate the back altogether with inducing screening culture medium that callus is screened, per three weeks are changeed ware once, go up division culture medium behind about one and a half months.
Every liter of resistant calli is induced the composed as follows of screening culture medium: add 2 on the basis of MS minimum medium, 4-dichlorphenoxyacetic acid (2,4-D, Sigma, the U.S.) 5mg, Totomycin (company limited of Roche Group, Switzerland) 75mg-150mg, Pyocianil (Beijing is glad through Bioisystech Co., Ltd of section) 250mg, pH5.8.
5, the differentiation of resistant calli
To reach the above resistant calli of 0.5cm through the diameter of screening and be put on the differentiation screening culture medium and break up, and in 25 ℃ of following illumination cultivation (16h light/8h is dark).There is green budlet to occur after 10 days, can be grown to seedling after the about week.
Every liter of division culture medium composed as follows: on the basis of MS minimum medium, add 6-benzyl aminopurine (Sigma, the U.S.) 0.2mg, kinetin (Sigma, the U.S.) 0.5mg, Totomycin (company limited of Roche Group, Switzerland) 50mg, pH5.8.
3, taking root of transformed plant:
The seedling that will break up before taking root is removed the unnecessary callus of leaf and bottom on top, is placed on the division culture medium in the triangular flask slow seedling and carries out root culture about 10 days again, is inoculated in root media, takes root.
Root media is the MS minimum medium, and adding Totomycin (company limited of Roche Group, Switzerland) to final concentration is 30mg/L.
(3) PCR of transformed plant identifies
Extract the genomic dna of transformed plant as method as described in the embodiment 1 (2), and be that template is carried out the PCR reaction with the 100ng genomic dna, the part of amplification WRAB17 promotor and gus gene is to confirm the conversion of pCAMBIA7006::17p.Reaction solution contains 100ng genomic dna, 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mM dNTP mixture, 1 μ M5 ' primer and 1 μ M3 ' primer, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company).Primer sequence is as follows:
5 ' primer: 5 '-GGCATGACTCCAGAAAAATGTCT-3 '
3 ' primer: 5 '-GTGCGGATTCACCACTTGC-3 '
In PCR-thermal cycler (Eppendorf company, Germany), carry out PCR circulation a part according to following scheme with amplification WRAB17 promotor and gus gene: earlier 94 ℃ 5 minutes; Then 94 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 1 minute, totally 30 circulations; Last 72 ℃ 10 minutes.Amplified production is carried out electrophoresis, and the result has band clearly at the 1900bp place that estimates shown in Fig. 5 A.Among the figure, 1 is the PCR of plasmid pCAMBIA7006::17p, and 2 for changeing the PCR of pCAMBIA7006::17p Festuca Arundinacea, and 3 is the PCR of transgenic tall fescue not, and M is DNAmarker (100bp ladder).
Extract the genomic dna of transformed plant as method as described in the embodiment 1 (2), and be that template is carried out the PCR reaction with the 100ng genomic dna, the part of amplification gus gene is to confirm the conversion of pCAMBIA7006.Reaction solution contains 100ng genomic dna, 1.5mM MgCl
2, 20mM Tris-HCl (pH8.4), 50mM KCl, 0.8mMdNTP mixture, 1 μ M5 ' primer and 1 μ M3 ' primer, and the Taq polysaccharase of 1 unit (Shanghai Shen You biotech company).Primer sequence is as follows:
5 ' primer: 5 ' GGTCAGTGGCAGTGAAGGG 3 '
3 ' primer: 5 ' AATCGCCGCTTTGGACATA 3 '
In PCR-thermal cycler (Eppendorf company, Germany), carry out PCR circulation with amplification gus gene dna fragmentation according to following scheme: earlier 94 ℃ 5 minutes; Then 94 ℃ 1 minute, 54 ℃ 1 minute, 72 ℃ 1 minute, totally 30 circulations; With 72 ℃ 10 minutes.Amplified production is carried out electrophoretic analysis, and the result has band clearly at the about 620bp place that estimates shown in Fig. 5 B.Among the figure, 1 is the PCR of plasmid pCAMBIA7006, and 2 for changeing the PCR of pCAMBIA7006 Festuca Arundinacea, and 3 is the PCR of transgenic tall fescue not, and M is DNA marker (100bp ladder).
(4) qualitative detection of glucuronidase activity
Get PCR male transformed plant and carry out the glucuronidase activity detection.Get blade at normal temperature and be soaked in the staining fluid, and place 37 ℃ of dark overnight incubation.Clean the dyeing blade with the 50mM sodium phosphate buffer, then blade is soaked in stationary liquid (dehydrated alcohol: Glacial acetic acid) 1 hour, and with 25%, 50%, 70%, 90%, 100% ethanol respectively decoloured 1 hour, directly visual observation is changeed the pCAMBIA7006 plant and is not dyed blueness, changes the visible incision of plant leaf light blue (Fig. 6) of pCAMBIA7006::17p.Transformed plant is placed 4 ℃ again, take out after 16 hours, as stated above dyeing, fixing, decolouring, directly range estimation, the result shows that the plant sheet of commentaries on classics pCAMBIA7006::17p expression vector is dyed blueness as shown in Figure 6, changes the pCAMBIA7006 plant and is not dyed blueness.Above experimental result shows that Wheat WRAB 17 gene promotor is cold evoked promoter, and it can regulate and control the foreign gene abduction delivering that catches cold in host plant in transgenic plant.
Staining fluid is composed as follows: the Na of 0.1M
2HPO
4/ KH
2PO
4(pH7.0, Sigma, America), 10mMEDTA (pH8.0, Promega company, the U.S.), the 5mM Tripotassium iron hexacyanide (Beijing Chemical Plant), 5mM yellow prussiate of potash (Beijing Chemical Plant), 1m M X-Gluc (5-bromo-4-chloro-3indolyl-β-D-glucuronide, Sigma company, the U.S.) and 0.1% triton x-100 (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd).
Sequence table
<160>1
<210>1
<211>2246
<212>DNA
＜213〉Triticum wheat (Triticum aestivum L.)
<400>1
gttgaatcgt?gctcccagtt?tagacgggag?cccgtgtaga?gtttatcttt?ctcctccaca 60
tagatcaaag?tgccatatga?acaggctata?agcttggtat?tatcctaaat?cccttgccct 120
gtactgtcct?gacgaaccac?acagacatgg?gccacatttg?gagttggacc?accttggcca 180
gaacgagctg?cctgcagtca?cgtcggcgac?gtgtacgcga?cgccacgtcc?aagtggcccg 240
ttcctgtctc?gccatgtgtc?cggaccgata?acggcgaacg?cgaacgagtg?gtgccgggag 300
acgagaggat?gcctcccacg?tcggccctcc?atgtcgacca?tgcaaatgcc?atccacatgt 360
tgtccagtgc?tacgcccaga?attcacggaa?cgagctgtgc?cgggggacgt?cggcgatcca 420
tgtcgaacac?tagctagttg?catggctcgg?atgccaagta?aggatggcaa?ttttatctat 480
gggtacggtt?acccgcggat?accgtacccg?tatgggcagg?gtatggacat?aattttatac 540
tcacgggtag?tatccatacc?ctacccgtca?agtcatgggt?agggcatggg?tatagtcttt 600
tacccatgga?tatacccata?tctatccatt?taaaccgaca?tgtgaacctt?acgcgtgatt 660
cacaagtgta?cctatgttaa?agttgtgtca?tgagtttgta?aacctatgtt?aaagttgtca 720
ccaattttca?atttaaatta?agataattgt?cacgtactca?tctatatgtt?attgagttga 780
ggtcaatgtt?ttttagtcaa?atgtgccata?gagaatgtaa?aattatgaat?aacttgtgta 840
ccgtttgatc?tacccgttgg?gtacccaatg?ggtatgggta?accgtcgggt?atgggtatgg 900
gtaaagtttc?atacccatgg?gtacgggtat?gggtagaatt?ttatacccat?tgaccacacg 960
ggtatgggta?tggtattgct?ctacccgccc?cataccctac?ccattgccat?ccttaatgcc 1020
aagctaaagg?gctcaatttt?tggttgaggt?ggtgggcctt?gctaaatgct?atagccatac 1080
aaaaatgatg?ccgctttttg?caggagtttt?attctccact?attgttatat?tcttatgcat 1140
gtatctgcac?catgcttggt?ctttgtggat?ccgatatatg?gagaggttgc?acatgtgcag 1200
attcacgttt?tttggcaatg?ctagaggaga?gatttgcgaa?ctttttttaa?aaaaaggagg 1260
ccaagatttt?gcctcatctc?attaataaag?aagaagaaaa?gtgtccggtt?aattagcaaa 1320
aaacgggcta?aaaccgtcac?aacaaccgca?ctgggcaaca?tcggccgact?tatacacgcg 1380
tgtggtgtga?atttatccgg?tccaatatat?gggcttgacc?aaggcatttc?ctatgtatgg 1440
tctaaatttt?agagttttgc?ttcggtaagc?taaactcaat?ttttgtttgt?ttgaccgtgt 1500
gcattctcaa?cttctcgtat?gcaaaggcgg?acagaggtgg?agacaggggg?tgccagccag 1560
gcccgggccc?agtcaacatg?ctattttttt?tcactagaac?aatgagtact?tctgctaaaa 1620
cagtgtatta?gctttctgtt?ccattggttt?gacccttccc?aagctagttt?tccgcactaa 1680
aggcggacag?ttgaacttga?gttccaacga?taaatgagta?aaaacttgta?ttatcgaaag 1740
aatatgttgc?gttggttttt?acctacaaat?tagctgctga?atttcaagtt?ttccaataac 1800
atctgtactg?atcaaacatg?ctacatgaat?tcattatata?tcacgtgtac?tttcagaaaa 1860
tatcacatct?aagacacaac?attgaaactg?acacattcac?aaaggtcaag?acgaaaagag 1920
acacaatcac?aggaagtata?tggcatgact?ccagaaaaat?gtcttaaatg?cacatattaa 1980
tcgacagatc?ttacacaaat?gtgttgtgcc?gacataccgt?tgtgcgtata?cacagctgag 2040
tggacaagtg?gccacaatga?gatacccttg?ttacaaaaat?atctcatata?acgccaacgt 2100
acttggaaag?cgatgtattc?tcttcagtat?caacctcggc?aatggggcaa?atggcctata 2160
taaaggaaga?acacacgtct?ctccaccaca?agcacaagga?aagaacacca?caaattagta 2220
cgtaccaaca?ctccatcaac?ttcaaa 2246
Claims (9)
1, Wheat WRAB 17 gene promotor has one of following nucleotide sequences:
1) dna sequence dna of holding the 1st-2210 bit base to limit from 5` of SEQ ID No:1 in the sequence table;
2) under the rigorous condition of height can with SEQ ID No:1 in the sequence table hold the nucleotide sequence of the dna sequence dna hybridization that the 1st-2210 bit base limit from 5`.
2, promotor according to claim 1 is characterized in that: described Wheat WRAB 17 gene promotor has the nucleotide sequence of SEQ ID No:1 in the sequence table.
3, promotor according to claim 2 is characterized in that: described SEQ ID No:1 to hold the 2157th the-the 2162nd bit base from 5` be the TATA frame; Described SEQ ID No:1 holds the 2008th the-the 2013rd bit base from 5`, holds the 1364th the-the 1369th bit base and holds the 634th the-the 639th bit base to be respectively the DNA cis acting factor D RE frame that is subjected to the adverse circumstance abduction delivering from 5` from 5`; Described SEQ ID No:1 holds the 2148th the-the 2153rd bit base from 5`, hold the 2045th the-the 2050th bit base from 5`, hold the 2033rd the-the 2038th bit base from 5`, hold the 1996th the-the 2001st bit base from 5`, hold the 1842nd the-the 1847th bit base from 5`, hold the 1800th the-the 1805th bit base from 5`, hold the 1688th the-the 1693rd bit base from 5`, hold the 1192nd the-the 1197th bit base from 5`, hold the 798th the-the 803rd bit base from 5`, hold the 663rd the-the 668th bit base from 5`, hold the 639th the-the 644th bit base, hold the 354th the-the 359th bit base from 5` from 5`, hold the 343rd the-the 348th bit base from 5`, hold the 253rd the-the 258th bit base from 5`, hold the 230th the-the 235th bit base, hold the 155th the-the 160th bit base and hold the 74th the-the 79th bit base to be respectively the MYC recognition site from 5` from 5` from 5`; SEQ ID No:1 holds the 1343rd the-the 1348th bit base from 5`, and SEQ ID No:1 holds the 879th the-the 884th bit base position that the MYB recognition site is arranged respectively from 5`.
4, the expression cassette that contains claim 1 or 2 or 3 described Wheat WRAB 17 gene promotors.
5, expression cassette according to claim 4 is characterized in that: described expression cassette constitutes for nucleotide sequence and the Transcription Termination nucleotide sequence by described Wheat WRAB 17 gene promotor, coding desired polypeptides; Described Wheat WRAB 17 gene promotor is connected with the nucleotide sequence of functional mode with the coding desired polypeptides, and the nucleotide sequence of described coding desired polypeptides is connected with a Transcription Termination nucleotide sequence.
6, the expression vector that contains claim 1 or 2 or 3 described Wheat WRAB 17 gene promotors, clone and host bacterium.
7, expression vector according to claim 6, clone and host bacterium is characterized in that: the expression vector that contains described Wheat WRAB 17 gene promotor is pCAMBIA7006::17p.
8, expression vector according to claim 6, clone and host bacterium is characterized in that: the carrier that sets out that is used to make up the expression vector that contains described Wheat WRAB 17 gene promotor is the binary vector of pMRT1207, pMRT1177, pMRT1178, pMRT1179, pMRT1180 or pMRT1181.
9, claim 1 or the 2 or 3 described Wheat WRAB 17 gene promotors application in cultivating transgenic plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100987490A CN100392081C (en) | 2004-12-15 | 2004-12-15 | Wheat WRAB 17 gene promotor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100987490A CN100392081C (en) | 2004-12-15 | 2004-12-15 | Wheat WRAB 17 gene promotor and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1789421A true CN1789421A (en) | 2006-06-21 |
| CN100392081C CN100392081C (en) | 2008-06-04 |
Family
ID=36787543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100987490A Active CN100392081C (en) | 2004-12-15 | 2004-12-15 | Wheat WRAB 17 gene promotor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100392081C (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102277354A (en) * | 2011-06-29 | 2011-12-14 | 济南大学 | Promoter of wheat dehydrin gene and application thereof |
| CN102477428A (en) * | 2010-11-22 | 2012-05-30 | 中国农业科学院作物科学研究所 | Wheat TaCPK7 promoter and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DK0459643T3 (en) * | 1990-05-18 | 2001-01-02 | Commw Scient Ind Res Org | Recombinant promoter for gene expression in monocotyledonous plants |
| AR021056A1 (en) * | 1998-11-03 | 2002-06-12 | Syngenta Participations Ag | DNA THAT INCLUDES A SPECIFIC GENE OF RICE AND TRANSGENIC PLANT TRANSFORMED WITH THE SAME |
| FR2799205B1 (en) * | 1999-09-30 | 2004-04-16 | Meristem Therapeutics | SYNTHETIC AND CHEMICAL PROMOTERS, EXPRESSION CASSETTES, PLASMIDS, VECTORS, TRANSGENIC SEED PLANTS CONTAINING THEM, AND PROCESS FOR OBTAINING THEM |
| CN1428351A (en) * | 2001-12-26 | 2003-07-09 | 中国科学院遗传研究所 | Wheat 1Bx14 gene, its coded protein and its promotor |
-
2004
- 2004-12-15 CN CNB2004100987490A patent/CN100392081C/en active Active
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102477428A (en) * | 2010-11-22 | 2012-05-30 | 中国农业科学院作物科学研究所 | Wheat TaCPK7 promoter and application thereof |
| CN102477428B (en) * | 2010-11-22 | 2013-08-07 | 中国农业科学院作物科学研究所 | Wheat TaCPK7 promoter and application thereof |
| CN102277354A (en) * | 2011-06-29 | 2011-12-14 | 济南大学 | Promoter of wheat dehydrin gene and application thereof |
| CN102277354B (en) * | 2011-06-29 | 2012-10-31 | 济南大学 | Promoter of wheat dehydrin gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100392081C (en) | 2008-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1196753A (en) | Root cortex specific gene promoter | |
| CN113174389B (en) | Lilium regale inducible promoter PR4 and application thereof | |
| CN1914321A (en) | Sucrose-inducible promoter from sweetpotato | |
| CN112708625B (en) | Lilium regale inducible promoter PG1 and application thereof | |
| CN112608924B (en) | Inducible promoter PCHI and application thereof | |
| CN106957355A (en) | It is a kind of to the resistance to low light of plant and low temperature resistant related PPR albumen and its encoding gene and application | |
| CN1772899A (en) | Wild rice drought-resisting gene and its coded protein and application | |
| CN1273483C (en) | bZIP transcription factor of corn and its encoding genes and use | |
| CN109266650B (en) | Inducible promoter, recombinant vector and transformant thereof, method for inducing gene expression and application of inducible promoter | |
| CN102712929A (en) | Identification and use of plant root-specific expression promoter | |
| CN1821395A (en) | Rice mitogen-activated protein kinase and its coded gene and use | |
| CN1831010A (en) | Regulatory factor for anti-reverse transcription of corn, and its coding gene and application thereof | |
| CN1202203A (en) | Plant glutathione s-transferase promoters | |
| CN1547589A (en) | Gene controlling life span of leaves in plants and method for controlling life span of plants using the gene | |
| CN1789421A (en) | Wheat WRAB 17 gene promotor and application thereof | |
| CN1526817A (en) | Anhydrant gene BcDh1 and the application of its promoter in raising drought-enduring plant | |
| CN1537944A (en) | Promoter induced by plant system acquired character resistance inducer and its application | |
| CN1778925A (en) | Plant epidermal hair specific expression promoter | |
| CN1285872A (en) | Gene associated with disease resistance in plants | |
| CN1789419A (en) | Wheat WRAB19 gene promotor and application thereof | |
| CN1900280A (en) | Rice tiller regulating gene OsTIL1 and its use | |
| CN100344760C (en) | Plant meiosis gene and its encoded protein and use thereof | |
| CN1624129A (en) | Specific promoter of root and its application | |
| CN1789420A (en) | Wheat WCOR726 gene promotor and application thereof | |
| CN1292067C (en) | Ethylene-responsive transcription coactivators in plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| DD01 | Delivery of document by public notice |
Addressee: Beijing Guardian Technology Co., Ltd. Document name: Notification that Application Deemed not to be Proposed |
|
| DD01 | Delivery of document by public notice |
Addressee: Chen Lei Document name: Notification that Application Deemed not to be Proposed |