CN1786176A

CN1786176A - Domestic natural silk gland bioreactor and its construction method

Info

Publication number: CN1786176A
Application number: CN 200410089203
Authority: CN
Inventors: 陆长德; 郭秀洋
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Priority date: 2004-12-08
Filing date: 2004-12-08
Publication date: 2006-06-14
Anticipated expiration: 2024-12-08
Also published as: CN100363498C

Abstract

The invention discloses a cultivated silkworm sericin-1 gene promoter and cultivated silkworm silk gland bioreactor drove by signal peptide coding area. It contains setting the promoter, DNA segment, gene, silk gland special excretion plasmid, donor plasmid; transforming DH10Bac.EGT competent cell; extracting recombination virus DNA; loading carrier cell to form recombination virus plasmid; and enlarging virus; injecting cultivated silkworm. The separating and purifying is very convenient; and the cultivated as altitude eukaryote, its silk gland always can be exactly expressed, decorated eukaryon albumen.

Description

Domestic natural silk gland bioreactor and construction process thereof

Technical field

The invention belongs to gene engineering technology field, specifically, be about a kind of albumen heterologous expression system, more particularly, be to drive domestic natural silk gland bioreactor and the construction process thereof of foreign gene at the special secreting, expressing of domestic natural silk gland about a kind of silk gum-1 gene promoter and signal peptide coding region.

Background technology

The heterologous expression system of a good eukaryotic protein should have the expression amount height, and expressed eukaryotic protein can correctly be modified, fold, locate, and is convenient to features such as downstream purification, and wherein the problem of purifying is the most difficult.Existing expression system mainly contains escherichia expression system, yeast expression system, insect cell-baculovirus expression system, mammalian cell expression system etc.Wherein, intestinal bacteria and yeast expression system expressed proteins amount are many, and cost is low, but expressed foreign protein can not meet the demands the aspect such as modifying, folding.Mammalian cell expression system is being best aspect the expressed proteic functionalized modification, and is with the obvious advantage aspect expression macromolecule eukaryotic protein, but this system is consuming time expensive, and expression amount is not high, is difficult for scale operation.The system expression amount height that baculovirus and insect cell are formed, expressed albumen are also modified normally folding and are had correct function, and baculovirus does not infect Mammals thereby security might as well.But it is higher to express cost in culturing cell.

Silkworm is a kind of lepidopteran economic insects of the domestic domestication of process that can weave silk.Over thousands of year,, obtained big, the individual economic strain with different qualities such as big of many amounts of weaving silk through the artificial screening breeding of various objectives.In the China relatively advanced country of such silkworm industry, normalized silkworm scale and raised pattern in order to satisfy the needs of silk reeling industry, to have developed.The normal development that this has not only ensured the silk industry has also made things convenient for the exploitation to other purposes of silkworm.Because silkworm has huge albumen synthesis capability, it is considered to be used for to carry out the good carrier that the heterologous protein of high added value is expressed.In this respect, there have been two kinds of different technological lines to obtain success.One is to be the cultivation of the stable exogenous gene expression strain of representative with the silkworm transgenosis.Promising green fluorescent protein reporter gene of setting up system and carrying out also has the proteic expression of recombinant human collagen (T.Tamura, et al.Nat.Biotech., 2000,18:81-84 in the expression of different tissues in the middle of this; Tomita M, et al.Nat.Biotech, 2003,21:52-56; Imamura M, et al.Genetics, 2003,165:1329-1340; Thomas JL, et al.Insect Biochem Mol Biol, 2002,32:247-253).Another is recombinant bombyx mori nuclear polyhedrosis virus inoculation silkworm larva or pupa with the heterologous protein gene expression construct that carries high added value, gathers in the crops the technological line of the silkworm body bio-reactor of recombinant protein from the polypide that infects.Existing human, viruses of human hepatitis B's surface antigen, human growth hormone, acidity and many kinds of heterologous proteins such as alkaline fiber archeocyte somatomedin, human granulocyte-macrophage colony stimulating factor and cattle gamma interferon have obtained successful expression (Maeda S in the middle of this, et al.Nature, 1985,315:592-594; Higashihashi N, et al.J Virol Methods, 1991,35:159-167; Kadonookuda K., et al.Biochemicaland Biophysical Research Communication, 1995,213:389-396; Wu X, et al.Protein Expr Purif, 2001,21:192-200; Shi X, et al.Biotechnol Appl Biochem, 1996,24:245-249; Murakami K, etal.Cytokine, 2001,13:18-24).In two kinds of routes, the technical difficulty of the cultivation of silkworm transgenic strain is bigger.

(Baculovirus Expression Vector System BEVS) is the another efficient expression system of setting up to the baculovirus expression carrier system behind intestinal bacteria, yeast and mammalian cell expression system.Its utilization is carried the high added value protein gene and is efficiently expressed the recombinant baculovirus of framework to insect or the efficient ability that infects of its clone, great expression target protein in metainfective host's individuality or culturing cell.Because as not only inserting the exogenous dna fragment that reaches 10kb at some sections that does not influence the infection duplication function on the baculovirus genome of expression vector, these sections also can lack or be replaced by exogenous dna fragment in the certain-length scope.BEVS is since nineteen eighty-three sets up [11], and existing nearly thousand kinds of foreign genes have obtained expression in this system.The used recombinant baculovirus of this system mainly is reorganization autographa california nuclear polyhedrosis virus (rAcMNPV) and recombinant bombyx mori nuclear polyhedrosis virus (rBmNPV) at present.The former host autumn mythimna separata individuality is very little, generally is to fit in a system with autumn mythimna separata (Spodopterda frugperda) culturing cell-rAcMNPV to use.Recombinant bombyx mori nuclear polyhedrosis virus then mainly is to be combined together use with silkworm larva or pupa, walks the route of silkworm body bio-reactor.

When utilizing cultivation insect cell and rhabdovirus system expression foreign protein, a strategy of simplifying purification step is that the foreign protein of expression is secreted in substratum, thereby reduce the foreign protein amount (Tessier that mixes with target protein, D.C., et al.Gene, 1991,8:177-183; O ' Reilly, D.R., Miller, L.K., and Luchow, V.A.Baculovirus expression vectors.1992, W.H.Freeman and Company, New York).

Domestic natural silk gland is typical external secretion body of gland.It is to be pipe synthetic, that secrete the monolayer cell tube wall that megalokaryocyte surrounded of silk-protein by the function eggcase.The albumen of the synthetic justacrine of sericterium in the sericterium chamber is totally two classes, i.e. silk fibroin and sericin.Silk fibroin is synthetic at posterior division of silkgland, by the composition of proportions with 6: 6: 1 of heavy chain, light chain and three kinds of protein moleculars of P25, is insoluble in water (Cong-Zhao Zhou, et al.Nucleic Acids Research, 2000,28 (12): 2413-2419; Inoue S, et al.J Biol Chem, 2000,275 (51): 40517-28).

Silk gum mainly is made of through each 4 kind of producing of alternative splicing and 2 kinds of molecules at middle division of silkgland ser1 and two genes of ser2, can water-soluble (Michaille J.J., et al.Biochimie, 1986,68:1165-1173; Michaille J.J., et al.Gene, 1990,86:177-184).The silk cocoon dry weight that some cultivated silkworm breed variety sericterium synthetic silk-protein constitutes can reach 0.5 gram.General silk gum accounts for 30% of silk-protein, based on the ser1 expression product.Because sericterium is synthetic, the huge ability of secretion silk-protein, it be counted as a kind of extremely huge potentiality good bio-reactor (Louis Marie Houdebine.Transgenic Research, 2000,9:305-320).And owing to only contain silk fibroin and sericin in the sericterium chamber, its character is more special, is easy to separate with other target protein matter, will bring great convenience for the back separation and purification.This advantage will be existing expression system can't be obtained.

As described above, use reorganization BmNPV usually at silkworm expression in vivo foreign protein genes, and it is generally acknowledged, AcMNPV does not infect silkworm, unless its p143 gene is replaced (Maeda S, et al.J Virol by the p143 Gene Partial of BmNPV, 1993,67:6234-6238; Croizier G, et al.Proc Natl Acad Sci USA, 1994,91:48-52).The present inventor is through discovering, the AcMNPV that the p143 gene does not suddenly change also can infect the economic strain (Guo T.et al.Archives of Virology, 2004, Sep 21[Epub ahead of print]) of some silkworms.

Summary of the invention

The present inventor is through discovering that the AcMNPV that the p143 gene does not suddenly change also can infect the economic strain of some silkworms, and the shown illness of infected silkworm is with similar by the shown illness of reorganization BmNPV infection.That is to say, also might utilize the silkworm larva of common some strain of reorganization AcMNPV virus infection or pupa and constitute silkworm biological reactor.Because it is more convenient that business-like AcMNPV makes up and uses, we utilize AcMNPV to set up the single-minded secreting, expressing system of sericterium, also are suitable for the BmNPV recombinant virus.

Purpose of the present invention just is to utilize AcMNPV can infect the ability of part silkworm strain and sericterium is synthetic, the huge ability of secretory protein, thus the domestic natural silk gland bioreactor that provides a kind of silkworm silk gum-1 gene promoter and signal peptide coding region to drive.

Another object of the present invention is to provide a kind of construction process of above-mentioned domestic natural silk gland bioreactor.

The construction process of the domestic natural silk gland bioreactor that silkworm silk gum-1 gene promoter of the present invention and signal peptide coding region drive is as follows:

A, structure contain the dna fragmentation of silk gum-1 gene promoter and signal peptide coding region, the sequence in silk gum-1 gene polyA signal site and the special secreting, expressing plasmid of sericterium of external source goal gene;

B, the external source destination gene expression frame that adopts suitable restriction endonuclease cutting-out silk gum-1 gene promoter and signal peptide coding region to drive, the swivel base donor plasmid of insertion virus expression systems;

C, have the swivel base donor plasmid of the external source destination gene expression frame that silk gum-1 gene promoter and signal peptide coding region drive to transform the clone to enter the bacterial strain of virus expression systems special use;

The viral DNA of d, extracting bacterial strain imports carrier cell, is assembled into the recombinant virus plasmid with infection, replication, and virus is increased on a large scale;

E, the recombinant virus inoculation silkworm to obtain are built into the domestic natural silk gland bioreactor that silkworm silk gum-1 gene promoter and signal peptide coding region drive.

The domestic natural silk gland bioreactor that silkworm silk gum-1 gene promoter that the present invention makes up and signal peptide coding region drive, because target protein is to secrete in silk-protein, and the albumen kind is only had an appointment 10 kinds in the silk-protein, therefore, separation and purification is very convenient; And silkworm is as higher eucaryote, and eukaryotic protein generally can both correctly be expressed, be modified to its sericterium.

Description of drawings

Fig. 1 is the gel electrophoresis synoptic diagram of PCR clone product after adding the A processing of silk gum 1 gene (ser1 gene) promotor and signal peptide coding region thereof.

Fig. 2 is the structure synoptic diagram that is used for the donor plasmid of recombinant virus.

Fig. 3 is the secretion situation synoptic diagram of the egfp of silk gum 1 gene promoter and signal peptide coding region guiding thereof at sericterium expression and distribution situation and EGFP.

EGFP exists the Western of situation to hybridize the detected result synoptic diagram to Fig. 4 in silk albumen and the sericterium chamber liquid filaments albumen for the silkworm that infects recombinant virus tells.

Fig. 5 A is the ion-exchange separation and purification peak figure of EGFP primary extract.

Fig. 5 B is the fluorescence spectrum scanning result synoptic diagram of the ion-exchange substep gleanings of EGFP primary extract.

Embodiment

Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples only to be used to the present invention is described and be not used in the scope of the present invention that limits.

The PCR clone of embodiment 1, silk gum 1 gene (ser1 gene) promotor and signal peptide coding region thereof

Respectively with reference to GeneBand ^TMIn/EMBL Data Bank the database call number be the publishing thesis of the sequence of M64781 and Garel etc. (Garel A., et al.Insect Biochem.Molec.Biol.1997 27:469-477), design two primers:

Primer 1:5 ' gaaattcttagctacatctagcccag 3 ';

Primer 2: 5 ' gcatgcctgcaggtgaccgaaagcttttacgc 3 ';

Genomic dna (Inst. of Silkworm, Chinese Academy of Agricultural Sciences (Jiangsu with 200ng cultivated silkworm breed variety 54A, Zhenjiang)) be template, the PCR clone contains the 5 ' flanking sequence of ser1 gene promoter and the dna fragmentation of exons 1, introne 1 and the exon 2 partial sequence of encoding for signal peptide; Because fragment is longer, used archaeal dna polymerase be LA Taq (TaKaRaBiotechnology Co., Ltd.);

The PCR reaction system is as follows:

Contain among the 25 μ l: each 20pmol of primer 1 and primer 2; Each dNTP final concentration 0.4mM; 54A genomic dna 200ng; MgCl ₂Final concentration 1.5mM; 10 * PCR reaction buffer, 2.5 μ l; LA Taq 1.25U.

The PCR reaction conditions is:

94 ℃ of sex change 5 minutes, 94 ℃ of sex change of 25 round-robin 30 seconds, 60 ℃ of annealing 30 seconds, 68 ℃ were extended 150 seconds, after the loop ends again 72 ℃ extended 10 minutes.

The PCR product adds an amount of distilled water and adjusts volume to 0.5ml, adds equal-volume phenol chloroform (balance phenol and chloroform equal-volume mixture), fully vibration, centrifugal 10 minutes of 12000g.Supernatant is transferred to a new centrifuge tube, adds 1/10 volume 3M NaAc (pH=5.2), the two volumes dehydrated alcohol, fully vibration, 12000g obtained the DNA precipitation in centrifugal 10 minutes.With 70% washing with alcohol once, instantaneous centrifugal, absorb ethanol.To reclaim fragment and be dissolved to 10 μ l, add 10 * PCRreaction buffer, 2.5 μ l, 2.5mM dATP 2 μ l, common taq enzyme 1.25U, an amount of distilled water is to cumulative volume 25 μ l.72 ℃ of water-baths added A in 10 minutes and handle.Carry out the low melting-point agarose gel electrophoresis then, electrophoresis result as shown in Figure 1.Behind the electrophoresis, cut off the blob of viscose of the position that contains the 3700bp size DNA band of having an appointment and put into a 1.5ml centrifuge tube.Add an amount of distilled water and adjust volume, place 65 ℃ of water-baths that blob of viscose is melted to 0.5ml.Take out centrifuge tube, add the equal-volume balance phenol, fully vibration, centrifugal 10 minutes of 12000g.Supernatant is transferred to a new centrifuge tube, adds equal-volume phenol chloroform (balance phenol and chloroform equal-volume mixture), fully vibration, centrifugal 10 minutes of 12000g.Supernatant is transferred to a new centrifuge tube, adds the equal-volume chloroform, fully vibration, centrifugal 10 minutes of 12000g.Supernatant is transferred to a new centrifuge tube.Add 1/10 volume 3M NaAc (pH=5.2), the two volumes dehydrated alcohol, fully vibration, 12000g obtained the DNA precipitation in centrifugal 10 minutes.With 70% washing with alcohol once, instantaneous centrifugal, absorb ethanol.The recovery fragment cloning that will obtain then advances T carrier pUCm-T (lottery industry biotech company), the plasmid called after pSerp-T that obtains, downcut the dna fragmentation that contains silk gum 1 gene promoter and signal peptide coding region section thereof with Bgl II and SphI from plasmid pSerp-T, it has sequence shown in SEQ ID NO:1 through checking order.

Embodiment 2, contain the clone of the sequence in silk gum 1 gene polyA signal site

Design following primer:

Primer 3:5 ' tctagaggttccagcacaagtggaggagc 3 ';

Primer 4:5 ' cgatgacacctcaacggggtgtgag 3 ';

Is the sequence that the template pcr amplification obtains containing silk gum 1 gene polyA signal site with

primer

3 and 4 with 200ng silkworm 54A genomic dna.

The PCR reaction system is as follows:

Contain among the 25 μ l: corresponding each 20pmol of two primers; Each dNTP final concentration 0.2mM; Template DNA; MgCl ₂Final concentration 1.5mM; 10 * PCR reaction buffer, 2.5 μ l; High-fidelity Taq archaeal dna polymerase 1.25U.

The PCR reaction conditions is:

94 ℃ of sex change 5 minutes, 94 ℃ of sex change of 25 round-robin 30 seconds, 60 ℃ of annealing 30 seconds, 68 ℃ were extended 30 seconds, after the loop ends again 72 ℃ extended 10 minutes.

Resulting fragment is handled rear clone and is advanced T-carrier (Promega) through adding A, the plasmid called after pSer3-T that obtains, and it has sequence shown in SEQ ID NO:2 through checking order.

The clone of embodiment 3, external source goal gene-green fluorescent protein egfp gene

Design following primer:

Primer 5:5 ' aagcttgtcgacagatctgcatgcatggtgagcaagggcg 3 ';

Primer 6:5 ' ggtaccggatccttacttgtacagctcgtc 3 ';

Is that the template pcr amplification obtains green fluorescent protein egfp gene fragment with primer 5 and 6 with 10ng plasmid pEGFP-N1 (Clontech).

The PCR reaction system is as follows:

The PCR reaction conditions is:

Resulting fragment is advanced T-carrier (Promega) through adding A processing rear clone, the plasmid called after pEGFP-T that obtains, and it has the sequence shown in the SEQ ID NO:3 through checking order.

The structure of embodiment 4, the special secreting, expressing plasmid of sericterium pSerpEGFP

With EcoR I and Kpn I double digestion plasmid pSer3-T, obtain containing the sequence in silk gum 1 gene polyA signal site, insert the corresponding site of plasmid pUC19 (Gibco BRL company).Resulting plasmid Hind III and Kpn I double digestion, electrophoresis reclaims its 3300bp fragment.

With Hind III and Kpn I double digestion plasmid pEGFP-T, obtain 750bp green fluorescent protein egfp gene small segment, the fragment of the 3300bp that obtains suddenly with previous step is connected, and obtains plasmid pEGFPser3.

With Bgl II and Sph I double digestion plasmid pSerp-T, cut out the dna fragmentation that contains silk gum 1 promotor and signal peptide coding region, be inserted into be positioned among the pEGFPser3 egfp gene 5 ' corresponding site, obtain the special secreting, expressing plasmid of sericterium pSerpEGFP.It has the sequence shown in the SEQ ID NO:4 through sequencing.

Embodiment 5, recombinant virus preparation

Relevant recombinant virus preparation method is with reference to Bac-to-Bac Baculovirus Expression System instructionmanual (Invitrogen life technologies), and key step is as follows:

1, the structure that is used for the donor plasmid of recombinant virus

With EcoR I and Bgl II double digestion plasmid pSerpEGFP, therefrom cut out egfp expression of gene framework; With EcoRI and BamH I double digestion plasmid pFFa2 (Guo et al, Archives of Virology, Published online:21, September, 2004), reclaim its 4600bp fragment, be connected with egfp expression of gene framework then, obtain donor plasmid pFFa2-serpegfp, Fig. 2 is seen in the process signal.

2, donor plasmid is recombinated to virus genomic swivel base

2.1, preparation contains the LB bacterial solids culture plate of 50 μ g/ml kantlex, 7 μ g/ml gentamicins, 10 μ g/ml tsiklomitsins and 25 μ g/ml paraxin and contains the microbial culture test tube of the same concentration microbiotic of 3ml LB liquid.

2.2, CaCl ₂Legal system is equipped with DH10Bac Δ EGT (Guo et al, Archives of Virology, Published online:21, September, 2004) competent cell.Method is with reference to " molecular cloning " (Sambrook J et al.Cold Spring HarborLaboratory Press, 1989).

2.3, get the frozen competent cell of 200 μ l, ice bath adds the about 100ng donor plasmid of 1 μ l DNA ice bath 30min after melting, 42 ℃ of processing 90s, ice bath 2min.Transfer to then the test tube that contains 3ml LB bacterial liquid substratum with 250～300rpm 37 ℃ of shaking culture 4 hours.

2.4, contain each figure cloth 50 μ l on four kinds of antibiotic LB flat boards at three and be dissolved in the X-gal of 100mg/ml of dimethyl formamide and the IPTG aqueous solution of 10 μ l 200mg/ml.The bacterium liquid that previous step was cultivated after 4 hours is centrifugal then, keeps about 300 μ l LB solution the gained thalline is suspended.Then at each planar surface difference even figure cloth 5 μ l, 50 μ l and 250 μ l.

2.5,37 ℃ cultivated 24-48 hour, to there being blue clearly hickie clone to occur.

3, the separation of recombinant virus genomes DNA (Bacmid)

3.1, choose about 10 hickie clearly with transfering loop, streak culture in containing on the LB flat board that four kinds of microbiotic, figure are furnished with X-gal and IPTG of new preparation.

3.2, choose the white mono-clonal that grows after the line and be inoculated in and contain four kinds of antibiotic liquid LB test tubes, 37 ℃ with 250-300rpm shaking culture 24 hours.

3.3,1.5ml gone up the step nutrient solution be transferred to a 1.5ml centrifuge tube, centrifugal 1 minute of 14000g.

3.4, inhale and to remove supernatant, extract the used solution I of plasmid (50mmol/L glucose, 25mmol/LTris-HCl (pH8.0), 10mmol/L EDTA) 200 μ l suspension bacterial sediments in a small amount with alkaline lysis; (0.2mol/L NaOH 1%SDS), slowly puts upside down the centrifuge tube mixing, and room temperature was placed 5 minutes to add 200 μ l solution II then; The solution III (3mol/L NaAc, 5mol/L HAc pH4.8) that slowly adds 200 μ l precoolings, the light and slow centrifuge tube of putting upside down mixes several times, places on ice 5～10 minutes.

3.5, the centrifugal 10min of 14000g.Supernatant is transferred to new centrifuge tube, and adds 540 μ l Virahols, slowly puts upside down the centrifuge tube mixing, placed on ice 5～10 minutes, or-20 ℃ of preservations of spending the night.

3.6, centrifugal 15 minutes of 14000g room temperature.Absorb supernatant, add 500 μ l, 70% ethanol, put upside down centrifuge tube washing precipitation for several times.Centrifugal 5 minutes of 14000g room temperature exhausts supernatant, room temperature place about 5 minutes suitably drying precipitated.

3.7, with 40 μ l TE dissolution precipitation DNA ,-20 ℃ of preservations are standby.

3.8, the PCR of reorganization Bacmid identifies.

The primer to a pair of be M13 forward and reverse primer (Shanghai bio-engineering corporation), another is to being egfp forward primer (embodiment 1.2, primer 3) and M13 reverse primer.Use the positive and negative primer amplification of M13 simultaneously, if about 300bp fragment then illustrates the impure or not reorganization of recombinant virus.If the positive and negative primer amplification of M13 does not have the 300bp fragment to occur, primer that goal gene is special and M13 reverse primer can amplify size and be pure and correct reorganization has taken place for the fragment of 2000bp then illustrates resulting recombinant virus dna.

The foundation of PCR reaction system and circulation are provided with reference to embodiment 1.2.

4, reorganization Bacmid transfection Sf-9 cell

4.1, the Sf-9 cell cultures

Take out frozen sf-9 cell (GIBCO BRL) in the liquid nitrogen, put rapidly in 27 ℃ of water, rock rapidly.Be transferred to a 15ml cell centrifugation pipe after melting fully, slowly drip PBS to the cumulative volume 10ml.Centrifugal 5 minutes of 800rpm, supernatant discarded.Cell precipitation suspends with containing foetal calf serum and antibiotic Grace ' s substratum (GIBCO BRL), is transferred to 25cm ²Tissue Culture Flask, substratum adds to 5ml, and 27 ℃ of cell culture incubators are cultivated.Changed liquid in per two days once or go down to posterity according to the cell growing state.Elder generation absorbs original substratum when going down to posterity, and adds the 5ml fresh culture, blows and beats gently with pipettor suction nutrient solution the part attached cell is come off.According to the cell of blowing and beating they are laid on one or several new cell cultures flask culture again, every flask culture base is mended to 5ml, and 27 ℃ of cell culture incubators are cultivated.Former bottle can add the 5ml substratum again to be continued to cultivate.

4.2, with Lipofectin Reagent (GIBCO BRL) the Bacmid importing Sf-9 cell of will recombinate

4.2.1, add from cell growth condition good culturing bottle light and slow piping and druming under 4 * 10 by every hole 1ml in cell cultures in 12 orifice plates ⁵The cell suspending liquid of individual cell/ml left standstill cultivation at least 1 hour, made adherent.

4.2.2, in the 1.5ml centrifuge tube, prepare two kinds of solution, A: be accredited as Grace ' the s substratum (GIBCO BRL) that pure reorganization bacmid DNA 3 μ l are dissolved in 200 μ l antibiotic-frees and foetal calf serum through PCR; B:1 μ l Lipofectin Reagent is dissolved in Grace ' the s substratum of 200 μ l antibiotic-frees and foetal calf serum.With both mixings that vibrates, room temperature was placed 20 minutes.Then both are mixed, the vibration mixing, room temperature was placed 30 minutes.

4.2.3, absorb the original fluid of culturing cell in 12 orifice plates, and with 0.5ml serum-free and antibiotic Grace ' s substratum slight wobble, exhaust with the former residual substratum of flush away.The AB mixed solution in last step is added in the hand-hole, and 27 ℃ of cell culture incubators were cultivated 5 hours.

4.2.4, the AB mixed solution of exhaustion in the culture hole, add and contain foetal calf serum and antibiotic Grace ' s substratum 1ml, 27 ℃ of cell culture incubators were cultivated about 72 hours.

4.2.4, the observation of cell form, the cell big circle that becomes that rises when having a large amount of amplifications of virus to duplicate, the trend that has bunchiness to merge.Gather in the crops nutrient solution in the 1.5ml centrifuge tube this moment, and centrifugal 5 minutes of 500g, supernatant move the virus that is increased for the first time in a new centrifuge tube.4 ℃ of dark preservations also can be put-70 ℃ of preservations.

4.3, virus a large amount of amplifications, purifying, preservation and titer determination

4.3.1, a large amount of amplification: to the 25cm that cell grows fine, attached cell almost is paved with bottle wall ²The virus-culturing fluid that adds the first amplification of 20 μ l in the Tissue Culture Flask.Can gather in the crops virus after about 48 hours.

4.3.2, the purifying of a large amount of amplicon virus: the virus of results was removed cell debris in centrifugal 10 minutes with 500g earlier, and with 35000g, 4 ℃ are centrifugal 60 minutes in Avanti J-E whizzer JA-21 rotary head (BECKMAN COULTER) for the gained supernatant.Absorb supernatant immediately, precipitation is resuspended with Grace ' the s nutrient solution of 1/5 original volume that contains microbiotic and foetal calf serum.4 ℃ of dark preservations.

4.3.3 titer determination:

Cell cultures with 96 orifice plates in 103 Sf-9 cells of inoculation, leave standstill cultivate make more than 1 hour adherent.

Do 10 times of gradient dilutions with the virus that cell culture medium will increase in a large number, concrete grammar is: get 10 1.5ml centrifuge tubes, every pipe adds Grace ' the s substratum that 900 μ l contain microbiotic and foetal calf serum, get a large amount of amplicon virus liquid of 100 μ l and add the first pipe mixing, add the second pipe mixing from wherein getting 100 μ l, take out 100 μ l from second pipe and add the 3rd pipe mixing, be diluted to the 10th pipe successively, promptly obtained 10 of a large amount of amplicon virus ^-1-10 ^-10Gradient dilution.

Inhale in turn and remove original substratum in each hole of 96 orifice plates.Add from 10 immediately ^-3The viral liquid 100 μ l of the every kind of dilution gradient that rises, each dilution gradient adds 10 holes.Like this, from 10 ^-3To 10 ^-10, every kind of gradient has 10 parallel infection holes.Culture plate is put 27 ℃ of cell culture incubators and was cultivated 6-7 days, observes the infection conditions of each gradient.

Press Tissue Culture Infectious Dose 50 (TCID ₅₀) method (with reference to Qbiogene " adenovator vectorsystem ") calculate virus titer.Be T=10 ^{1+d (s-0.5)}, promptly obtain virion subnumber in the 100 μ l virus stock solution useds.Wherein, d is the logarithmic value of extension rate, is Log10 herein, equals 1.S for each the dilution gradient 10 holes in by the virus infection hole count account for ten hole sums per-cent and.This experiment is because can predict 10 ^-1With 10 ^-2Can all infect, both are all in 1.With the data instance of this experiment, 10 ^-6All infect in ten holes of gradient and more high-gradient inoculation; 10 ^-7In ten holes of gradient inoculation 5 infection are arranged, 10 ^-8In ten holes of gradient inoculation 3 infection are arranged; 10 ^-9With 10 ^-10Ten holes of gradient inoculation there is no infection, then S=1+1+1+1+1+1+0.5+0.3+0+0=6.8.The titre of 100 μ l is T=10 ^{1+1 (6.8-0.5)}=10 ^7.3, promptly the virion subnumber is about 2 * 10 in the 100 μ l virus stock solution useds ⁷Individual.

Present method is only still good at the negative control cell state, and just is suitable under the infected situation of ten hole nones of minimum at least dilution gradient.

Embodiment 6, recombinant virus are to inoculation and the sericterium Fluirescence observation of silkworm

Silkworm 54A (Inst. of Silkworm, Chinese Academy of Agricultural Sciences) raises in 25 ℃ of mulberry leaf, virus inoculation when play silkworm 5 ages.Virus after the mensuration titre is diluted to every milliliter 10 with cell culture fluid ⁸PFU.Draw viral suspension by every silkworm 10 μ l subcutaneous injections with 50 μ l microsyringes, make virus enter silkworm body fluid.The recombinant virus AcFFa2 Δ EGT (Guoet al, Archives of Virology, Published online:21, September, 2004) that no egfp expresses framework injects simultaneously as negative control.Silkworm and mulberry leaf after the injection is fed, and one to twice silkworm of spray in a day uses microbiotic " gram silkworm bacterium " (Inst. of Silkworm, Chinese Academy of Agricultural Sciences) in case the silkworm infectation of bacteria.

Raise after about 5 days and to observe, the silkworm of injecting virus occurs that food leaf amount reduces, the weak and limp few elasticity of body, the more typical recombinant virus infection symptom such as overlapping of unable, the intersegmental membrane of abdominal foot atrophy when creeping.Dissect the silkworm body this moment, therefrom takes out sericterium flush away in PBS (PH7.0) and stick fragment of tissue.Put regularly on slide glass then, put to observe under the fluorescent microscope (LeicaMZFLIII) and take pictures, as shown in Figure 3, sericterium presents the EGFP green fluorescence, and the middle part fluorescence of middle division of silkgland obviously is better than posterior division of silkgland.

The preparation of embodiment 7, EGFP primary extract, FPLC preliminary purification and fluorescence spectrometry

1, the preparation of EGFP primary extract

Separate the sericterium that cuts rapidly in distilled water rinsing remove and stick the fragment tissue, cut middle division of silkgland with clean scissors and place an ice-cold clean plate in addition, add ice-cold distilled water by a pair of sericterium 1ml.Promptly have a large amount of silk-proteins after several minutes and gush out, this moment is Ex-all sericterium wall tissue carefully.Remaining be invisible egfp albumen under silk-protein and the white light.With gel-like filament albumen smash to pieces make fully water-soluble.The imbitition part is in the 1.5ml centrifuge tube, and-20 ℃ frozen.Take out after about 1 hour, stretch into the insoluble solids of choosing formation in the pipe with clean suction nozzle immediately after the room temperature dissolving and partly discard.Also can centrifugal solid precipitation be got off, shift the new centrifuge tube of supernatant to.℃ freeze once more-20 to the method with freezing draining (SpeedVac Savant) behind the solid and be concentrated into 1/5 of original volume.The gained concentrated solution is ℃ frozen again-20, takes out room temperature dissolving and the centrifugal immediately solid part of separating out of removing after about 1 hour.The supernatant from about 5 pairs of sericteriums that obtains is so partly lumped together, and-20 ℃ freeze to being concentrated into the volume that is fit to next step upper prop with the freezing method of draining behind the solid.Concentrated solution ℃ freezes once more-20, the centrifugal immediately solid of separating out of removing after the room temperature dissolving.Supernatant-20 is ℃ frozen to be that column purification is used on next step.

2, the FPLC preliminary purification of EGFP

Obtain solution A:20mM Tis-HCl, pH7.5;

Solution B: the solution A that contains 0.4M NaCl.

Go up assembling 1ml HiTrap DEAE column (Pharmacia) ion exchange column at FPLC system (Pharmacia).Previous step concentrated solution 0.4ml is gone up sample,, uses 50% elutriant wash-out 10 minutes then with the B elutriant wash-out of 0-30% 12 minutes, at last with 100%B elutriant wash-out 6 minutes to clean exchange column.Press the every pipe of 1ml during wash-out and collect elutriant.Wash-out peak-to-peak figure sees Fig. 5 A.

3, fluorescence spectrum scanning

One pipe is gone up the elutriant that the step collects adds the fluorescence cuvette, spectrophotofluorometer (Hitachi F-4010) go up with the 480nm excitation wavelength from 500nm to the 550nm sweep measuring collected proteic emission peak.In the pipe of emission peak appears in 510nm, the proteic existence of EGFP is arranged promptly.See Fig. 5 B, the collection tube a of emission peak occurs, b, c, d is corresponding with Fig. 5 A, and the b pipe has the strongest emission, illustrates that EGFP mainly concentrates on the b pipe.

Embodiment 8, SDS-PAGE gel electrophoresis are protein immunoblot

1, SDS-PAGE gel electrophoresis

Be formulated as follows storage liquid:

A, 30% acrylamide mother liquor, Arc: Bis=29: 1;

B、1.5mol/L?Tris-HCl，pH8.8；

C、0.5mol/L?Tris-HCl，pH6.8；

D, 10%SDS; 10% ammonium persulphate (APS);

E, 5 * sample buffer: 4.0ml redistilled water, 1.0ml 0.5mol/L Tris-HCl (pH6.8) damping fluid, 0.80ml glycerine, 1.6ml 10% (w/v) SDS, 0.4ml mercaptoethanol, 0.2ml 0.1% (w/v) tetrabromophenol sulfonphthalein, cumulative volume 8ml;

F, concentrated electrophoretic buffer (5 *): get 15g Tris, the 72g glycine, 5g SDS, water is dissolved to 1000ml, and pH is 8.3 (without adjust pHs).

According to following prescription glue:

10% separation gel prescription: 4.02ml redistilled water, 2.50ml 1.5mol/L Tris-HCl (pH8.8), 100 μ l 10%SDS, 3.33ml 30% acrylamide mother liquor.The room temperature degassing 15 minutes adds 50 μ l, 10% ammonium persulphate (fresh preparation) and 5 μ lTEMED.

4.0% concentrates the glue prescription: 3.0ml redistilled water, 1.25ml 1.5mol/L Tris-HCl (pH6.8), 50 μ l 10%SDS, 0.67ml 30% acrylamide mother liquor.The room temperature degassing 15 minutes adds 25 μ l10% ammonium persulphate (fresh preparation) and 5 μ lTEMED.

Get behind the recombinant virus infection in right amount, be dipped in 100 ℃ of distilled waters 10 minutes, prepare and infect silk cocoon silk soluble protein part at the silk that silkworm tells of sericterium specifically expressing EGFP.Gained protein solution and sericterium effluent protein part and corresponding reference protein be through the 10%SDS-PAGE electrophoresis, the operation of this step with reference to Laemmli publish thesis (Laemmli U.K, Nature, 1970,227:680-685), carry out next step behind the electrophoresis.

2 half dry type electrotransfers

The operation of this step is with reference to " protein chemistry investigative technique and progress " (Xia Qichang chief editor, Science Press, 1997).

Be formulated as follows damping fluid:

Anode buffer liquid I:0.3mol/L Tris, 10% methyl alcohol, pH10.4;

Anode buffer liquid II:25mmol/L Tris, 10% methyl alcohol, pH10.4;

Negative electrode damping fluid: 25mmol/L Tris, 40mmol/L 6-aminocaprolc acid, 10% methyl alcohol, pH9.4 (replacing 6-aminocaprolc acid) with the 40mmol/L glycine.

(Immobilon-P Millipore) in 100% methyl alcohol wetting 2～3 seconds earlier, used the ultrapure water rinsing 2～3 minutes, then balance 15 minutes in anode buffer liquid II again with pvdf membrane.After electrophoresis finishes with gel balance 5 minutes in the negative electrode damping fluid.On half dry type electrotransfer instrument, put successively by anode to negative electrode: the onesize Whatman 3mm filter paper of impregnated and glue is 4 in anode buffer liquid I, the onesize Whatman 3mm filter paper of impregnated and glue is 2 in anode buffer liquid II, pvdf membrane, gel, the onesize Whatman 3mm filter paper of impregnated and glue is 6 in the negative electrode damping fluid.1mA/cm electrotransfer 90 minutes.The caudacoria that finishes is paused rinsing in TTBS, can carry out the sealing step of next step Western blot.

3, Western hybridization

Previous step is transferred to pvdf membrane, and (Immobilon-P, Millipore) albumen on carries out Western hybridization detection with the sheep anti rat two anti-A-6782 (Sigma) of GFP immune rat monoclonal antibody GFP (B-2): sc-9996 (Santa Cruz) and coupling horseradish peroxidase.The step that Western hybridization detects is as follows:

The ProBloot membrane (as then soaking in methyl alcohol earlier for the film after air-dry) that shifts after finishing is put into TTBS solution (TTBS:20m mol/L Tris-HCl pH7.5; 137m mol/L NaCl; 0.05%Tween-20) rinsing is 2 minutes.Film is placed 5ml sealing damping fluid, and room temperature is shaken gently and is hatched 1 hour (sealing damping fluid: the TTBS that contains 5% skim-milk).Film is placed 5ml one anti-damping fluid (an anti-damping fluid: contain the sealing damping fluid that 1/2000 volume one resists), and room temperature was shaken one hour gently.Remove an anti-damping fluid, use TTBS solution washing 3 times, each 5 minutes.Add 5ml two anti-damping fluids (two anti-damping fluids: contain the sealing damping fluid that 1/2000 volume two resists), room temperature is shaken gently and is hatched 1 hour.Remove two anti-damping fluids, use TTBS solution washing 3 times, each 5 minutes.Washed film is placed a clean plate, chemical illuminating reagent (the 0.1M Tris.Cl 4ml that contains pH9.0,68mM styracin 8 μ l are dissolved in Luminol (Gibicol BRL) the 15 μ l of DMSO with 100mg/ml) evenly is added in the surface reaction 1 minute of film.Mention film with the diffluence of face liquid with tweezers, place rapidly between the preprepared plastic film then, place the exposure of carrying out the X-ray sheet in the X-ray sheet sheet folder.Appropriate time taking-up X-ray sheet develops, photographic fixing.The result infects the silk lumen of gland and the existence that EGFP is all arranged in the silk albumen of telling as shown in Figure 4, and the contrast silkworm does not have.

Though below only having enumerated with green fluorescent protein egfp gene is silkworm silk gum-1 gene promoter of external source goal gene structure and the domestic natural silk gland bioreactor that signal peptide coding region drives, but by silkworm silk gum-1 gene promoter of other external source goal gene of employing proper restriction site construction expression and the domestic natural silk gland bioreactor of signal peptide coding region drive, apparent for a person skilled in the art and be very easy to accomplish, therefore enumerate no longer one by one herein.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉domestic natural silk gland bioreactor and construction process thereof

<130>041431N

<160>4

<170>PatentIn?version?3.1

<210>1

<211>3691

<212>DNA

<213>silkworm

<220>

<221>gene

<222>(1)..(3691)

<223>

<400>1

ccagtcttga?aattcttagc?tacatctagc?ccagactgta?agagtttctt?aggagcttta 60

gaagttaaag?aagtaccttt?gtgttgctga?tccttctata?tcatctggtc?ctagtaaagg 120

tactctctta?taatctcctt?cctaattcct?tacctgctat?ttatcgattg?taggtcgtct 180

tggaaaccag?taccactgta?caaactcgcg?ccccattagt?aacgtgattt?gaacggccaa 240

ccaattgatg?ttttaatgca?attaatatcg?tatctttaac?cccaacgtgg?ttctgcgtta 300

actaagtgct?caccgctgtc?aacagcaata?aaaccatttt?tgaaataata?acatcattac 360

actaacatag?tgagctagtc?gcaaaatgta?tgtagagaga?aaacaaacct?tctttggggt 420

gttgagagga?aatcgctgga?ttagaactat?cgtgaagacc?attcactgat?cctgtgtact 480

taaattcgcg?gattcagcat?taagcgccgg?atctcagttc?catcgtaatc?ccagttaaag 540

aggtgaaatt?agctatcact?tcgatatctg?ttctgaaagc?aatgttccac?ttgtaaaagc 600

ataagcggtc?agaaaccttg?ttaaccaata?gagccaaata?tagttaacac?aatagaaatt 660

tatccaaata?ttattcgtgt?attgtttata?gcctttgtca?agtcttttac?aaggcaagat 720

aataagtaat?attccgtgat?tggacgtaac?atttcccgga?agatccttag?ccgataagtc 780

gaagagccgc?atgtggctag?agagacgcgg?gtttccgacc?actggcttag?gcgcttattc 840

cgccataata?gatgtacgtg?ttcacaatta?gcacccgaaa?ttcgtaatag?ctacgagaag 900

tatcgaatat?caaaaatcta?tatattaata?cgtgaagcaa?aaactttgta?tcccttttta 960

cgaaaattgc?gaggacggag?gagtatgaaa?tttcccacac?ttatagagaa?tacagagaag 1020

aagtgcacaa?tgctaatatt?tttttaaaat?aatgcataaa?agatacttta?aatcaataaa 1080

gaaaacagca?cacacactac?ataccatgta?tttgacgcac?acacgcatgt?atactattta 1140

ttgtcaaact?tttgttcttg?acgtctgtgt?tcaaactgag?aatagattaa?atattgtttg 1200

tctttattaa?tattttttaa?tagtgtagtc?ttggcgaaat?ttgtgattat?agaagtataa 1260

aatacaatca?taatagtgta?caaacttaca?attccaatta?attatagtcg?aatttcgact 1320

actgcgggac?ctctagtatt?aataattctc?tttaaaaaaa?aacagagcat?caaatactgc 1380

acaaatgtca?agcgggtctc?aacgagccat?gaataaatta?gaaatcaatt?aataacataa 1440

aataggcaaa?caaaataaaa?ccatttacat?agagaacgtt?tgttgaacaa?aaacaataac 1500

ttgtatacat?tgtttgcaca?aatgtttgaa?gcgaaaattt?attactctct?acgtaagctt 1560

gatcaaactt?cgttttcgta?taaaacgcgt?tggcccaacc?actttggcat?agtcgtctta 1620

tcatcgggtc?tctaaggatc?aagcgatcca?aagaccgcca?acatgcgttt?cgttctgtgc 1680

tgcactttga?ttgcgttggc?tgtgagtatc?attgcttcgt?tatcaacaat?gacgtattta 1740

ctaagaacac?tcttagatat?gccttcaaat?taaagctttc?gaagctctga?agttcaccaa 1800

atgcgactgt?tttagcgtaa?gctatttcta?tcccccaaca?gccatttagc?gactacccga 1860

aaatcactcg?atttaacttg?ggagtttctg?caatttaaaa?gttcacaggt?cgtctccgat 1920

tatactttta?aacgcttcgc?gaaaatatca?gagttattaa?aaagttgcca?caaaatcttt 1980

ctgtccacta?aggactggcg?tttagcagca?aatcatctag?attttgggtg?gttggttcag 2040

aattttccat?tttactcttg?ggagtcgttt?cggtctgtat?tccctacgca?ttattagaat 2100

ccatcgaatg?taatttgtat?aattacgagt?taaatactgt?gtacaaacca?atatgtaaat 2160

ttttattcaa?ctagtttatt?gtttttaact?tataggtacc?agttttgaaa?cgaacttcag 2220

agttatctag?aaaaaacata?attatgagta?gctttactaa?tctatattaa?attacgcttt 2280

aatactttta?atagcttact?tggggaaata?gtgatttttc?atgtaataac?agtccacttg 2340

gtcataagca?gcttttatgg?gcttgcgctg?gatatgaatg?ccgcagaacc?aacgatcgtt 2400

ggagtagacg?gggtcttgag?tggagaccgc?gtgccggcaa?acgtagcgtg?ggacgcctcc 2460

tgaccaagtg?gagggctggc?ttgcgatttg?gaagaggcct?atgtctagca?gggagtgatt 2520

aggagctgat?gattgtggtc?ataattgaca?gccacttcgt?ttatggcaat?caaatatcct 2580

gggcattttg?agggtatttt?gctaaacgaa?gacattagaa?ggatgggcga?gctcacagcc 2640

cacctggtgt?taagtggtta?ctggagccca?tagacatcta?cgacgtaaat?gcgccaccca 2700

ccttgagata?taagttctaa?ggtctcagta?tagttacaac?cgctgccccg?cccttcaaac 2760

cgaaacgcat?taactgcttc?acggcagaaa?taggcagggt?ggtggtacct?acccgtgcgg 2820

acccacaaga?ggtcctacct?ccagtccaat?ggtatcccaa?aattttatac?ataacattcc 2880

tgatatttaa?gaatgaggca?gtcgttctta?gactcttcgt?ttccaggaag?acgatacatc 2940

aatatgcggt?ttaataggct?agagtgacta?tgttatccta?gttggtaatt?aattcactag 3000

cataactata?tgattatcgt?taatctgatt?cgcctttttc?tttctttgtt?tgattgctta 3060

acaatcgctc?tgggagcaat?ttggtttgac?tctattggtt?tagtcttttt?tttaatcatc 3120

atcaccccga?tgtcaaaata?atgttcttgt?taacaatttc?gactaactta?acgaggggtg 3180

aaaggcaatt?tggtataagc?ttaatagtat?ttatctttaa?ttaaaggtcc?attttatttg 3240

gtactagcga?cccgccctcg?cttcgctacg?gaaactgtaa?tttattattg?atttctccac 3300

tattcaatgg?atgttattat?acatataaac?cttcctcttc?aatcgctcta?tctattaaaa 3360

aaaccgcatc?aaaatccgtt?gcgtagtttt?aaagatttaa?gcatacgtag?ggacagacag 3420

atatagagac?agagaaagcg?actttgtttt?atactatgta?gtgatgatta?ctatcaacag 3480

ttcgatgttt?ttaattgaac?ttgaattaag?tttaccccat?tcaaatagct?gaagtttttt 3540

ttttttcata?ttttaaactt?taaatgactt?cccggtaaag?ttgcaaaaat?gtcacttaaa 3600

atagacaccc?ctcgatatat?tgtaaagcac?aacatatata?ttaatgaatt?ttttatttat 3660

ttttcaggcg?ctcagcgtaa?aagctttcgg?t 3691

<210>2

<211>3638

<212>DNA

<213>silkworm

<220>

<221>plasmid

<222>(1)..(3638)

<223>

<400>2

ggtacctaca?acaaacacga?ctggagtatt?ccttgtagtg?tttaagattt?taaatcttac 60

ttaatgactt?cgaacgattt?aacgataact?ttctctttgt?ttaactttaa?tcagcataca 120

taaaaagccc?cggttttgta?ccgggaagaa?aaaaaatgta?attgtgttgc?ctagataata 180

aacgtattat?caaagtgtgt?ggttttcctt?taccaaagac?ccctttaaga?tgcgctaatg 240

gccttaagtc?gagtcctttc?cgatgtgtta?aatacacatg?tattacactg?atacgtcgaa 300

tgtacacttt?taataggata?gctccactaa?aaattatttt?atttatttaa?tttgttgcac 360

caaaactgat?acattgacga?aatgatgcag?tagttagcgg?ctgactgatg?cctcgagggt 420

cgtgggttcg?attcccacgt?cgggcaaaca?ttctgtaatg?aacaggtttg?ctcttcgtct 480

gggtgattat?tatctatata?tatatatata?aatgtatata?agaatcttcg?acagtttttg 540

gtatacataa?aaaagggaat?cataaattcg?ggatgaccct?ccgggtgacc?gtgcgttctc 600

acttatttat?ttcccagatg?accgacgagg?aattcatcac?tagtgcggcc?gcctgcaggt 660

cgaccatatg?ggagagctcc?caacgcgttg?gatgcatagc?ttgagtattc?tatagtgtca 720

cctaaatagc?ttggcgtaat?catggtcata?gctgtttcct?gtgtgaaatt?gttatccgct 780

cacaattcca?cacaacatac?gagccggaag?cataaagtgt?aaagcctggg?gtgcctaatg 840

agtgagctaa?ctcacattaa?ttgcgttgcg?ctcactgccc?gctttccagt?cgggaaacct 900

gtcgtgccag?ctgcattaat?gaatcggcca?acgcgcgggg?agaggcggtt?tgcgtattgg 960

gcgctcttcc?gcttcctcgc?tcactgactc?gctgcgctcg?gtcgttcggc?tgcggcgagc 1020

ggtatcagct?cactcaaagg?cggtaatacg?gttatccaca?gaatcagggg?ataacgcagg 1080

aaagaacatg?tgagcaaaag?gccagcaaaa?ggccaggaac?cgtaaaaagg?ccgcgttgct 1140

ggcgtttttc?gataggctcc?gcccccctga?cgagcatcac?aaaaatcgac?gctcaagtca 1200

gaggtggcga?aacccgacag?gactataaag?ataccaggcg?tttccccctg?gaagctccct 1260

cgtgcgctct?cctgttccga?ccctgccgct?taccggatac?ctgtccgcct?ttctcccttc 1320

gggaagcgtg?gcgctttctc?atagctcacg?ctgtaggtat?ctcagttcgg?tgtaggtcgt 1380

tcgctccaag?ctgggctgtg?tgcacgaacc?ccccgttcag?cccgaccgct?gcgccttatc 1440

cggtaactat?cgtcttgagt?ccaacccggt?aagacacgac?ttatcgccac?tggcagcagc 1500

cactggtaac?aggattagca?gagcgaggta?tgtaggcggt?gctacagagt?tcttgaagtg 1560

gtggcctaac?tacggctaca?ctagaaggac?agtatttggt?atctgcgctc?tgctgaagcc 1620

agttaccttc?ggaaaaagag?ttggtagctc?ttgatccggc?aaacaaacca?ccgctggtag 1680

cggtggtttt?tttgtttgca?agcagcagat?tacgcgcaga?aaaaaaggat?ctcaagaaga 1740

tcctttgatc?ttttctacgg?ggtctgacgc?tcagtggaac?gaaaactcac?gttaagggat 1800

tttggtcatg?agattatcaa?aaaggatctt?cacctagatc?cttttaaatt?aaaaatgaag 1860

ttttaaatca?atctaaagta?tatatgagta?aacttggtct?gacagttacc?aatgcttaat 1920

cagtgaggca?cctatctcag?cgatctgtct?atttcgttca?tccatagttg?cctgactccc 1980

cgtcgtgtag?ataactacga?tacgggaggg?cttaccatct?ggccccagtg?ctgcaatgat 2040

accgcgagac?ccacgctcac?cggctccaga?tttatcagca?ataaaccagc?cagccggaag 2100

ggccgagcgc?agaagtggtc?ctgcaacttt?atccgcctcc?atccagtcta?ttaattgttg 2160

ccgggaagct?agagtaagta?gttcgccagt?taatagtttg?cgcaacgttg?ttggcattgc 2220

tacaggcatc?gtggtgtcac?gctcgtcgtt?tggtatggct?tcattcagct?ccggttccca 2280

acgatcaagg?cgagttacat?gatcccccat?gttgtgcaaa?aaagcggtta?gctccttcgg 2340

tcctccgatc?gttgtcagaa?gtaagttggc?cgcagtgtta?tcactcatgg?ttatggcagc 2400

actgcataat?tctcttactg?tcatgccatc?cgtaagatgc?ttttctgtga?ctggtgagta 2460

ctcaaccaag?tcattctgag?aataccgcgc?ccggcgaccg?agttgctctt?gcccggcgtc 2520

aatacgggat?aatagtgtat?gacatagcag?aactttaaaa?gtgctcatca?ttggaaaacg 2580

ttcttcgggg?cgaaaactct?caaggatctt?accgctgttg?agatccagtt?cgatgtaacc 2640

cactcgtgca?cccaactgat?cttcagcatc?ttttactttc?accagcgttt?ctgggtgagc 2700

aaaaacagga?aggcaaaatg?ccgcaaaaaa?gggaataagg?gcgacacgga?aatgttgaat 2760

actcatactc?ttcctttttc?aatattattg?aagcatttat?cagggttatt?gtctcatgag 2820

cggatacata?tttgaatgta?tttagaaaaa?taaacaaata?ggggttccgc?gcacatttcc 2880

ccgaaaagtg?ccacctgtat?gcggtgtgaa?ataccgcaca?gatgcgtaag?gagaaaatac 2940

cgcatcaggc?gaaattgtaa?acgttaatat?tttgttaaaa?ttcgcgttaa?atatttgtta 3000

aatcagctca?ttttttaacc?aataggccga?aatcggcaaa?atcccttata?aatcaaaaga 3060

atagaccgag?atagggttga?gtgttgttcc?agtttggaac?aagagtccac?tattaaagaa 3120

cgtggactcc?aacgtcaaag?ggcgaaaaac?cgtctatcag?ggcgatggcc?cactacgtga 3180

accatcaccc?aaatcaagtt?ttttgcggtc?gaggtgccgt?aaagctctaa?atcggaaccc 3240

taaagggagc?ccccgattta?gagcttgacg?gggaaagccg?gcgaacgtgg?cgagaaagga 3300

agggaagaaa?gcgaaaggag?cgggcgctag?ggcgctggca?agtgtagcgg?tcacgctgcg 3360

cgtaaccacc?acacccgccg?cgcttaatgc?gccgctacag?ggcgcgtcca?ttcgccattc 3420

aggctgcgca?actgttggga?agggcgatcg?gtgcgggcct?cttcgctatt?acgccagctg 3480

gcgaaagggg?gatgtgctgc?aaggcgatta?agttgggtaa?cgccagggtt?ttcccagtca 3540

cgacgttgta?aaacgacggc?cagtgaattg?taatacgact?cactataggg?cgaattgggc 3600

ccgacgtcgc?atgctcccgg?ccgccatggc?cgcgggat 3638

<210>3

<211>3759

<212>DNA

<213>unsure

<220>

<221>plasmid

<222>(1)..(3759)

<223>

<400>3

gggcgaattg?ggcccgacgt?cgcatgctcc?cggccgccat?ggccgcggga?taagcttgtc 60

gacagatctg?catgcatggt?gagcaagggc?gaggagctgt?tcaccggggt?ggtgcccatc 120

ctggtcgagc?tggacggcga?cgtaaacggc?cacaagttca?gcgtgtccgg?cgagggcgag 180

ggcgatgcca?cctacggcaa?gctgaccctg?aagttcatct?gcaccaccgg?caagctgccc 240

gtgccctggc?ccaccctcgt?gaccaccctg?acctacggcg?tgcagtgctt?cagccgctac 300

cccgaccaca?tgaagcagca?cgacttcttc?aagtccgcca?tgcccgaagg?ctacgtccag 360

gagcgcacca?tcttcttcaa?ggacgacggc?aactacaaga?cccgcgccga?ggtgaagttc 420

gagggcgaca?ccctggtgaa?ccgcatcgag?ctgaagggca?tcgacttcaa?ggaggacggc 480

aacatcctgg?ggcacaagct?ggagtacaac?tacaacagcc?acaacgtcta?tatcatggcc 540

gacaagcaga?agaacggcat?caaggtgaac?ttcaagatcc?gccacaacat?cgaggacggc 600

agcgtgcagc?tcgccgacca?ctaccagcag?aacaccccca?tcggcgacgg?ccccgtgctg 660

ctgcccgaca?accactacct?gagcacccag?tccgccctga?gcaaagaccc?caacgagaag 720

cgcgatcaca?tggtcctgct?ggagttcgtg?accgccgccg?ggatcactct?cggcatggac 780

gagctgtaca?agtaaggatc?cggtaccatc?actagtgcgg?ccgcctgcag?gtcgaccata 840

tgggagagct?cccaacgcgt?tggatgcata?gcttgagtat?tctatagtgt?cacctaaata 900

gcttggcgta?atcatggtca?tagctgtttc?ctgtgtgaaa?ttgttatccg?ctcacaattc 960

cacacaacat?acgagccgga?agcataaagt?gtaaagcctg?gggtgcctaa?tgagtgagct 1020

aactcacatt?aattgcgttg?cgctcactgc?ccgctttcca?gtcgggaaac?ctgtcgtgcc 1080

agctgcatta?atgaatcggc?caacgcgcgg?ggagaggcgg?tttgcgtatt?gggcgctctt 1140

ccgcttcctc?gctcactgac?tcgctgcgct?cggtcgttcg?gctgcggcga?gcggtatcag 1200

ctcactcaaa?ggcggtaata?cggttatcca?cagaatcagg?ggataacgca?ggaaagaaca 1260

tgtgagcaaa?aggccagcaa?aaggccagga?accgtaaaaa?ggccgcgttg?ctggcgtttt 1320

tcgataggct?ccgcccccct?gacgagcatc?acaaaaatcg?acgctcaagt?cagaggtggc 1380

gaaacccgac?aggactataa?agataccagg?cgtttccccc?tggaagctcc?ctcgtgcgct 1440

ctcctgttcc?gaccctgccg?cttaccggat?acctgtccgc?ctttctccct?tcgggaagcg 1500

tggcgctttc?tcatagctca?cgctgtaggt?atctcagttc?ggtgtaggtc?gttcgctcca 1560

agctgggctg?tgtgcacgaa?ccccccgttc?agcccgaccg?ctgcgcctta?tccggtaact 1620

atcgtcttga?gtccaacccg?gtaagacacg?acttatcgcc?actggcagca?gccactggta 1680

acaggattag?cagagcgagg?tatgtaggcg?gtgctacaga?gttcttgaag?tggtggccta 1740

actacggcta?cactagaagg?acagtatttg?gtatctgcgc?tctgctgaag?ccagttacct 1800

tcggaaaaag?agttggtagc?tcttgatccg?gcaaacaaac?caccgctggt?agcggtggtt 1860

tttttgtttg?caagcagcag?attacgcgca?gaaaaaaagg?atctcaagaa?gatcctttga 1920

tcttttctac?ggggtctgac?gctcagtgga?acgaaaactc?acgttaaggg?attttggtca 1980

tgagattatc?aaaaaggatc?ttcacctaga?tccttttaaa?ttaaaaatga?agttttaaat 2040

caatctaaag?tatatatgag?taaacttggt?ctgacagtta?ccaatgctta?atcagtgagg 2100

cacctatctc?agcgatctgt?ctatttcgtt?catccatagt?tgcctgactc?cccgtcgtgt 2160

agataactac?gatacgggag?ggcttaccat?ctggccccag?tgctgcaatg?ataccgcgag 2220

acccacgctc?accggctcca?gatttatcag?caataaacca?gccagccgga?agggccgagc 2280

gcagaagtgg?tcctgcaact?ttatccgcct?ccatccagtc?tattaattgt?tgccgggaag 2340

ctagagtaag?tagttcgcca?gttaatagtt?tgcgcaacgt?tgttggcatt?gctacaggca 2400

tcgtggtgtc?acgctcgtcg?tttggtatgg?cttcattcag?ctccggttcc?caacgatcaa 2460

ggcgagttac?atgatccccc?atgttgtgca?aaaaagcggt?tagctccttc?ggtcctccga 2520

tcgttgtcag?aagtaagttg?gccgcagtgt?tatcactcat?ggttatggca?gcactgcata 2580

attctcttac?tgtcatgcca?tccgtaagat?gcttttctgt?gactggtgag?tactcaacca 2640

agtcattctg?agaataccgc?gcccggcgac?cgagttgctc?ttgcccggcg?tcaatacggg 2700

ataatagtgt?atgacatagc?agaactttaa?aagtgctcat?cattggaaaa?cgttcttcgg 2760

ggcgaaaact?ctcaaggatc?ttaccgctgt?tgagatccag?ttcgatgtaa?cccactcgtg 2820

cacccaactg?atcttcagca?tcttttactt?tcaccagcgt?ttctgggtga?gcaaaaacag 2880

gaaggcaaaa?tgccgcaaaa?aagggaataa?gggcgacacg?gaaatgttga?atactcatac 2940

tcttcctttt?tcaatattat?tgaagcattt?atcagggtta?ttgtctcatg?agcggataca 3000

tatttgaatg?tatttagaaa?aataaacaaa?taggggttcc?gcgcacattt?ccccgaaaag 3060

tgccacctgt?atgcggtgtg?aaataccgca?cagatgcgta?aggagaaaat?accgcatcag 3120

gcgaaattgt?aaacgttaat?attttgttaa?aattcgcgtt?aaatatttgt?taaatcagct 3180

cattttttaa?ccaataggcc?gaaatcggca?aaatccctta?taaatcaaaa?gaatagaccg 3240

agatagggtt?gagtgttgtt?ccagtttgga?acaagagtcc?actattaaag?aacgtggact 3300

ccaacgtcaa?agggcgaaaa?accgtctatc?agggcgatgg?cccactacgt?gaaccatcac 3360

ccaaatcaag?ttttttgcgg?tcgaggtgcc?gtaaagctct?aaatcggaac?cctaaaggga 3420

gcccccgatt?tagagcttga?cggggaaagc?cggcgaacgt?ggcgagaaag?gaagggaaga 3480

aagcgaaagg?agcgggcgct?agggcgctgg?caagtgtagc?ggtcacgctg?cgcgtaacca 3540

ccacacccgc?cgcgcttaat?gcgccgctac?agggcgcgtc?cattcgccat?tcaggctgcg 3600

caactgttgg?gaagggcgat?cggtgcgggc?ctcttcgcta?ttacgccagc?tggcgaaagg 3660

gggatgtgct?gcaaggcgat?taagttgggt?aacgccaggg?ttttcccagt?cacgacgttg 3720

taaaacgacg?gccagtgaat?tgtaatacga?ctcactata 3759

<210>4

<211>7714

<212>DNA

<213>unsure

<220>

<221>plasmid

<222>(1)..(7714)

<223>

<400>4

gatctccagt?cttgaaattc?ttagctacat?ctagcccaga?ctgtaagagt?ttcttaggag 60

ctttagaagt?taaagaagta?cctttgtgtt?gctgatcctt?ctatatcatc?tggtcctagt 120

aaaggtactc?tcttataatc?tccttcctaa?ttccttacct?gctatttatc?gattgtaggt 180

cgtcttggaa?accagtacca?ctgtacaaac?tcgcgcccca?ttagtaacgt?gatttgaacg 240

gccaaccaat?tgatgtttta?atgcaattaa?tatcgtatct?ttaaccccaa?cgtggttctg 300

cgttaactaa?gtgctcaccg?ctgtcaacag?caataaaacc?atttttgaaa?taataacatc 360

attacactaa?catagtgagc?tagtcgcaaa?atgtatgtag?agagaaaaca?aaccttcttt 420

ggggtgttga?gaggaaatcg?ctggattaga?actatcgtga?agaccattca?ctgatcctgt 480

gtacttaaat?tcgcggattc?agcattaagc?gccggatctc?agttccatcg?taatcccagt 540

taaagaggtg?aaattagcta?tcacttcgat?atctgttctg?aaagcaatgt?tccacttgta 600

aaagcataag?cggtcagaaa?ccttgttaac?caatagagcc?aaatatagtt?aacacaatag 660

aaatttatcc?aaatattatt?cgtgtattgt?ttatagcctt?tgtcaagtct?tttacaaggc 720

aagataataa?gtaatattcc?gtgattggac?gtaacatttc?ccggaagatc?cttagccgat 780

aagtcgaaga?gccgcatgtg?gctagagaga?cgcgggtttc?cgaccactgg?cttaggcgct 840

tattccgcca?taatagatgt?acgtgttcac?aattagcacc?cgaaattcgt?aatagctacg 900

agaagtatcg?aatatcaaaa?atctatatat?taatacgtga?agcaaaaact?ttgtatccct 960

ttttacgaaa?attgcgagga?cggaggagta?tgaaatttcc?cacacttata?gagaatacag 1020

agaagaagtg?cacaatgcta?atattttttt?aaaataatgc?ataaaagata?ctttaaatca 1080

ataaagaaaa?cagcacacac?actacatacc?atgtatttga?cgcacacacg?catgtatact 1140

atttattgtc?aaacttttgt?tcttgacgtc?tgtgttcaaa?ctgagaatag?attaaatatt 1200

gtttgtcttt?attaatattt?tttaatagtg?tagtcttggc?gaaatttgtg?attatagaag 1260

tataaaatac?aatcataata?gtgtacaaac?ttacaattcc?aattaattat?agtcgaattt 1320

cgactactgc?gggacctcta?gtattaataa?ttctctttaa?aaaaaaacag?agcatcaaat 1380

actgcacaaa?tgtcaagcgg?gtctcaacga?gccatgaata?aattagaaat?caattaataa 1440

cataaaatag?gcaaacaaaa?taaaaccatt?tacatagaga?acgtttgttg?aacaaaaaca 1500

ataacttgta?tacattgttt?gcacaaatgt?ttgaagcgaa?aatttattac?tctctacgta 1560

agcttgatca?aacttcgttt?tcgtataaaa?cgcgttggcc?caaccacttt?ggcatagtcg 1620

tcttatcatc?gggtctctaa?ggatcaagcg?atccaaagac?cgccaacatg?cgtttcgttc 1680

tgtgctgcac?tttgattgcg?ttggctgtga?gtatcattgc?ttcgttatca?acaatgacgt 1740

atttactaag?aacactctta?gatatgcctt?caaattaaag?ctttcgaagc?tctgaagttc 1800

accaaatgcg?actgttttag?cgtaagctat?ttctatcccc?caacagccat?ttagcgacta 1860

cccgaaaatc?actcgattta?acttgggagt?ttctgcaatt?taaaagttca?caggtcgtct 1920

ccgattatac?ttttaaacgc?ttcgcgaaaa?tatcagagtt?attaaaaagt?tgccacaaaa 1980

tctttctgtc?cactaaggac?tggcgtttag?cagcaaatca?tctagatttt?gggtggttgg 2040

ttcagaattt?tccattttac?tcttgggagt?cgtttcggtc?tgtattccct?acgcattatt 2100

agaatccatc?gaatgtaatt?tgtataatta?cgagttaaat?actgtgtaca?aaccaatatg 2160

taaattttta?ttcaactagt?ttattgtttt?taacttatag?gtaccagttt?tgaaacgaac 2220

ttcagagtta?tctagaaaaa?acataattat?gagtagcttt?actaatctat?attaaattac 2280

gctttaatac?ttttaatagc?ttacttgggg?aaatagtgat?ttttcatgta?ataacagtcc 2340

acttggtcat?aagcagcttt?tatgggcttg?cgctggatat?gaatgccgca?gaaccaacga 2400

tcgttggagt?agacggggtc?ttgagtggag?accgcgtgcc?ggcaaacgta?gcgtgggacg 2460

cctcctgacc?aagtggaggg?ctggcttgcg?atttggaaga?ggcctatgtc?tagcagggag 2520

tgattaggag?ctgatgattg?tggtcataat?tgacagccac?ttcgtttatg?gcaatcaaat 2580

atcctgggca?ttttgagggt?attttgctaa?acgaagacat?tagaaggatg?ggcgagctca 2640

cagcccacct?ggtgttaagt?ggttactgga?gcccatagac?atctacgacg?taaatgcgcc 2700

acccaccttg?agatataagt?tctaaggtct?cagtatagtt?acaaccgctg?ccccgccctt 2760

caaaccgaaa?cgcattaact?gcttcacggc?agaaataggc?agggtggtgg?tacctacccg 2820

tgcggaccca?caagaggtcc?tacctccagt?ccaatggtat?cccaaaattt?tatacataac 2880

attcctgata?tttaagaatg?aggcagtcgt?tcttagactc?ttcgtttcca?ggaagacgat 2940

acatcaatat?gcggtttaat?aggctagagt?gactatgtta?tcctagttgg?taattaattc 3000

actagcataa?ctatatgatt?atcgttaatc?tgattcgcct?ttttctttct?ttgtttgatt 3060

gcttaacaat?cgctctggga?gcaatttggt?ttgactctat?tggtttagtc?ttttttttaa 3120

tcatcatcac?cccgatgtca?aaataatgtt?cttgttaaca?atttcgacta?acttaacgag 3180

gggtgaaagg?caatttggta?taagcttaat?agtatttatc?tttaattaaa?ggtccatttt 3240

atttggtact?agcgacccgc?cctcgcttcg?ctacggaaac?tgtaatttat?tattgatttc 3300

tccactattc?aatggatgtt?attatacata?taaaccttcc?tcttcaatcg?ctctatctat 3360

taaaaaaacc?gcatcaaaat?ccgttgcgta?gttttaaaga?tttaagcata?cgtagggaca 3420

gacagatata?gagacagaga?aagcgacttt?gttttatact?atgtagtgat?gattactatc 3480

aacagttcga?tgtttttaat?tgaacttgaa?ttaagtttac?cccattcaaa?tagctgaagt 3540

tttttttttt?tcatatttta?aactttaaat?gacttcccgg?taaagttgca?aaaatgtcac 3600

ttaaaataga?cacccctcga?tatattgtaa?agcacaacat?atatattaat?gaatttttta 3660

tttatttttc?aggcgctcag?cgtaaaagct?ttcggtcacc?tgcaggcatg?catggtgagc 3720

aagggcgagg?agctgttcac?cggggtggtg?cccatcctgg?tcgagctgga?cggcgacgta 3780

aacggccaca?agttcagcgt?gtccggcgag?ggcgagggcg?atgccaccta?cggcaagctg 3840

accctgaagt?tcatctgcac?caccggcaag?ctgcccgtgc?cctggcccac?cctcgtgacc 3900

accctgacct?acggcgtgca?gtgcttcagc?cgctaccccg?accacatgaa?gcagcacgac 3960

ttcttcaagt?ccgccatgcc?cgaaggctac?gtccaggagc?gcaccatctt?cttcaaggac 4020

gacggcaact?acaagacccg?cgccgaggtg?aagttcgagg?gcgacaccct?ggtgaaccgc 4080

atcgagctga?agggcatcga?cttcaaggag?gacggcaaca?tcctggggca?caagctggag 4140

tacaactaca?acagccacaa?cgtctatatc?atggccgaca?agcagaagaa?cggcatcaag 4200

gtgaacttca?agatccgcca?caacatcgag?gacggcagcg?tgcagctcgc?cgaccactac 4260

cagcagaaca?cccccatcgg?cgacggcccc?gtgctgctgc?ccgacaacca?ctacctgagc 4320

acccagtccg?ccctgagcaa?agaccccaac?gagaagcgcg?atcacatggt?cctgctggag 4380

ttcgtgaccg?ccgccgggat?cactctcggc?atggacgagc?tgtacaagta?aggatccggt 4440

acctacaaca?aacacgactg?gagtattcct?tgtagtgttt?aagattttaa?atcttactta 4500

atgacttcga?acgatttaac?gataactttc?tctttgttta?actttaatca?gcatacataa 4560

aaagccccgg?ttttgtaccg?ggaagaaaaa?aaatgtaatt?gtgttgccta?gataataaac 4620

gtattatcaa?agtgtgtggt?tttcctttac?caaagacccc?tttaagatgc?gctaatggcc 4680

ttaagtcgag?tcctttccga?tgtgttaaat?acacatgtat?tacactgata?cgtcgaatgt 4740

acacttttaa?taggatagct?ccactaaaaa?ttattttatt?tatttaattt?gttgcaccaa 4800

aactgataca?ttgacgaaat?gatgcagtag?ttagcggctg?actgatgcct?cgagggtcgt 4860

gggttcgatt?cccacgtcgg?gcaaacattc?tgtaatgaac?aggtttgctc?ttcgtctggg 4920

tgattattat?ctatatatat?atatataaat?gtatataaga?atcttcgaca?gtttttggta 4980

tacataaaaa?agggaatcat?aaattcggga?tgaccctccg?ggtgaccgtg?cgttctcact 5040

tatttatttc?ccagatgacc?gacgaggaat?tcactggccg?tcgttttaca?acgtcgtgac 5100

tgggaaaacc?ctggcgttac?ccaacttaat?cgccttgcag?cacatccccc?tttcgccagc 5160

tggcgtaata?gcgaagaggc?ccgcaccgat?cgcccttccc?aacagttgcg?cagcctgaat 5220

ggcgaatggc?gcctgatgcg?gtattttctc?cttacgcatc?tgtgcggtat?ttcacaccgc 5280

atatggtgca?ctctcagtac?aatctgctct?gatgccgcat?agttaagcca?gccccgacac 5340

ccgccaacac?ccgctgacgc?gccctgacgg?gcttgtctgc?tcccggcatc?cgcttacaga 5400

caagctgtga?ccgtctccgg?gagctgcatg?tgtcagaggt?tttcaccgtc?atcaccgaaa 5460

cgcgcgagac?gaaagggcct?cgtgatacgc?ctatttttat?aggttaatgt?catgataata 5520

atggtttctt?agacgtcagg?tggcactttt?cggggaaatg?tgcgcggaac?ccctatttgt 5580

ttatttttct?aaatacattc?aaatatgtat?ccgctcatga?gacaataacc?ctgataaatg 5640

cttcaataat?attgaaaaag?gaagagtatg?agtattcaac?atttccgtgt?cgcccttatt 5700

cccttttttg?cggcattttg?ccttcctgtt?tttgctcacc?cagaaacgct?ggtgaaagta 5760

aaagatgctg?aagatcagtt?gggtgcacga?gtgggttaca?tcgaactgga?tctcaacagc 5820

ggtaagatcc?ttgagagttt?tcgccccgaa?gaacgttttc?caatgatgag?cacttttaaa 5880

gttctgctat?gtggcgcggt?attatcccgt?attgacgccg?ggcaagagca?actcggtcgc 5940

cgcatacact?attctcagaa?tgacttggtt?gagtactcac?cagtcacaga?aaagcatctt 6000

acggatggca?tgacagtaag?agaattatgc?agtgctgcca?taaccatgag?tgataacact 6060

gcggccaact?tacttctgac?aacgatcgga?ggaccgaagg?agctaaccgc?ttttttgcac 6120

aacatggggg?atcatgtaac?tcgccttgat?cgttgggaac?cggagctgaa?tgaagccata 6180

ccaaacgacg?agcgtgacac?cacgatgcct?gtagcaatgg?caacaacgtt?gcgcaaacta 6240

ttaactggcg?aactacttac?tctagcttcc?cggcaacaat?taatagactg?gatggaggcg 6300

gataaagttg?caggaccact?tctgcgctcg?gcccttccgg?ctggctggtt?tattgctgat 6360

aaatctggag?ccggtgagcg?tgggtctcgc?ggtatcattg?cagcactggg?gccagatggt 6420

aagccctccc?gtatcgtagt?tatctacacg?acggggagtc?aggcaactat?ggatgaacga 6480

aatagacaga?tcgctgagat?aggtgcctca?ctgattaagc?attggtaact?gtcagaccaa 6540

gtttactcat?atatacttta?gattgattta?aaacttcatt?tttaatttaa?aaggatctag 6600

gtgaagatcc?tttttgataa?tctcatgacc?aaaatccctt?aacgtgagtt?ttcgttccac 6660

tgagcgtcag?accccgtaga?aaagatcaaa?ggatcttctt?gagatccttt?ttttctgcgc 6720

gtaatctgct?gcttgcaaac?aaaaaaacca?ccgctaccag?cggtggtttg?tttgccggat 6780

caagagctac?caactctttt?tccgaaggta?actggcttca?gcagagcgca?gataccaaat 6840

actgtccttc?tagtgtagcc?gtagttaggc?caccacttca?agaactctgt?agcaccgcct 6900

acatacctcg?ctctgctaat?cctgttacca?gtggctgctg?ccagtggcga?taagtcgtgt 6960

cttaccgggt?tggactcaag?acgatagtta?ccggataagg?cgcagcggtc?gggctgaacg 7020

gggggttcgt?gcacacagcc?cagcttggag?cgaacgacct?acaccgaact?gagataccta 7080

cagcgtgagc?tatgagaaag?cgccacgctt?cccgaaggga?gaaaggcgga?caggtatccg 7140

gtaagcggca?gggtcggaac?aggagagcgc?acgagggagc?ttccaggggg?aaacgcctgg 7200

tatctttata?gtcctgtcgg?gtttcgccac?ctctgacttg?agcgtcgatt?tttgtgatgc 7260

tcgtcagggg?ggcggagcct?atggaaaaac?gccagcaacg?cggccttttt?acggttcctg 7320

gccttttgct?ggccttttgc?tcacatgttc?tttcctgcgt?tatcccctga?ttctgtggat 7380

aaccgtatta?ccgcctttga?gtgagctgat?accgctcgcc?gcagccgaac?gaccgagcgc 7440

agcgagtcag?tgagcgagga?agcggaagag?cgcccaatac?gcaaaccgcc?tctccccgcg 7500

cgttggccga?ttcattaatg?cagctggcac?gacaggtttc?ccgactggaa?agcgggcagt 7560

gagcgcaacg?caattaatgt?gagttagctc?actcattagg?caccccaggc?tttacacttt 7620

atgcttccgg?ctcgtatgtt?gtgtggaatt?gtgagcggat?aacaatttca?cacaggaaac 7680

agctatgacc?atgattacgc?caagcttgtc?gaca 7714

Claims

1, a kind of domestic natural silk gland bioreactor is used to express the external source goal gene, it is characterized in that, described reactor is carrier with the silkworm, is controlling element with silk gum-1 gene promoter and signal coding sequence.

2, reactor as claimed in claim 1, it is characterized in that described reactor clone has the special secreting, expressing plasmid of sericterium of the sequence in the dna fragmentation that contains silk gum-1 gene promoter and signal peptide coding region, external source goal gene encoding sequence, silk gum-1 gene polyA signal site.

3, reactor as claimed in claim 1 or 2 is characterized in that, described external source goal gene is a green fluorescent protein egfp gene.

4, reactor as claimed in claim 2 is characterized in that, the described dna fragmentation that contains silk gum-1 gene promoter and signal peptide coding region has the sequence shown in the SEQ ID NO:1.

5, reactor as claimed in claim 3 is characterized in that, the special secreting, expressing plasmid of the sericterium of described structure has the sequence shown in the SEQ ID NO:4.

6, a kind of construction process of domestic natural silk gland bioreactor is characterized in that may further comprise the steps:

A, make up the special secreting, expressing plasmid of sericterium of the sequence in the dna fragmentation contain silk gum-1 gene promoter and signal peptide coding region, external source goal gene coding region sequence, silk gum-1 gene polyA signal site;

C, have the swivel base donor plasmid of the external source destination gene expression frame that silk gum-1 gene promoter and signal coding sequence drive to transform the clone to enter the bacterial strain of virus expression systems special use;

The viral DNA of d, extracting bacterial strain imports carrier cell, is assembled into the recombinant virus particle with infection, replication, and virus is increased on a large scale;

E, the recombinant virus inoculation silkworm to obtain are built into the domestic natural silk gland bioreactor that is driven exogenous gene expression by silkworm silk gum-1 gene promoter and signal coding sequence.

7, construction process as claimed in claim 6, it is characterized in that, described step a comprises the clone of the dna fragmentation that contains silk gum-1 gene promoter and signal peptide coding region section thereof, the clone who contains the sequence in silk gum 1 gene polyA signal site, the clone of external source goal gene coding region, and with suitable restriction endonuclease the three is coupled together.

As claim 6 or 7 described construction processs, it is characterized in that 8, described external source goal gene is a green fluorescent protein egfp gene.

As each described construction process in the claim 6, it is characterized in that 9, the described dna fragmentation that contains silk gum-1 gene promoter and signal peptide coding region has the sequence shown in the SEQ ID NO:1.

10, construction process as claimed in claim 8 is characterized in that, the special secreting, expressing plasmid of the sericterium of described structure has the sequence shown in the SEQ ID NO:4.

11, the special secreting, expressing plasmid of a kind of sericterium, it is characterized in that, described expression plasmid by the dna fragmentation that contains silk gum-1 gene promoter and signal coding sequence, contain the sequence in silk gum-1 gene polyA signal site and green fluorescent protein egfp is gene constructed forms.

12, the special secreting, expressing plasmid of sericterium as claimed in claim 11 is characterized in that, the described dna fragmentation that contains silk gum-1 gene promoter and signal peptide coding region has the sequence shown in the SEQ ID NO:1.

As claim 11 or the special secreting, expressing plasmid of 12 described sericteriums, it is characterized in that 13, the special secreting, expressing plasmid of the sericterium of described structure has the sequence shown in the SEQ ID NO:4.