CN1900280A - Rice tiller regulating gene OsTIL1 and its use - Google Patents

Abstract

The present invention discloses a kind of rice tiller regulating gene OsTIL1 and its coded protein, the plasmid containing the said gene and its plant expression vector, corresponding transgenic plant cell and rice tiller modifying method. Cloning the gene of the present invention is favorable to the research on molecular mechanism of rice tiller generation and development, and possesses excellent application potential in culturing high yield rice variety with excellent plant form structure and in improving high yield plant form structure of other crops by means of transgenic method.

Description

Rice tiller regulating gene OsTIL 1 and application thereof

Technical field

The invention belongs to plant genetic engineering field.Specifically, the present invention relates to rice tiller regulating gene OsTIL 1 and application thereof.

Background technology

Tillering is a kind of special branch phenomenon of unifacial leaf gramineae plant, and it is one of important factor of decision gramineous crop output, the important composition factor of good plant type especially.The every joint of the cane of gramineous crop all has bud, and bud can be grown the formation branch, and the branch base portion forms adventive root, and this class branch is tillered exactly.The morphological specificity and the stem of tillering are basic identical, tiller can separate with stem and survival separately.The branching process of plant can be divided into two stages, the formation of axillary meristem and the growth of axillalry bud subsequently.Often be in dormant state after axillalry bud forms, the formation that needs could to grow behind the inner and extraneous token stimulus is tillered.

Genetics research shows that tillering number is subjected to polygene combined regulation and control, tillering angle also is a controlled by multiple genes, intergenic additivity effect plays the dominance effect to tillering number and tillering angle, and non additivity effect and Effect of Environmental account for back burner (Wu etc., 1999 between gene; Shen Shengquan etc., 2005; Qian Qian etc., 2001).

Two genes that participate in tiller regulating have been cloned in the paddy rice.The formation of MOC1 control axillary meristem, it also influences the growth of axillalry bud, and the MOC1 sudden change then can not form tiller (Li etc., 2003).OsTB1 is that another has reported the paddy gene that participates in tiller regulating, and it mainly participates in the growth of positive regulation tiller bud, strengthens growth afunction sudden change then the increasing tiller number (Takeda etc., 2003) that expression inhibiting is tillered.In addition, also reported two tiller regulating mutational sites by Fine Mapping, d3 and htd-1, these two genes also mainly participate in the growth of regulation and control tiller bud, their Arabidopis thaliana homologous gene MAX2 and MAX3 also participate in growth (Ishikawa etc., 2005 of tiller bud; Zou etc., 2005).And present report of also not cloning the tillering angle regulatory gene.

The NAC gene family is the special transcription factor extended familys of plant, and more than 100 member (Riechmann etc., 2000) (http://www.tigr.org/) all arranged in Arabidopis thaliana and paddy rice.The proteic N-end of NAC comprise a high conservative NAC ( NAM, ATAF1,2 reaches CUC2) DNA binding domains (Aida etc., 1997).The proteic C-stub area of NAC is the transcription activating domain of supposition, conservative property relatively poor (Duval etc., 2002 between different NAC albumen; Takada etc., 2001; Xie etc., 2000).The NAC family gene participates in different regulatory pathways, their play an important role aspect growth and development of plants many (Olsen etc., 2005).Be included in foundation (Aida etc., 1997 of organ boundaries in embryo, flower and the nutritional development; Mitsuda etc., 2005; Souer etc., 1996; Takada etc., 2001; Vroemen etc., 2003); Signal transduction such as growth hormone, dormin signal (Aida etc., 2002; Xie etc., 2000); And (He etc., 2005 such as participation biology and abiotic stress reaction; Ren etc., 2000; Selth etc., 2005).Not studies show that also that at present the NAC family gene participates in the adnation branching process.Also do not report at present the functional study of NAC gene in the paddy rice.

Used reference is as follows:

Aida?M.，Vernoux?T.，Furutani?M.，Traas?J.and?Tasaka?M.(2002)Roles?of?PIN-FORMED1and?MONOPTEROS?in?pattern?formation?of?the?apical?region?of?the?Arabidopsis?embryo.Development，129，3965-3974.

Aida，M.，Ishida，T.，Fukaki，H.，Fujisawa，H.and?Tasaka，M.(1997)Genes?involved?inorgan?separation?in?Arabidopsis：an?analysis?of?cup-shaped?cotyledon?mutant.Plant?Cell，9，841-857.

Duval?M.，Hsieh?T.F.，Kim?S.Y.and?Thomas?T.L.(2002)Molecular?characterization?ofAtNAM：a?member?of?the?Arabidopsis?NAC?domain?superfamily.Plant?Mol.Biol.，50，237-248.

He?X.，Mu?R.，Cao?W.，Zhang?Z.，Zhang?J.，Chen?S.(2005)AtNAC2，a?transcription?factordownstream?of?ethylene?and?auxin?signaling?pathways，is?involved?in?salt?stress?response?andlateral?root?development.Plant?J.44：903-916.

Ishikawa?S.，Maekawa?M.，Arite?T.，Onishi?K.，Takamure?I.，Kyozuka?J.(2005)Suppressionof?tiller?bud?activity?in?tillering?dwarf?mutants?of?rice.Plant?Cell?Physiol.，46：79-86.

Li?X.，Qian?Q.，Fu?Z.，Wang?Y.，Xiong?G.，Zeng?D.，Wang?X.，Liu?X.，Teng?S.，Hiroshi?F.，Yuan?M.，Luo?D.，Han?B.and?Li?J.(2003)Control?of?tillering?in?rice.Nature，422，618-621.

Mitsuda?N.，Seki?M.，Shinozaki?K.and?Ohme-Takagi?M.(2005)The?NAC?transcriptionfactors?NST?1and?NST2of?Arabidopsis?regulate?secondary?wall?thickenings?and?are?required?foranther?dehiscence.Plant?Cell，17，2993-3006.

Olsen，A.，Ernst，H.，Leggio，L.and?Skriver，K.(2005)NAC?transcription?factors：structurally?distinct，functionally?diverse.Trends?Plant?Sci.，10，79-87.

Riechmann?J.，Heard?J.，Martin?G.，Reuber?L.，Jiang?C.，Keddie?J.，Adam?L.，Pineda?O.，Ratcliffe?O.，Samaha?R.，Creelman?R.，Pilgrim?M.，Broun?P.，Zhang?J.，Ghandehari?D.，ShermanB.and?Yu?G.(2000)Arabidopsis?transcription?factors：genome-wide?comparative?analysis?amongeukaryotes.Science，290，2105-2110.

Selth?L.，Dogra?S.，Rasheed?M.，Healy?H.，Randles?J.and?Rezaian?M.(2005)A?NACdomain?protein?interacts?with?tomato?leaf?curl?virus?replication?accessory?protein?and?enhancesviral?replication.Plant?cell，17，311-325.

Souer，E.，van?Houwelingen，A.，Kloos，D.，Mol，J.and?Koes，R.(1996)The?No?ApicalMeristem?gene?of?petunia?is?required?for?pattern?formation?in?embryos?and?flowers?and?isexpressed?at?meristem?and?primordia?boundaries.Cell，85，159-170.

Suzuki?Y.，Uemura?S.，Saito?Y.，Murofushi?N.，Schmitz?G.，Theres?K.ard?Yamaguchi?I.(2001)A?novel?transposon?tagging?element?for?obtaining?gain-of-function?mutants?based?on?aself-stabilizingAc?derivative.Plant?Mol.Biol.，45，123-131.

Takada?S.，Hibara?K.，Ishida?T.and?Tasaka?M.(2001)The?CUP-SHAPED?COTYLEDON1gene?ofArabidopsis?regulates?shoot?apical?meristem?formation.Development，128，1127-1135.

Takeda?T.，Suwa?Y.，Suzuki?M.，Kitano?H.，Ueguchi-Tanaka?M.，Ashikari?M.，Matsioka?M.and?Ueguchi?C.(2003)The?OsTB1?gene?negatively?regulates?lateral?branching?in?rice.Plant?J.，33，513-520.

Vroemen，C.W.，Mordhorst，A.P.，Albrecht，C.，Kwaaitaal，M.A.C.J.and?de?Vries，S.C.(2003)The?CUP-SHAPED?COTYLEDON3?gene?is?required?for?boundary?and?shoot?meristemformation?in?Arabidopsis.Plant?Cell，15，1563-1577.

Wu?W.，Li?W.，Tang?D.，Lu?H.and?Worland?A.(1999)Time-related?mapping?of?quantitativetrait?loci?underlying?tiller?number?in?rice.Genetics，151，297-303.

Xie?Q.，Frugis?G.，Colgan?D.and?Chua?N.H.(2000)Arabidopsis?NAC1?transduces?auxinsignal?downstream?of?TIR1?to?promote?lateral?root?developmernt.Genes?Dev.，14，3024-3036.

Zou?J.，Chen?Z.，Zhang?S.，Zhang?W.，Jiang?G.，Zhao?X.，Zhai?W.，Pan?X.and?Zhu?L.(2005)Characterizations?and?fine?mapping?of?a?mutant?gene?for?high?tillering?and?dwarf?in?rice(Oryzasativa?L.).Planta，1-9.

Before the money, what is flat, Teng Sheng, once energetically, and Zhu Lihuang. the QTLs of rice tillering angle analyzes. Acta Genetica Sinica, 2001,28 (1), 29-32.

Shen Shengquan, Zhuan Jieyun, the bag sturdy pines, Zheng Kangle, the summer is soldierly bearing, Shu Qingyao. the qtl analysis of rice tillering maximum angle. Journal of Agricultural Biotechnology, 2005,13 (1), 16-20.

Summary of the invention

At the deficiencies in the prior art part, the invention provides a kind of rice tiller regulating gene OsTIL 1 and application thereof.

The present invention is to realize by such technical scheme for reaching above purpose: a kind of rice tiller regulating gene TIL1 encoded protein matter is provided, and it has the aminoacid sequence shown in the Seq ID No:2.

A kind of improvement as rice tiller regulating gene TIL1 encoded protein matter of the present invention: this aminoacid sequence also is included in and adds, replaces, inserts and lack the derivative that one or more amino acid generate in the aminoacid sequence shown in the Seq ID No:2.

The present invention also provides coding above-mentioned proteinic gene, and this gene has the nucleotide sequence shown in the Seq ID No:1.

A kind of improvement as gene of the present invention: nucleotide sequence also is included in and adds, replaces, inserts and lack mutant, allelotrope and the derivative that one or more Nucleotide generate in the nucleotide sequence shown in the Seq ID No:1.

The present invention also provides the plasmid that contains said gene.

The present invention also provides the plant expression vector of above-mentioned plasmid.

The present invention also provides the transgenic plant cells of above-mentioned nucleic acid.

The present invention obtains a tiller regulating gene OsTIL 1 by activating the label technique clone, and sequential analysis shows that this gene is different from the tiller regulating gene of having reported.And verified the function of this gene by transgenosis.This gene belongs to the transcription factor of NAC family.The clone of this gene helps to study the molecular mechanism of rice tillering genesis and development, has the high-yield rice kind of good plant type structure to producing to cultivate, or has very big application potential by the high yield plant type structure that transgenic method is improved other crops.

The present invention has set forth grow relevant gene of new and a rice tillering.The TIL1 gene belongs to the transcription factor of NAC family, is cloned into this gene by the mutant Ostil1 of tillering that screens from the fine mutant library of paddy rice Japan that activates the label insertion more.The transgenic experiments that its function is expressed OSTIL1 gene and RNA interference TIL1 gene through collaborative separate authentication and the enhancing of Southern trace and PCR is confirmed.This gene is positioned on the 4th karyomit(e) of paddy rice.Clone this full-length gene through 5 ' RACE and 3 ' RACE.The NAC structural domain of its cDNA coding has high conservative with other species NAC gene of having reported.RT-PCR shows, OSTIL1 gene constitutive expression in paddy rice is better than its hetero-organization at root and the expression of rhizome joint portion.

One of the object of the invention provides a kind of isolated dna molecular, and it comprises the dna sequence dna shown in Fig. 5 and Seq ID No:1.NAC family gene relevant of its coding with rice tillering growth.

Two of the object of the invention provides isolated protein of a kind of energy and albumen of equal value thereof, and it has 343 aminoacid sequences shown in the Seq ID No:2, perhaps with its aminoacid sequence at least 60% homologous protein.

Three of the object of the invention provides a kind ofly carries out the method for Plant Transformation efficiently with the OsTIL1 gene, specifically, the invention provides gene or the segmental carrier of Gene Partial with Seq ID No:1 and sequence shown in Figure 5, pcOV as shown in Figure 4 and pcRNAi, this carrier can express above-mentioned nucleotide sequence coded polypeptide or its homology analogue.

The present invention also provide a kind of utilize above-mentioned plant expression vector to vegetable cell transformation influence that monocotyledons tillers, the method for the branched number of dicotyledons and angle.

Realize that concrete technological step of the present invention is as follows:

One, paddy rice separation and the genetic analysis of mutant Ostil1 of tillering more:

Insert mutant by a large amount of screening and activating labels, the present invention has obtained the paddy rice mutant Ostil1 (Oryzasativa tillering 1) of tillering more, by experimental results show that with wild-type paddy rice reciprocal cross we have obtained a semidominance mutant that meets the genetic development of single-gene control, as shown in Figure 1.

Two, the plasmid rescue clone control paddy rice gene OsTIL 1 of tillering more:

Be that probe carries out the Southern results of hybridization and shows that Ostil1 causes (Fig. 2 C) owing to single copy Ds inserts with the Totomycin, the Ostil1 mutation type surface separates with Totomycin is collaborative.

From the mutant of tillering, take the adjacent dna sequence dna in side that Ds inserts with the plasmid rescue method more, compare through order-checking and rice genome sequence, discovery is inserted on the 4th karyomit(e) of paddy rice (Fig. 2 B), and the sequence of extending is carried out finding that there is a transcription factor OsTIL1 of NAC family (Fig. 2 A) in its downstream behind the function prediction.The BC that backcrosses with wild-type and mutant ₁F ₂The checking of colony shows that Ds inserts and the phenotype of tillering is worked in coordination with more.The Northern engram analysis proves that the OsTIL1 gene in this mutant character and downstream strengthens expression collaborative (Fig. 2 D).

Three, the functional verification of OsTIL1 gene, analysis:

Strengthen the expression of OsTIL1 gene in paddy rice by strengthening the express transgenic technology, having obtained the tillers transgenic paddy rice (Fig. 3 D) that the angle increases that increases, tillers, the transgenic paddy rice that utilizes RNA to interfere will to hang down OsTIL1 expression of gene amount in the mutant then to obtain tiller number and tillering angle all to tend to wild-type (Fig. 3 B, C).It is relevant with OsTIL1 expression of gene amount with the expansion of tillering angle that tillering number increases, and proves that OsTIL1 genetic expression can regulate tillering number and angle (Fig. 3).

China exists cultivated area to reduce population growth's contradiction at present.Press for the rice varieties of cultivating high yield and high quality, good plant type structure is the basis of decision rice yield and quality, and the development of genetic engineering technique makes that using OsTIL1 gene regulating plant type of rice structure becomes possibility.

Description of drawings

The tiller phenotype of mutant Ostil1 and wild-type (WT) of Fig. 1 paddy rice more;

Fig. 2 Ds inserts the analyses of copy number, on position and side expression of gene; Wherein

A, the structure of Ds on position and Ds element (DsAT);

B, the chromosome position that Ds inserts;

C, Ds inserts the copy number analysis in the Ostil1 mutant;

D, the Northern expression analysis of on position side gene;

IR: from the inverted repeats of Ac transposable element; The 35S:35S promotor; Amp ^r: ammonia benzyl resistant gene; Ori: intestinal bacteria replication origin; En4:4 series connection multiple enhancer element; Hgm ^r: hygromycin gene; MoaC, the MoaC family gene; R, root; SB, stem foot; S, stem; L, leaf; P, young fringe;

The answer checking of Fig. 3 Ostil1 mutant phenotype; Wherein

A-C, the RNA of Ostil1 mutant interferes the transgenic line phenotype;

A, the Ostil1 mutant;

B, C, and RNA interference transgenic line 1 and 2 (Ri1, Ri2);

D strengthens the transgenic line of expressing OsTIL1 and shows as mutation type surface in wild-type;

Left side seedling is a wild-type, the right two young plants be 1 and 2 for strengthening the express transgenic strain (OV1, OV2);

E, the quantitative RT-PCR analytical results;

Nip, wild-type; Blank bar is represented 2cm;

Fig. 4 pcOV and pcRNAi carrier collection of illustrative plates;

The cDNA sequence of Fig. 5 OsTIL1 gene;

The aminoacid sequence of Fig. 6 OsTIL1 genes encoding.

Embodiment

In the Japanese fine rice mutant storehouse of activating label T-DNA insertion structure, screen one more and tiller, the mutant material (Fig. 1) that the angle of tillering is big.The mean tillering number at the Ostil1 of the normal season of growth (April is to August) field planting is 27.5, is 2.4 times of wild-type.The angle of tillering is 41.3 degree, is 5.6 times of wild-type.Plant height is 62.8cm, is 65% (Fig. 1) of wild-type.From total DNA of the mutant of tillering, isolate the adjacent dna sequence dna in side that Ds inserts with the plasmid rescue method, compare through order-checking and rice genome sequence, discovery is inserted on the 4th karyomit(e) of paddy rice, work in coordination with compartment analysis and shows that mutant phenotype and Ds insertion work in coordination with according to inserting both sides, site genome sequence design primer.Carry out expression analysis and show and be inserting both sides, site gene owing to insert the NAC gene on right side, site and strengthen to express and cause.Clone this full length gene CDS (Seq ID No:1) through 5 ' RACE and 3 ' RACE, totally 1032 bases, these cDNA coding 343 amino acid whose protein (Seq ID No:2).Express and RNA interferes transgenic line at this gene constructed enhancing, found that in mutant the transgenic line that will hang down the OsTIL1 expression level by the RNA interference shows the phenotype of wild-type.And the transgenic line that strengthens this gene of expression in wild-type shows the phenotype of mutant.Thereby further determined the function (Fig. 3) of this Gene Handling tiller number and tillering angle.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the invention.

Embodiment 1,

1.Ostil1 screening mutant

The paddy rice mutant of tillering is to activate label T-DNA from more than 1000 to insert to screen the mutant libraries and obtain more, according to the phenotype called after Ostil1 of tillering (Oryza sativa tillering1).

2. the cultivation condition of rice material

Rice paddy seed is seeded on the seedbed then in 35 degree seed soaking 3 days.The seedling replanting of 4 leaf phases in the paddy field, the individual plant rice transplanting, density is 20 * 20cm ²

3. the clone of collaborative separation and OSTIL1.

Primary T-DNA inserts, the jump of Ds element and insert according to the method for (2001) such as Suzuki again and analyze, and the result shows that this mutant is caused by the Ds back insertion of jumping.The hygromycin gene that is arranged in the Ds element is used for carrying out the collaborative compartment analysis of mutant phenotype and Ds element.Utilize PCR and Southern to hybridize and determined whether that Ds inserts.The PCR primer is: GCTTCTGCGGGCGATTTGTGTA; CGGTCGCGGAGGCTATGGATG.Obtained insertion site flanking sequence by plasmid rescue.Cross over a pair of primer (ACCTGGTGTCTGCTTCCCTAACAG that inserts the site; ATGGCTGAGATGTGAATACGGTT) and be used for checking with the combination of 35S primer and exist Ds to insert.

Obtain the cDNA (containing the OsTIL1 open reading frame) of 1192bp by RT-PCR amplification, the primer is 5 '-AGGAGCAGTTAGCCAGGTAAAG-3 ' and 5 '-ATTAAGCGAACCTTGGTAGATG-3 '.The PCR reaction conditions is that 94 ℃ of 5min then are 94 ℃ of 30s of 31 circulations, 60 ℃ of 1.5min, 72 ℃ of 30s.The PCR product cloning is advanced the pUC-T carrier, carry out follow-up work after confirming through order-checking.

4. plasmid rescue

With phenol/chloroform purifying, the 3mol/L NaAc of 1/10 volume and two volumes dehydrated alcohol precipitate 20 μ g genomic dnas after the HindIII enzyme is cut.Precipitation is used for after with water dissolution from connecting reaction.(Takara, Japan) 16 ℃ are reacted 8h with 450U T4 ligase enzyme in the 200 μ l ligation systems.Connect the product isopropanol precipitating, with 75% washing with alcohol precipitation, dry, dissolution precipitation to final concentration is 100 μ g ml ^-1With electric shocking method it is converted in the E.coli DH5 α electric shock competent cell, transforms and use BioRad gene fusion instrument (voltage 2.5kv, resistance 200 Ω).On the LB solid medium that contains Amp resistance (50mg/l), screen resistance clone, cultivate 16h for 37 ℃.The picking positive colony checks order after PCR detects, and uses MegaBACE ^TM1000 (Amersham Pharmacia, USA) order-checkings.Paddy rice sequences all among sequence that obtains and the database GenBank are carried out BLAST (NCBI, National Center for Biotechnology Information, and in RGP genome annotation system, carry out predictive genes and note (http://ricegaas.dna.affrc.go.jp/) http://www.ncbi.nlm.nih.gov/BLAST).

Embodiment 2,

Vector construction and Plant Transformation

For cloned genes being carried out phenotype checking, mutator gene strengthened in wild-type express or interfere with the observation phenotype at mutant.Transform the callus (Chen etc., 2003) of wild-type (Japan is fine) to strengthening expression vector by agrobacterium-mediated transformation, and interference vector is transformed the callus of mutant Ostil1 and wild-type.

OsTIL1 clones with PCR method, and the primer is: AGGAGCAGTTAGCCAGGTAAAG; ATTAAGCGAACCTTGGTAGATG.The PCR product is long to be 1192bp.The PCR product is connected on the T carrier after reclaiming, and the reverse connection clone of choosing cuts with EcoRV, BamHI enzyme and is connected to pCAMBIA1301-35S, and the expression vector that is enhanced is pcOV.

OsTIL1 interference vector (pcRNAi) makes up as follows:

With one section among the following primer amplification OSTIL1 (470-804bp, 334bp altogether), upstream primer: AGAACGAGTGGGTGTTGT; Downstream primer: CTGCCCGTACTGCGTGAAG, the PCR product is long to be 334bp.The PCR product is connected to called after NAC2-2-T on the T carrier.Construction step: with NotI, BamHI double digestion this fragment forward is connected the left side of a nitrite reductase intron, with XhoI, EcoRV this fragment oppositely is connected this segmental right side again.To comprise at last that the carrier that obtains is pcRNAi on the pCAMBIA2301 carrier that these 3 fragments sequence are connected to band 35S.

It is rice transformation among the EHA105 (Chen etc., 2003) that two plasmids change the Agrobacterium strain over to by the method that shocks by electricity.With Ostil1 mutant and wild type seeds shelling sterilization, in the substratum of callus induction, after 3 weeks of cultivation, select growth vigorous, color is pale yellow, and more open embryo callus subculture is as the acceptor that transforms.Infect rice callus with the carrier EHA105 bacterial strain that contains the double base plasmid, after dark place 25 degree are cultivated 3 days, screening kanamycin-resistant callus tissue and transfer-gen plant on the selection substratum that contains 50mg/L Totomycin (to the G418 of interference vector) with 80mg/L.Totomycin or G418 resistance seedling be hardening in the cool, is transplanted to paddy field cultivation results T after the week ₁Generation.

At last, it is also to be noted that what more than enumerate only is a specific embodiment of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.

Sequence table

SEQ?ID?NO：1

ATGGAGCAGC?ATCAGGGCCA?GGCAGGCATG?GACTTGCCCC?CTGGCTTCCG?CTTCCACCCG 60

ACCGACGAGG?AGCTGATCAC?GCACTACCTC?GCCAAGAAGG?TCGCCGACGC?CCGCTTCGCC 120

GCCCTCGCCG?TCGCCGAGGC?CGACCTCAAC?AAGTGCGAGC?CCTGGGACCT?GCCATCTCTG 180

GCGAAGATGG?GGGAGAAGGA?GTGGTACTTC?TTCTGCCTCA?AGGACAGGAA?GTACCCGACG 240

GGGCTGAGGA?CGAACAGGGC?GACGGAGTCC?GGGTACTGGA?AGGCCACGGG?GAAGGACAAG 300

GACATCTTCA?GACGGAAGGC?CCTCGTCGGC?ATGAAGAAGA?CGCTCGTTTT?CTACACGGGG 360

CGCGCTCCCA?AGGGGGAGAA?GTCTGGCTGG?GTCATGCACG?AGTACCGCCT?CCACGGCAAG 420

CTCCACGCCG?CCGCCCTCGG?CTTCCTCCAC?GGCAAGCCCG?CGTCGTCCAA?GAACGAGTGG 480

GTGTTGTGCA?GGGTGTTCAA?GAAGAGCCTC?GTGGAGGTGG?GCGCGGCGGG?AGGGAAGAAG 540

GCGGCCGTGG?TGACGATGGA?GATGGCGAGG?GGAGGGTCGA?CGTCGTCGTC?CGTGGCGGAC 600

GAGATCGCCA?TGTCGTCCGT?CGTCCTCCCT?CCGCTGATGG?ACATGTCCGG?AGCCGGCGCC 660

GGCGCCGTCG?ACCCGGCGAC?GACGGCGCAC?GTGACCTGCT?TCTCCAACGC?GCTGGAGGGC 720

CAGTTCTTTA?ACCCGACGGC?AGTACACGGG?CACGGCGGCG?GCGACTCCTC?GCCGTTCATG 780

GCGAGCTTCA?CGCAGTACGG?GCAGCTGCAC?CACGGCGTGA?GCCTGGTGCA?ACTCCTGGAG 840

AGCTGCAACG?GCTACGGCGG?CCTCGTCGAC?ATGGCAGCGT?CCGGCAGCCA?GCTGCAGCCG 900

GCGGCGTGCG?GCGGCGAGCG?GGAGAGGCTT?AGCGCGTCGC?AGGACACCGG?CCTCACCTCC 960

GACGTGAACC?CGGAGATCTC?GTCATCCTCC?GGCCAAAAAT?TCGACCACGA?GGCCGCGCTA 1020

TGGGGCTACT?AA 1032

SEQ?ID?NO：2

Met?Glu?Gln?His?Gln?Gly?Gln?Ala?Gly?Met?Asp?Leu?Pro?Pro?Gly 15

Phe?Arg?Phe?His?Pro?Thr?Asp?Glu?Glu?Leu?Ile?Thr?His?Tyr?Leu 30

Ala?Lys?Lys?Val?Ala?Asp?Ala?Arg?Phe?Ala?Ala?Leu?Ala?Val?Ala 45

Glu?Ala?Asp?Leu?Asn?Lys?Cys?Glu?Pro?Trp?Asp?Leu?Pro?Ser?Leu 60

Ala?Lys?Met?Gly?Glu?Lys?Glu?Trp?Tyr?Phe?Phe?Cys?Leu?Lys?Asp 75

Arg?Lys?Tyr?Pro?Thr?Gly?Leu?Arg?Thr?Asn?Arg?Ala?Thr?Glu?Ser 90

Gly?Tyr?Trp?Lys?Ala?Thr?Gly?Lys?Asp?Lys?Asp?Ile?Phe?Arg?Arg 105

Lys?Ala?Leu?Val?Gly?Met?Lys?Lys?Thr?Leu?Val?Phe?Tyr?Thr?Gly 120

Arg?Ala?Pro?Lys?Gly?Glu?Lys?Ser?Gly?Trp?Val?Met?His?Glu?Tyr 135

Arg?Leu?His?Gly?Lys?Leu?His?Ala?Ala?Ala?Leu?Gly?Phe?Leu?His 150

Gly?Lys?Pro?Ala?Ser?Ser?Lys?Asn?Glu?Trp?Val?Leu?Cys?Arg?Val 165

Phe?Lys?Lys?Ser?Leu?Val?Glu?Val?Gly?Ala?Ala?Gly?Gly?Lys?Lys 180

Ala?Ala?Val?Val?Thr?Met?Glu?Met?Ala?Arg?Gly?Gly?Ser?Thr?Ser 195

Ser?Ser?Val?Ala?Asp?Glu?Ile?Ala?Met?Ser?Ser?Val?Val?Leu?Pro 210

Pro?Leu?Met?Asp?Met?Ser?Gly?Ala?Gly?Ala?Gly?Ala?Val?Asp?Pro 225

Ala?Thr?Thr?Ala?His?Val?Thr?Cys?Phe?Ser?Asn?Ala?Leu?Glu?Gly 240

Gln?Phe?Phe?Asn?Pro?Thr?Ala?Val?His?Gly?His?Gly?Gly?Gly?Asp 255

Ser?Ser?Pro?Phe?Met?Ala?Ser?Phe?Thr?Gln?Tyr?Gly?Gln?Leu?His 270

His?Gly?Val?Ser?Leu?Val?Gln?Leu?Leu?Glu?Ser?Cys?Asn?Gly?Tyr 285

Gly?Gly?Leu?Val?Asp?Met?Ala?Ala?Ser?Gly?Ser?Gln?Leu?Gln?Pro 300

Ala?Ala?Cys?Gly?Gly?Glu?Arg?Glu?Arg?Leu?Ser?Ala?Ser?Gln?Asp 3l5

Thr?Gly?Leu?Thr?Ser?Asp?Val?Asn?Pro?Glu?Ile?Ser?Ser?Ser?Ser 330

Gly?Gln?Lys?Phe?Asp?His?Glu?Ala?Ala?Leu?Trp?Gly?Tyr 343

Claims (8)

1, a kind of rice tiller regulating gene OsTIL 1 encoded protein matter, it is characterized in that: it has the aminoacid sequence shown in the Seq ID No:2.

2, rice tiller regulating gene OsTIL 1 encoded protein matter according to claim 1 is characterized in that: described aminoacid sequence also is included in and adds, replaces, inserts and lack the derivative that one or more amino acid generate in the aminoacid sequence shown in the Seq ID No:2.

3, a kind of coding claim 1 or 2 described proteinic genes, it is characterized in that: described gene has the nucleotide sequence shown in the Seq ID No:1.

4, coding claim 1 according to claim 3 or 2 described proteinic genes is characterized in that: described nucleotide sequence also is included in and adds, replaces, inserts and lack mutant, allelotrope and the derivative that one or more Nucleotide generate in the nucleotide sequence shown in the Seq ID No:1.

5, a kind of plasmid that contains claim 3 or 4 described genes.

6, a kind of plant expression vector as plasmid as described in the claim 5.

7, a kind of transgenic plant cells that comprises claim 3 or 4 described nucleic acid.

8, a kind of method that rice tillering is transformed is characterized in that: comprise that the rice cell after will transforming is again cultivated into plant with the described gene transformation rice cell of claim 3.

Images