KR102319845B1 - CRISPR-CAS system for avian host cells - Google Patents

Abstract

The present invention relates to the fields of molecular biology and cell biology. More particularly, the present invention relates to the CRISPR-Cas system for Labyrinthulomycetes host cells.

Description

CRISPR-CAS system for avian host cells

Cross-referencing of related applications

This application claims priority to U.S. Provisional Patent Application No. 62/361,741, filed on July 13, 2016, the contents of which are incorporated herein by reference in their entirety.

technical field

The present disclosure relates to the fields of molecular biology and cell biology. More specifically, the present invention relates to a CRISPR-Cas system for avian Labyrinthulomycetes host cells.

Recent advances in genomic techniques and analytical methods have significantly accelerated the ability to classify and map genetic factors associated with a diverse range of biological functions and diseases. Precise genome engineering techniques are needed to advance synthetic biology, biotechnology, and medical applications, as well as to enable systematic reverse engineering of causal genetic variations by allowing selective perturbation of individual genetic elements. Genome-editing techniques, such as designer zinc tweezers, transcription activator-type effector nucleases (TALENs), or homing meganucleases, are available for generation of targeted genomic perturbations, but are available and easy to set up. There is still a need for novel genome engineering techniques that are scalable and capable of targeting multiple locations within the genome. Engineering of the meganuclease has been a challenge for most academic researchers because the DNA recognition and cleavage functions of the enzyme are intertwined in a single domain. Robust fabrication of engineered zinc clamp arrays has also proven difficult for many laboratories due to the need to elucidate context-dependent influences between individual clamp domains during arrays.

There is therefore an urgent need for alternative robust techniques for targeting specific sequences in host cells with numerous applications. The solution to the above technical problem is provided by the embodiments characterized in the claims.

The present application is based on the CRISPR-Cas system, which does not require the creation of a custom protein for a target-specific sequence, but rather a single Cas enzyme that can be programmed by a guide-polynucleotide to recognize a specific polynucleotide target. to do; That is, the Cas enzyme can be recruited to a specific polynucleotide target using the guide-polynucleotide molecule. Adding the CRISPR-Cas system to the repertoire of genomic techniques and analysis methods can significantly simplify existing methods in the field of molecular biology.

The present invention provides a non-natural or engineered composition comprising a source of a CRISPR-Cas system comprising a guide-polynucleotide and a Cas protein, wherein the guide-polynucleotide is essentially a target-polynucleotide in a host cell. and the guide-polynucleotide can direct binding of the Cas protein to the target-polynucleotide in the host cell to form a CRISPR-Cas complex.

The invention also relates to a method for modulating the expression of a polynucleotide in a cell comprising contacting the host cell with a composition according to the invention, wherein said guide-polynucleotide is at a target-polynucleotide in said host cell. It directs the binding of the Cas protein to form a CRISPR-Cas complex.

The invention also relates to a host cell comprising a composition according to the invention.

The invention also relates to a method for producing a host cell, comprising contacting the host cell with a composition according to the invention, wherein said guide-polynucleotide binds said Cas protein to a target-polynucleotide in said host cell. to form a CRISPR-Cas complex.

The present invention also relates to a method for producing a compound of interest, comprising culturing a host cell according to the invention under conditions conducive to the compound of interest and optionally purifying or isolating said compound of interest.

For a further understanding of the nature, objects, and advantages of the present disclosure, reference will be made to the following detailed description in conjunction with the following drawings, wherein like reference numerals refer to like elements.
1 depicts examples of a typical guide-polynucleotide. Both guide-polynucleotides are guide-RNAs comprising a guide-sequence (crRNA) and a guide-polynucleotide structural component. In the upper figure, the guide-polynucleotide structural component consists of two separate molecules hybridized to each other; These individual components may be referred to as a tracr sequence and a tracr-pair sequence. In the lower figure, the guide-polynucleotide structural component consists of a single molecule with internal hybridization. This figure was adapted from Sander and Joung, 2014 and Mali et al ., Nat Methods.10(10):957-63, 2013.
2 depicts how guide-polynucleotides (guide RNA self-processing ribozymes abbreviated as gRSRs) are formed. Hammerhead ribozymes and HDV ribozymes cleave RNA molecules to form final and functional mature guide-polynucleotides (guide-RNAs).
Figure 3 depicts cleaved plasmids and PCR-amplified fragments run on 1% agarose gels.
Figure 4 shows the results of colony PCR of transformants generated from pYB32 and pYB33 bacterial transformation.
Fig. 5 shows an agarose gel in which amplification products derived from the genomic DNA of T188 and T189 transformants were isolated, and tested for the presence of promoter and partial Cas9.
6 depicts amplification products derived from genomic DNA of T188 and T189 transformants run on agarose gels demonstrating the integration of Cas9 into the OrfA/Pfa1 locus.
7 depicts a portion of the Schizochytrium fatty acid synthase (FAS) gene amplified from genomic DNA run on 1% agarose gel.
Figure 8 depicts the results of PCR cloning of paromomycin and gRNA cassette into the FAS locus in vector pCL400.
9 shows the results of PCR performed to amplify the entire region including the first 3 CS gRNA target as one amplification product and another PCR for separately amplifying the gRNA3 CS4 target.
Figure 10 shows the results of PCR performed to amplify the gRNA3 CS1 target separately from the genomic DNA of the T206 transformant.
11 depicts the results of cleavage of pLC122-Cas9 and pYB30 plasmids.
12 shows the results of colony PCR of transformants resulting from pYB61 bacterial transformation.
Figure 13 shows the cleavage result of pCL122 plasmid on 1% agarose gel.
Figure 14 depicts the amplification product of the gRNA3 CS1 cassette for pYB66 cloning on 1% agarose gel.
15 shows the cleavage results of gRNA3 CS1 (pYB66 fragment) on 1% agarose gel.
16 depicts the results of colony PCR of transformants resulting from pYB66 bacterial transformation.
17 shows the results of cleavage of pYB61 plasmid on 1% agarose gel.
18 depicts the amplification product of the gRNA CS1 cassette for pYB73 cloning on 1% agarose gel.
19 shows the results of colony PCR of transformants resulting from pYB73 bacterial transformation.
20 shows an agarose gel in which amplification products derived from the genomic DNA of the T212 transformant were isolated, and tested for the presence of the CarG gene.
21 shows an agarose gel in which amplification products derived from the genomic DNA of T280, T281, T285 and T286 transformants were isolated and tested for the presence of partial promoter and Cas9 sequences.
22 shows an agarose gel in which amplification products derived from genomic DNA of T281 and T286 transformants were isolated and tested for the presence of a gRNA cassette.
23 shows an agarose gel in which amplification products derived from the genomic DNA of T282 and T287 transformants were isolated and tested for the presence of a partial gRNA cassette.
24 depicts the results of PCR performed to separately amplify the gRNA3 CS1 target from the genomic DNA of T281, T282, T286 and T287 transformants.
Description of Sequence Listing
SEQ ID NO: 1 shows the pCL122-Cas9 vector nucleotide sequence.
SEQ ID NO:2 shows the pYB31 vector nucleotide sequence.
SEQ ID NO: 3 shows the pYB32 vector nucleotide sequence.
SEQ ID NO: 4 shows the pYB33 vector nucleotide sequence.
SEQ ID NO: 5 shows the pCL399 vector nucleotide sequence.
SEQ ID NO: 6 shows the pCL400 vector nucleotide sequence.
SEQ ID NO: 7 shows the pCL401 vector nucleotide sequence.
SEQ ID NO:8 shows the pCL402 vector nucleotide sequence.
SEQ ID NO: 9 shows the pYB36 vector nucleotide sequence.
SEQ ID NO: 10 shows the pYB37 vector nucleotide sequence.
SEQ ID NO: 11 shows the pYB38 vector nucleotide sequence.
SEQ ID NO: 12 shows the pYB39 vector nucleotide sequence.
SEQ ID NO: 13 shows the 121 Tub seq F primer nucleotide sequence.
SEQ ID NO: 14 shows the pYB32/3 CR1 primer nucleotide sequence.
SEQ ID NO: 15 shows the CS pro Kpn IF F1 primer nucleotide sequence.
SEQ ID NO: 16 shows the CS pro BamH IF R1 primer nucleotide sequence.
SEQ ID NO: 17 shows the CS pro BamH IF F2 primer nucleotide sequence.
SEQ ID NO: 18 shows the CS pro Nde IF R2 primer nucleotide sequence.
SEQ ID NO: 19 shows the O A1-KO F primer nucleotide sequence.
SEQ ID NO: 20 shows the pYB32/3 SV40 R1 primer nucleotide sequence.
SEQ ID NO: 21 shows the O A1-KO R primer nucleotide sequence.
SEQ ID NO: 22 shows the pYB32/3 C F1 primer nucleotide sequence.
SEQ ID NO:23 shows the 5' FAS PmeNde primer nucleotide sequence.
SEQ ID NO: 24 shows the 3' FAS PmeHpa primer nucleotide sequence.
SEQ ID NO: 25 shows the pCL402 IF F primer nucleotide sequence.
SEQ ID NO:26 shows the pCL402 IF R primer nucleotide sequence.
SEQ ID NO: 27 shows the pYB36 CS1 F primer nucleotide sequence.
SEQ ID NO:28 shows the pYB36 CS1 R primer nucleotide sequence.
SEQ ID NO: 29 shows the pYB36 CS3 R primer nucleotide sequence.
SEQ ID NO: 30 shows the pYB36 CS4 F primer nucleotide sequence.
SEQ ID NO: 31 shows the pYB36 CS4 R primer nucleotide sequence.
SEQ ID NO: 32 shows the pYB30 vector nucleotide sequence.
SEQ ID NO: 33 shows the pYB61 vector nucleotide sequence.
SEQ ID NO:34 shows the pYB66 vector nucleotide sequence.
SEQ ID NO: 35 shows the pYB73 vector nucleotide sequence.
SEQ ID NO:36 shows the pCL310 vector nucleotide sequence.
SEQ ID NO:37 shows the pCL122 vector nucleotide sequence.
SEQ ID NO: 38 shows the pYB66 BamBgl F primer nucleotide sequence.
SEQ ID NO:39 shows the pYB66 Nde R primer nucleotide sequence.
SEQ ID NO: 40 shows the pYB66 EF1seq F primer nucleotide sequence.
SEQ ID NO: 41 shows the pCL122 OrfC R primer nucleotide sequence.
SEQ ID NO: 42 shows the pYB73 gRNA Pst Kpn IF F primer nucleotide sequence.
SEQ ID NO:43 shows the pYB73 gRNA Xho Pst IF R primer nucleotide sequence.
SEQ ID NO: 44 shows the pYB73 seq F primer nucleotide sequence.
SEQ ID NO: 45 shows the pYB73 seq R primer nucleotide sequence.
SEQ ID NO: 46 shows the pYB13 pYB1 seq F primer nucleotide sequence.
SEQ ID NO: 47 shows the TT pYB73 HDV R primer nucleotide sequence.

Before further describing this specification, the specification is directed to specific embodiments of the specification set forth below, as changes may be made in specific embodiments and such changes may still be within the scope of the appended claims. It should be noted that there are no restrictions. It is also to be understood that the terminology used is for the purpose of describing particular embodiments and is not intended to be limiting. Instead, the scope of the present disclosure will be established by the appended claims.

In a first aspect, the present invention provides a non-natural or engineered composition comprising a source of a CRISPR-Cas system comprising a guide-polynucleotide and a Cas protein, wherein the guide-polynucleotide is essentially a host cell a guide-sequence that is the reverse complement of a target-polynucleotide in the host cell, wherein the guide-polynucleotide is capable of directing binding of the Cas protein to the target-polynucleotide in the host cell to form a CRISPR-Cas complex, wherein wherein said guide-sequence is essentially the reverse complement of the (N)y portion of the target 5'-(N)yPAM-3' polynucleotide sequence in the genome of said host cell, wherein y is 8 to 30, more preferably is 10 to 30, more preferably 15 to 30, more preferably 17 to 27, more preferably 17 to 20, more preferably 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or an integer of 27, wherein PAM is a protospacer adjacent motif, wherein said host cell is of the class Labyrinthulomycetes, preferably of the order Thraustochytriales, more preferably of Thraustochytriales. Aseae (Thraustochytriaceae) family, more preferably Aurantiochytrium ( Aurantiochytrium ), Oblongichytrium , Schizochytrium , Thraustochytrium ) and Ulkenia consisting of Thraustochytrium and Ulkenia ) A member of the genus selected from the group, even more preferably of the Schizochytrium sp. ATCC# 20888, wherein the PAM is preferably 5'-XGG-3', 5'-XGGXG-3', 5'-XXAGAAW-3 ', 5'-XXXXGATT-3', 5'-XXAGAA-3', 5'-XAAAAC-3' is a sequence selected from the group consisting of, wherein X is any nucleotide or analogs thereof, preferably X can be any nucleotide; W is A or T.

The composition, source, CRISPR-Cas system, guide-polynucleotide, Cas protein, target-polynucleotide, host cell and CRISPR-Cas complex herein are the composition, source, CRISPR-Cas system, guide-poly according to the present invention. referred to as nucleotides, Cas proteins, target-polynucleotides, host cells and CRISPR-Cas complexes. For completeness sake, since "a" is defined as "at least one" elsewhere herein, a composition according to the invention comprises at least one, ie, 1, 2, 3 or more intra-polynucleotides and/or or at least one, ie, 1, 2, 3 or more sources of Cas proteins. Correspondingly, the present invention conveniently provides a multiplex CRISPR-Cas system. The multiplex CRISPR-Cas system as described above can be conveniently used for introduction of a donor polynucleotide, deletion of the polynucleotide, and insertion of a polynucleotide library into the genome of a host cell. As used herein, a multiplex CRISPR-Cas system may refer to the use of one or more Cas proteins, one or more guide-polynucleotides and/or one or more donor polynucleotides.

The terms "CRISPR system", "CRISPR-Cas system" and "CRISPR enzyme system" are used interchangeably herein and in the context of all embodiments of the present invention together with a target-polynucleotide to form a CRISPR-Cas complex. refers to the set of necessary elements; These elements include, but are not limited to, Cas proteins and guide-polynucleotides.

The term "CRISPR-Cas complex" in the context of all embodiments of the invention refers to a complex comprising a guide-polynucleotide hybridized to a target-polynucleotide and complexed with a Cas protein. In its simplest form, when an unmutated Cas protein, such as, but not limited to , the Cas9 protein of Streptococcus pyogenes , is used, the formation of the CRISPR-Cas complex is in or near the target-polynucleotide. Produces cleavage of one or both polynucleotide strands (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from above) . Typically, a target-polynucleotide according to the invention (as defined herein below) is associated with a PAM sequence (as defined herein below) and said PAM sequence is preferably immediately downstream of said target-polynucleotide. in (3'); Formation of the CRISPR-Cas complex typically results in cleavage of one or both polynucleotide strands 3 base pairs upstream (5') of the PAM sequence.

The term “non-natural composition” refers to a composition that is not naturally present in its form as used in the present invention in the context of all embodiments of the present invention. The individual element may for example be present as is or in combination with other elements in nature, although the non-naturally occurring composition comprises at least one element, for example more or less than the natural composition.

The term "engineered composition" in the context of all embodiments of the invention refers to a composition in which at least one of the elements has been engineered, ie, modified by a human, in such a way that the resulting element does not exist in nature. By including at least one engineered element, the engineered composition is non-existent in nature.

The terms "polynucleotide", "nucleotide sequence" and "nucleic acid" are used interchangeably herein and in the context of embodiments of the invention, a polymeric form of a nucleotide of any length, whether deoxyribonucleotide or ribonucleotide , or mixtures or analogs thereof. A polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci defined from association analysis (locus), exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosome Isolation of RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozyme, cDNA, recombinant polynucleotide, branched polynucleotide, plasmid, vector, arbitrary sequence DNA, isolated RNA of any sequence, nucleic acid probes, oligonucleotides and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs or nucleotide equivalents (wherein nucleotide analogs or equivalents include modified bases and/or modified backbones, and/or non -defined as residues having natural internucleoside bonds, or a combination of these modifications). Preferred nucleotide analogs and equivalents are described in the "General Definitions" section. Optionally, modifications to the nucleotide structure may be introduced before or after assembly of the polynucleotide. The polynucleotide may be further modified after polymerization, for example by conjugation with a labeling compound.

As used herein, a "polynucleotide" may include conventional phosphodiester linkages or non-conventional linkages (e.g., amide linkages, e.g., found in peptide nucleic acids (PNA)). . A polynucleotide may contain the nucleotide sequence of a full-length cDNA sequence, including untranslated 5' and 3' sequences, coding sequences, as well as fragments, epitopes, domains and variants of said nucleic acid sequence. The polynucleotide may consist of any polyribonucleotides or polydeoxyribonucleotides, which may be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides include single- or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, single-stranded or more typically a hybrid molecule comprising DNA and RNA, which may be double-stranded or a mixture of single- and double-stranded regions. In addition, the polynucleotide may be composed of a triple-stranded region comprising RNA or DNA or both RNA and DNA. A polynucleotide may be a ribonucleoside (adenosine, guanosine, uridine, or cytidine; an “RNA molecule”) or a deoxyribonucleoside (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxy cytidine; "DNA molecule"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters. Polynucleotides may also contain one or more modified bases or DNA or RNA backbones that have been modified for stability or other reasons. "Modified" bases include, for example, tritylated bases and unconventional bases, such as inosine. Various modifications can be made to DNA and RNA; Thus, "polynucleotide" includes chemically, enzymatically or metabolically modified forms. The term nucleic acid molecule refers only to the primary and secondary structure of the molecule and is not limited to any particular tertiary conformation. Thus, the term specifically includes double-stranded DNA found in linear or circular DNA molecules (eg restriction fragments), plasmids, and chromosomes. In the discussion of specific double-stranded DNA molecular structures, sequences are in the conventional convention of providing only sequences in the 5' to 3' direction along the untranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA) herein. can be described accordingly.

The term “isolated” nucleic acid molecule refers to a nucleic acid molecule, DNA or RNA that has been removed from its native environment. Additional examples of isolated nucleic acid molecules include nucleic acid molecules comprising recombinant polynucleotides maintained in a heterologous host cell or purified (partially or substantially) polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of polynucleotides of the invention. The isolated nucleic acid molecule according to the present invention further comprises such molecules produced synthetically. A nucleic acid molecule or polynucleotide may also include regulatory elements, such as promoters, ribosome binding sites, or transcription terminators.

A “gene” refers to an assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acids. A "gene" also includes intervening sequences (introns) between individual coding segments (exons) as well as regulatory sequences preceding (5' non-coding sequences) and following (3' non-coding sequences) coding sequences, including, Refers to a nucleic acid fragment that expresses a protein. A “native gene” refers to a gene as found in nature, having its own regulatory sequences.

In some embodiments, the nucleic acid molecule is at least about 80%, 85%, or 90% identical to a polynucleotide sequence as reported herein, or at least about 95%, 96% identical to a polynucleotide sequence as reported herein, polynucleotide sequences that are 97%, 98%, 99% or 100% identical. As is known in the art, the term "percent identity" is the relationship between two or more amino acid sequences or two or more polynucleotide sequences, as determined by sequence comparison. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or polynucleotide sequences, as the case may be, as measured by the agreement between strings of sequences.

For a nucleic acid molecule having a polynucleotide sequence that is at least, for example 95% "identical to" a reference polynucleotide sequence of the invention, the polynucleotide sequence of the nucleic acid molecule is such that the polynucleotide sequence is equal to each 100 of the reference polynucleotide sequence. is meant to match the reference sequence, except that it may contain a difference of up to 5 nucleotides per nucleotide. That is, in order to obtain a nucleic acid molecule having a polynucleotide sequence that is at least 95% identical to a reference polynucleotide sequence, 5% or less of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or A number of nucleotides up to 5% of the total nucleotides may be inserted into the reference sequence.

As a practical matter, any particular polynucleotide sequence or amino acid sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a polynucleotide sequence or amino acid sequence of the present invention. Whether or not it can be measured can be conventionally performed using a known computer program. The method of determining the best overall match between the sequence in question (sequence of the invention) and the main sequence can be determined using the alignment of the sequences and calculation of the identity score. The alignment was performed using the computer program Genius (www.geneious.com) with a reference algorithm and a map to the Geneious reference assembler.

A guide-polynucleotide according to the present invention comprises at least one guide-sequence capable of hybridizing with a target-polynucleotide and directs sequence-specific binding of said CRISPR-Cas system to said target-polynucleotide to thereby direct CRISPR- Cas complexes can be formed. To enable the formation of an active CRISPR-Cas complex, the guide-polynucleotide preferably also comprises a sequence having a specific secondary structure and allowing binding of the Cas protein to the guide-polynucleotide . Such sequences are known in the art as tracr RNA, tracr sequences, tracr scaffolds or guide-polynucleotide structural components, and these terms are used interchangeably herein; wherein the tracr is an abbreviation for transactivation CRISPR; Therefore, tracrRNA means transcription-promoting CRISPR RNA. The tracrRNA in the native CRISPR-Cas system is an endogenous bacterial RNA capable of linking a crRNA (guide-sequence) to a Cas nuclease and can bind any crRNA. A guide-polynucleotide structural component may consist of a single polynucleotide molecule or may consist of two or more molecules hybridized to each other, or two or more molecules that bind Cas proteins or other nucleases of similar function. . Such components of the guide-polynucleotide structure may be referred to as tracr sequences and tracr-pair sequences.

Correspondingly, said guide-polynucleotide preferably also comprises a tracr sequence and/or a tracr-pair sequence. said guide-polynucleotide is a polynucleotide according to the general definition of polynucleotide set forth herein above; Preferred guide-polynucleotides include ribonucleotides, and more preferred guide-polynucleotides are RNA (guide-RNA). Two examples of guide-polynucleotide structures are depicted in FIG. 1 .

In the context of the present invention, a sequence essentially consists of a target-sequence or target-polynucleotide, if the main sequence is preferably capable of hybridizing with a target-sequence or target-polynucleotide under physiological conditions, such as in a host cell. referred to as reverse complement. The degree of complementarity between the guide-sequence and its corresponding target-sequence, when optimally aligned using a suitable alignment algorithm, is preferably 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, greater than 99% sequence identity. When the target-polynucleotide is a double-stranded polynucleotide, a main sequence, such as a guide-sequence, can hybridize with either strand of the target-polynucleotide, eg, a coding strand or a non-coding strand.

Preferably, the guide-sequence according to the invention targets a unique target-sequence among the targets. Preferably, the guide-sequence according to the present invention is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, more preferably in the target-polynucleotide immediately adjacent to the PAM sequence. has 100% sequence identity with 8, 9, 10, 11 or 12 nucleotides.

The guide-sequence according to the invention preferably has a length of 8 to 30, more preferably 10 to 30, more preferably 15 to 30, more preferably 17 to 27, more preferably 17 to 20, more preferably 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides. The ability of a guide-sequence to direct sequence-specific binding to a target-sequence of the CRISPR-Cas system to form a CRISPR-Cas complex can be assessed by any suitable assay. Components of the CRISPR system sufficient to form a CRISPR-Cas complex, including, for example, the guide-sequence to be tested, for example by transfection with a vector encoding the components of the CRISPR-Cas system, followed by, for example, Host cells with the corresponding target-sequence can be presented to host cells, eg by standard sequencing, by evaluation of the resulting mutations induced by preferential cleavage and/or cell repair mechanisms in the target-sequence. Cleavage of the target-polynucleotide also provides components of the CRISPR-Cas system, including the target-polynucleotide, the guide-sequence to be tested, and a control guide-sequence different from the test guide-sequence, for the test and control. It can be assessed in vitro by comparing the rate of cleavage or binding at the target-sequence between guide-sequence reactions. Other assays are possible and known to those skilled in the art.

The guide-polynucleotide structural component is believed to be required for the formation of an active CRISPR-Cas complex. It is believed that the guide-polynucleotide structural component is not necessarily operatively linked to the guide-sequence; A guide-polynucleotide structural component may be operatively linked to a guide-sequence within the guide-polynucleotide. A guide-polynucleotide structural component according to the invention [which includes all or part of a wild-type guide-polynucleotide structural component (eg about or about 20, 26, 32, 45, 48, 54, 63, wild-type tracr-sequence, 67, 85, or more nucleotides)), for example, of at least a part of a tracr-sequence according to the invention to all or part of a tracr-pair sequence according to the invention. By hybridization and preferably operatively linked to the guide-sequence according to the invention, it forms part of the CRISPR-Cas complex. The tracr-sequence according to the invention preferably has sufficient complementarity to hybridize to the tracr-pair sequence according to the invention under physiological conditions such as in a host cell and promote the formation of the CRISPR-Cas complex. Perfect complementarity is not considered necessary if there is sufficient complementarity to be functional, such as a target-sequence according to the present invention. Preferably, the tracr-sequence according to the invention is at least 50%, 60%, 70%, 80%, 90%, 95% or 99% sequence along the length of the tracr-pair sequence according to the invention when optimally aligned. have consistency. Optimal alignment can be determined using any suitable algorithm for sequence alignment as discussed above.

In general, a tracr pair sequence according to the present invention comprises any sequence having sufficient complementarity to promote the formation of a CRISPR-Cas complex in a target-sequence with a tracr sequence according to the present invention, wherein said CRISPR-Cas complex comprises a tracr partner sequence according to the invention hybridized to a tracr sequence according to the invention. The degree of complementarity of the tracr sequence according to the invention and the tracr pair sequence according to the invention is preferably defined with respect to the optimal alignment of the tracr pair sequence and the tracr sequence along the length of the shorter of the two sequences. Optimal alignment can be determined using any suitable algorithm for sequence alignment as discussed above.

Preferably, for the tracr pair sequence according to the invention and the tracr sequence according to the invention, the secondary structure takes into account, for example, self-complementarity within either said tracr sequence or the tracr pair sequence. Preferably, the degree of complementarity between the tracr sequence according to the invention and the tracr partner sequence according to the invention is 50%, 60%, 75%, 80%, when optimally aligned along the length of the shorter of the two sequences, greater than 85%, 90%, 95%, 97.5%, 99% sequence identity. Preferably the tracr pair sequence according to the invention has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 or more nucleotides. Preferably the tracr sequence according to the invention has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 more than one nucleotide. Preferably, the tracr sequence according to the invention and the tracr pair sequence according to the invention, ie the guide-polynucleotide structural component, are such that hybridization between the two produces a hybridization complex comprising a secondary structure, for example a hairpin. contained within a single transcript. Such hybridization complexes may also be formed when the tracr sequence and the tracr pair sequence are not included in a single transcript. Preferred ring-forming sequences in the tracr sequence according to the invention and/or the tracr pair sequence according to the invention and/or the guide-polynucleotide structural component according to the invention for the formation of a hairpin structure are 4 nucleotides in length, most preferably has a GAAA sequence; Longer or shorter ring sequences, which may be replacement sequences, may also be used. The ring sequence preferably comprises a nucleotide triplet (eg AAA) and additional nucleotides (eg C or G). Examples of ring-forming sequences include CAAA and AAAG. Preferably the tracr sequence according to the invention and/or the tracr pair sequence according to the invention or hybridization complex thereof and/or the intra-polynucleotide structural component according to the invention comprises or forms at least two or more hairpins. can More preferably, the tracr sequence according to the invention and/or the tracr pair sequence according to the invention or hybridization complex thereof and/or the guide-polynucleotide structural component according to the invention comprises 2, 3, 4 or 5 hairpins or may form the above. Preferably, the tracr sequence according to the invention and/or the tracr pair sequence according to the invention or hybridization complex thereof and/or the guide-polynucleotide structural component according to the invention comprises or forms no more than 5 hairpins. can do. Preferably, a hybridization complex of a tracr sequence according to the invention and a tracr-pair sequence according to the invention or a tracr sequence according to the invention and a tracr pair sequence according to the invention and/or a guide-polynucleotide structural component according to the invention a single transcript of further comprises a transcription termination sequence; Preferably it is a polyT sequence, for example 6 T nucleotides. As stated, the guiding-polynucleotide structural components are known to those skilled in the art; Background information can be found in Gaj et al., 2013.

In the context of all embodiments according to the present invention, the term "target-polynucleotide" refers to a target-sequence according to the present invention, wherein the guide-sequence according to the present invention is designed to have complementarity, wherein the target according to the present invention- Hybridization between the sequence and the guide-sequence according to the invention promotes the formation of the CRISPR-Cas complex. Complete complementarity is not necessarily required as long as there is sufficient complementarity to cause hybridization of the CRISPR-Cas complex and promote formation of the complex. Preferably, the guide-sequence according to the invention targets a unique target-sequence in the target. Preferably, the guide-sequence according to the invention is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, more preferably in the target-polynucleotide immediately adjacent to the PAM sequence. has 100% sequence identity with 8, 9, 10, 11 or 12 nucleotides. The target-polynucleotide according to the present invention may comprise any polynucleotide, for example a DNA or RNA polynucleotide, and may be single or double stranded. When the target-polynucleotide is a double-stranded polynucleotide, the guide-sequence according to the present invention can hybridize with either strand of the target-polynucleotide, for example a coding strand or a non-coding strand.

The target-polynucleotide according to the present invention may be located in the nucleus or cytoplasm of a cell. The target-polynucleotide according to the present invention may be located in an organelle of a host cell, for example in mitochondria or plastids. The target-polynucleotide according to the present invention may be contained within the genome, within the chromosome or present extrachromosomally, may also be contained within an artificial chromosome, any chromosomal entity or extrachromosomal entity, for example an autosomal replicating entity, For example, it may be present in an episomal plasmid or vector. The target-polynucleotide according to the present invention may be native to the host cell or foreign.

The target-polynucleotide according to the present invention is preferably associated with a protospacer adjacent motif (PAM), which is a short polynucleotide recognized by the CRISPR-Cas complex. Preferably, the target-polynucleotide and the PAM are linked, wherein the PAM is preferably immediately downstream (3′) of the target-polynucleotide. The exact sequence and length of the PAM may vary, eg, different Cas proteins and nucleases of similar function may require different PAM sequences. Preferred PAMs according to the invention are polynucleotides of 2 to 8 nucleotides in length. Preferred PAMs are 5'-XGG-3', 5'-XGGXG-3', 5'-XXAGAAW-3', 5'-XXXXGATT-3', 5'-XXAGAA-3', 5'-XAAAAC-3' (wherein X can be any nucleotide or analog thereof, preferably any nucleotide; W is A or T). A more preferred PAM is 5'-XGG-3'. The PAM is preferably compatible with a Cas protein. The most widely used CAS/CRISPR system is derived from Streptococcus pyogenes and the matching PAM sequence 5'-XGG-3' is located immediately downstream (3') of the target-sequence. A preferred PAM for Neisseria meningitidis Cas protein is 5′-XXXXGATT-3′; A preferred PAM for the Streptococcus thermophilus Cas protein is 5'-XXAGAA-3'; A preferred PAM for Treponema denticola is 5'-XAAAAC-3'. Preferred PAMs are compatible with the Cas protein used. Cas proteins according to the invention can be engineered to match a different PAM than a native PAM that matches the wild-type Cas protein. As such, the CRISPR-Cas system according to the present invention can be used for tailored specific targeting.

The term "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonds between the bases of nucleotide residues. The hydrogen bonding may occur by Watson Creek base pairing, Hoogstein bonding, or in any other sequence-specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. A hybridization reaction may constitute one step in a broader process, for example, cleavage of a polynucleotide by an enzyme. Preferred hybridization conditions are physiological conditions, such as in a host cell according to the present invention.

The term "source" in the context of all embodiments of the invention refers to any source of the CRISPR-Cas system comprising a guide-polynucleotide and a Cas protein. The guide-polynucleotide and Cas protein may be in separate sources. In such a case, the composition according to the present invention comprises a CRISPR-Cas system comprising a source of intra-polynucleotides and a source of Cas-proteins. Any source means that the guide-polynucleotide and Cas protein can exist as such in a form capable of functioning in the CRISPR-Cas system. The guide-polynucleotide and/or Cas-protein may be provided in its active form, for example from an inactive form or from another individual. Said guide-polynucleotide may for example be present on another polynucleotide or encoded by a transcribed polynucleotide to provide the actual guide-polynucleotide. The Cas protein may be encoded by a polynucleotide (eg DNA or mRNA) transcribed and/or translated to provide the actual Cas protein. The encoding polynucleotide may be present in a nucleic acid construct as defined herein and/or in a vector as defined herein. Such nucleic acid constructs and vectors are referred to herein as nucleic acid constructs according to the present invention and vectors according to the present invention.

Preferably, in the composition according to the present invention, said Cas protein or nuclease of related function is encoded by a polynucleotide and/or said guide-polynucleotide is encoded by or is present on said polynucleotide.

Preferably, in the composition according to the present invention, said Cas protein or nuclease of related function is encoded by a polynucleotide and/or said guide-polynucleotide is encoded by or present on another polynucleotide and is present on said polynucleotide Nucleotides or polynucleotides are included in the vector.

Preferably, in the composition according to the invention, the guide-polynucleotide is encoded by the transcribed polynucleotide to give the actual guide-polynucleotide. Correspondingly, in one embodiment, in the composition according to the invention, preferably said guide-polynucleotide is in the form of a polynucleotide encoding said guide-polynucleotide and said guide-polynucleotide is said polynucleotide in a host cell. obtained upon transcription of nucleotides.

Preferably, in the composition according to the present invention, the Cas protein is encoded by a polynucleotide and the guide-polynucleotide is encoded by or present on another polynucleotide and the polynucleotide is comprised in one vector.

Preferably, in the composition according to the invention, the Cas protein is encoded by a polynucleotide contained in one vector and the guide-polynucleotide is encoded by or present on another polynucleotide contained in another vector. do. Preferably, the vector encoding the Cas protein is a low copy vector and/or the promoter driving expression of the Cas transcript is a low-strength promoter and the vector encoding the guide-polynucleotide is a high copy vector and/or the gRNA The promoter driving expression of the transcript is a high-strength promoter. This allows for differential expression of the Cas protein and guide-polynucleotide; The Cas protein may be expressed, for example, at a lower level than the guide-polynucleotide. Promoter strength can be assessed by any means, for example by RNA sequencing. RNA sequencing (RNAseq) is a very sensitive and accurate tool for measuring expression throughout the transcriptome under different conditions. This allows for a quantitative approximation of gene expression at the transcript level, reported as RPKM values (reads per kilobase of transcript per million mapped reads). The RPKM values and relative promoter strengths of typical genes from Schizochytrium are provided in Table 1.

gene Average RPKM value relative
promoter strength Arginase (EC 3.5.3.1) 3694.34 strong Pyruvate Kinase (EC 2.7.1.40) 2127.49 strong heat shock protein 70 1857.74 strong Glyceraldehyde 3-phosphate dehydrogenase (EC 1.2.1.12) 1688.00 strong tubulin alpha chain 696.85 middle Protein Translation Elongation Factor 1A (EF-1A) 682.30 middle Isocitrate lyase (EC 4.1.3.1) 510.45 middle Aconitate hydratase 2 (EC 4.2.1.3) 317.74 middle Maleate dehydrogenase (EC 1.1.1.37) 192.47 middle vacuole ATP synthase subunit D (EC 3.6.3.14) 163.74 middle Acyl-CoA dehydrogenase (EC 1.3.99.3) 94.43 weakness Acetylspermidine deacetylase (EC 3.5.1.48) 90.60 weakness Acetolactate synthase (EC 2.2.1.6) 63.21 weakness Maleylacetoacetate isomerase (EC 5.2.1.2) 39.46 weakness Phytoene deseturase (EC 1.14.99.-) (carotene synthase) 31.56 weakness ATP-dependent RNA helicase 28.42 weakness Acetyl-CoA acetyltransferase (EC 2.3.1.9) 26.74 weakness

Examples of low-strength (ie weak) Schizochytrium promoters include, but are not limited to, those that drive expression of carotenoid synthase. Examples of medium-strength (ie, medium) Schizochytrium promoters include, but are not limited to, those driving expression of alpha-tubulin. Examples of high-strength (ie, strong) Schizochytrium promoters include, but are not limited to, those driving expression of elongation factor 1 (EF-1). Although RPKM values are generally considered to be indicative of relative promoter strength, it is known to those skilled in the art that a promoter in the native genomic environment may not have exactly the same strength as in the expression vector environment. Accordingly, those skilled in the art will appreciate that the relative promoter strengths provided in Table 1 may vary in the context of the present invention.

Accordingly, the present invention provides possibilities in which the guide-polynucleotide and Cas protein are provided as such, or encoded on a vector or present on a vector. In the latter case, the encoding polynucleotides may each be on a separate vector or both may be on a single vector. Correspondingly, in one embodiment, the invention provides a composition according to the invention, wherein a polynucleotide encoding a Cas protein according to the invention, a guide-polynucleotide or a guide-polynucleotide encoding the guide-polynucleotide according to the invention The polynucleotides described herein are present on a single vector, which vector may further comprise any elements necessary to express the encoded product, such as promoter and terminator elements. Such a single (all-in-one) vector has the advantage that all components necessary for the CRISPR-Cas system are present together; Also, a single transformation event, optionally with a donor polynucleotide, is sufficient to introduce the components into the host cell.

vector

In the context of all embodiments of the present invention, the vector may conveniently be any vector (eg plasmid or virus) capable of mediating the expression of a polynucleotide according to the present invention to which it has been subjected to recombinant DNA processing. The choice of vector will typically depend on the compatibility of the vector with the host cell into which it is introduced. A preferred vector is the vector used in the embodiments herein. A vector may be a linear polynucleotide or a linear or closed circular plasmid. A vector may be an integrative or autonomously replicating vector, ie a vector that exists as a chromosomal or extrachromosomal entity and whose replication is dependent or independent of chromosomal replication, eg, a plasmid, an extrachromosomal element, a mini-chromosome, or an artificial chromosome.

Preferably, the vector is one that is integrated into the genome when introduced into a host cell and is replicated together with the chromosome(s) into which it is integrated. The integration vector may integrate randomly in the chromosome of the host cell or at a given target locus. Preferred integration vectors include DNA fragments, said fragments homologous to a DNA sequence in said predetermined target locus in the genome of a host cell to target integration of said vector into said predetermined locus. To facilitate targeted integration, the vector is preferably linearized prior to transformation of said cells. Linearization is preferably carried out such that at least one end, preferably either end, of the vector is flanked by sequences homologous to the target locus. The length of the homologous sequence flanking the target locus is preferably at least 30 bp, preferably at least 50 bp, preferably at least 0.1 kb, even more preferably at least 0.2 kb, more preferably at least 0.5 kb, even more preferably at least 1 bp. kb, most preferably at least 2 kb. Preferably, the efficiency of targeted integration into the genome of said host cell, ie integration in a given target locus, is increased by the enhanced homologous recombination capacity of said host cell.

The homologous flanking DNA sequence (which is homologous to the target locus) in the vector may be derived from an expressed locus, meaning that the sequence is derived from a gene capable of expression in a host cell. A flanking DNA sequence can be ligated with a selectable marker gene so that transformed cells grow when the culture medium is supplemented with a suitable selectable factor. The flanking DNA sequences can be designed by any means known to those skilled in the art; One preferred design directs homologous recombination into genes encoding saturated and/or polyunsaturated fatty acid synthase (PUFA synthase), so that mutation or disruption of these synthases results in saturated and/or polyunsaturated fatty acid synthase (PUFA synthase). Creates an auxotroph for fatty acids. Cells that are auxotrophic for saturated and/or polyunsaturated fatty acids require the saturated and/or polyunsaturated fatty acids as a supplement for growth. Another preferred design allows expression of the selectable marker gene so that transformants of the dominant selectable marker gene can be grown in the presence of a suitable dominant selectable factor.

More than one copy of a polynucleotide according to the invention can be inserted into a microbial host cell to mediate production of a product encoded by said polynucleotide. This can preferably be done by integrating multiple copies of the polynucleotide into the genome of the host cell or by targeting the integration of the polynucleotide in an operable arrangement to a highly expressed locus. On the one hand, integration of multiple copies can be achieved by including an amplifiable selectable marker gene with a polynucleotide according to the present invention, thus generating an amplified copy of the selectable marker gene (and thereby an additional copy of the nucleic acid sequence). The containing cells can be selected by culturing the cells in the presence of a suitable selectivity factor. In order to increase the copy number of the polynucleotide according to the invention even more, the technique of gene conversion as described in WO98/46772 can be used.

Upon integration of a Cas protein according to the invention and/or a polynucleotide according to the invention encoding a guide-polynucleotide according to the invention into the genome of a host cell, for example when the desired genome editing has occurred, said polynucleotide It may be desirable to excise nucleotides from the genome. Excision of polynucleotides can be performed by any means known to those skilled in the art; One preferred means is a nucleotide that repairs the auxotrophic-induced gene mutation or disruption so that auxotrophic cured cells can be selected instead by growth in culture medium omitting the nutrients required by the auxotroph. by secondary transformation. Another means of ablation may be the use of the CRISPR-Cas system according to the present invention.

The vector according to the present invention may be a single vector or plasmid containing the polynucleotide according to the present invention together to be introduced into a host cell, or a vector system comprising two or more vectors or plasmids.

The vector according to the invention may contain one or more selectable markers which allow for easy selection of transformed cells. In one embodiment, one or more or all vectors in the composition according to the invention comprise a selectable marker, preferably each vector comprises a separate selectable marker. Selectable markers are genes whose products confer biocide or virus resistance, resistance to heavy metals, prototrophs for auxotrophs, and the like. The selectable marker may be introduced into cells on the vector as an expression cassette or may be introduced on a separate vector.

Selectable markers for use in labyrinthulomycet cells include, but are not limited to, nptII (neomycin phosphotransferase II, conferring paromomycin resistance), ALS (acetolactate synthase, sulfometuronmethyl resistance confer), bsd (blasticidin-S-deaminase, confer blasticidin resistance), and Sh ble (pleomycin binding, confer zeocin resistance) can

Alternatively, one can use a specific selectable marker, for example an auxotrophic marker that requires a corresponding mutant host cell bearing an inactivating mutation of the saturated or polyunsaturated fatty acid synthase gene as the strains discussed above. In a preferred embodiment, the selectable marker is deleted from the transformed host cell after introduction of the expression construct to obtain a transformed host cell capable of producing a polypeptide lacking the selectable marker gene.

The procedure used to ligate the elements described above to construct a vector according to the invention is well known to those skilled in the art (see, e.g., Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed. , CSHL Press). , Cold Spring Harbor, NY, 2001; and Ausubel et al. , Current Protocols in Molecular Biology , Wiley InterScience, NY, 1995).

Cas protein in the context of all embodiments of the present invention refers to any Cas protein suitable for the purposes of the present invention. A Cas protein may or may not contain enzymatic activity. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1 , Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csf3, Csx10, Csf , Csf2, Csf3, Csf4, homologues thereof or modified versions thereof. These Cas proteins are known to those skilled in the art; For example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be found under accession number Q99ZW2 in the SwissProt database. Preferably, the unmodified Cas protein according to the invention, for example Cas9, has DNA cleavage activity. Preferably, the corresponding Cas protein is Cas9, which may be Cas9 from Streptococcus pyogenes or Streptococcus pneumoniae. Preferably, the Cas protein according to the invention comprises cleavage of one or both polynucleotide strands at the position of the target-polynucleotide, for example in said target-polynucleotide and/or in the reverse complement of said target-polynucleotide. instruct The position of the target-polynucleotide herein is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 from the first or last nucleotide of the target-polynucleotide. , within 100, 200, 500, or more nucleotides; more preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or within more nucleotides; Even more preferably within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides from the first or last nucleotide of the target-polynucleotide. Correspondingly, the Cas protein according to the invention is preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 from the first or last nucleotide of the target-polynucleotide. , within 50, 100, 200, 500, or more nucleotides; more preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or within more nucleotides; Even more preferably one or two within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50 nucleotides from the first or last nucleotide of the target-polynucleotide Directs cleavage of all polynucleotide strands. Typically, a target-polynucleotide according to the invention is associated with a PAM sequence (as defined elsewhere herein), said PAM sequence preferably immediately downstream (3') of the target-sequence; Formation of the CRISPR-Cas complex typically results in cleavage of one or both polynucleotide strands 3 base pairs upstream (5') of the PAM sequence.

Preferably, the Cas protein in the composition according to the present invention has an activity to direct the cleavage of both polynucleotide strands at the position of said target-polynucleotide. Cas nuclease activity is typically carried out by two separate catalytic domains, RuvC and HNH. Each domain cleaves one polynucleotide strand and each domain can be inactivated by a single point mutation.

Accordingly, the Cas protein according to the present invention may be conveniently mutated to the corresponding wild-type Cas protein such that the mutated Cas protein has altered nuclease activity and lacks the ability to cleave one or both strands of the target-polynucleotide. have. For example, aspartate to alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from Streptococcus pyogenes (D10A) results in a nickase in a nuclease that cleaves both strands of Cas9 (see It is defined as a Cas protein that cleaves a single strand of a target-polynucleotide). Other examples of mutations that render Cas9 nickase include, but are not limited to, H840A, N854A, and N863A. In the context of the present invention, a Cas protein with nickase activity can be used for genome editing via homologous recombination, preferably a double nicking technique according to Ran et al., 2013. Correspondingly, a preferred Cas protein according to the invention has an activity that directs cleavage of a single polynucleotide strand, preferably at the position of the target-sequence, such that said protein has an altered nuclease activity compared to the corresponding wild-type Cas protein. at least one mutation with Such so-called nickase mutants can be conveniently used in a duplex setup, i.e., in the composition according to the invention comprising a RuvC mutated Cas protein nickase mutant and a NHN mutated Cas protein nickase mutant, and thus One Cas protein mutant nicks one strand of the polynucleotide target and another Cas protein mutant nicks the other strand of the polynucleotide target. Depending on the two guide-polynucleotides used, two different CRISPR-Cas complexes will effectively generate two single-stranded nicks in the polynucleotide target; These nicks can be multiple nucleotides 5, 10, 20, 30 or more apart. This double nicking method greatly enhances the specificity of non-homologous end attachment (NEJH). Background information on double nicking can be found, for example, in Ran et al., 2013.

A Cas protein according to the present invention can generate a mutated Cas9 that is substantially free of any DNA cleavage activity comprising two or more mutated catalytic domains of Cas9, for example RuvC I, RuvC II and/or RuvC III Some In an embodiment, the D10A mutation is combined with one or more of the H840A, N854A, or N863A mutation to generate a Cas9 enzyme substantially free of all DNA cleavage activity. Preferably, the Cas protein has all DNA cleavage activity when the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or less relative to the unmutated form. considered practically absent. Cas proteins lacking substantially all enzymatic activity can be conveniently used for gene silencing or down-regulation of expression, since the CRISPR-Cas complex will interfere with transcription from the target-polynucleotide. Other mutations may be useful; If the Cas9 or other Cas protein is from a species other than Streptococcus pyogenes, a similar effect can be achieved by performing mutations in the corresponding amino acids; A person skilled in the art knows how to identify these corresponding amino acids.

The Cas protein according to the present invention may be a fusion protein and comprises at least one heterologous functional domain, such domains are preferably described in Aggarwal, AK; Wah, DA; Hirsch, J. A.; Donner, L. F.; Schildkraut, I. (1997). "Structure of the multimodular endonuclease FokI bound to DNA". Nature 388 (6637): a domain containing 97-100] Fok I activity as described. The enzyme Fok I is a bacterial type IIS restriction endonuclease naturally found in Flavobacterium okeanokoites and consisting of an N-terminal DNA-binding domain and a C-terminal non-specific DNA cleavage domain. (Durai et al., 2005). When the Fok I protein binds to double-stranded DNA via its DNA-binding domain at the 5'-GGATG-3':3'-CATCC-5' recognition site, the DNA cleavage domain is activated without further sequence specificity. Cleave 9 nucleotides of the first strand downstream of the recognition site and 13 nucleotides of the second strand upstream of the nearest nucleotide of the site (Wah et al., 1998). Cas9- Fok I fusions are particularly described in Guilinger et al ., 2014; and Tsai et al ., 2014.

The Cas fusion protein according to the present invention may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more domains in addition to the Cas protein. Examples of protein domains that can be fused to a Cas protein include, but are not limited to, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demitylase activity, transcriptional activation activity, Transcription repression activity, transcription release factor activity, historical modification activity, RNA cleavage activity and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, autofluorescent proteins including luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and blue fluorescent protein (BFP). A Cas protein is a gene sequence encoding a protein or fragment of a protein that binds to a DNA molecule or binds to another cellular molecule, including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA binding domain ( DBD) fusion, a GAL4 DNA binding domain fusion, and a herpes simplex virus (HSV) BP 16 protein fusion. Additional domains capable of forming part of a fusion protein comprising a CRISPR enzyme are described in US20110059502. A tagged Cas protein can be used to determine the location of the target-polynucleotide. Preferred Cas fusion proteins according to the invention comprise a Fok I domain as hereinbefore defined.

Preferred Cas proteins according to the invention comprise a nuclear localization sequence, preferably a heterologous nuclear localization sequence. Such nuclear localization sequences are also referred to as nuclear localization signals. Preferably, such a nuclear localization signal imparts to the CRISPR-Cas complex a strength sufficient to drive accumulation of the CRISPR-Cas complex in a detectable amount in the nucleus of a host cell. While not wishing to be bound by theory, although nuclear localization sequences are not required for CRISPR-Cas activity in a host cell, the inclusion of such sequences enhances the activity of the system, particularly for target nucleic acid molecules into the nucleus. It is considered Such nuclear localization sequences are preferably present in the Cas protein, but may also be present elsewhere to facilitate targeting of the CRISPR-Cas system to the nucleus. A preferred nuclear localization sequence is the SV40 nuclear localization sequence.

In the composition according to the invention and in any other embodiment, the Cas protein encoding polynucleotide is preferably codon optimized in the host cell in which it is to be expressed, more preferably the Cas protein encoding polynucleotide is codon pair optimized. In general, codon optimization refers to the codon of at least one of the native sequences (e.g., the codons used more frequently or most frequently in the gene of the host cell) for enhanced expression in the host cell of interest while maintaining the native amino acid sequence. for example, 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons). Different species exhibit specific biases for some codons of specific amino acids. Codon bias (differences in codon usage between organisms) is often correlated with the translation efficiency of messenger RNA (mRNA), which in turn has been shown to vary with, among other things, the nature of the codon being translated and the availability of a particular transfer RNA (tRNA) molecule. It is considered The predominance of a selected tRNA in a cell is generally a reflection of the codons most frequently used in peptide synthesis. Correspondingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, in the "Codon Usage Database" and the tables can be adapted in a variety of ways. See, eg, Nakamura, Y., et al., 2000. Computer algorithms for codon optimization of specific sequences for expression in specific host cells are also available, for example, from Gene Forge (Aptagen; Zuckers, PA). can do. Preferably, one or more codons (e.g. 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in the sequence encoding the Cas protein are the most codons for a particular amino acid. Corresponds to frequently used codons. Preferred methods for codon optimization are described in WO2006/077258 and WO2008/000632. WO2008/000632 deals with codon-pair optimization. Codon-pair optimization is a nucleotide sequence encoding a polypeptide, in order to obtain improved expression of the nucleotide sequence encoding the polypeptide and/or improved production of the encoded polypeptide, its codon-use, in particular the codons used - A modified method for pairs. A codon pair is defined as a set of two successive triplets (codons) in a coding sequence. The amount of Cas protein in the source in the composition according to the invention can vary and can be optimized for optimal performance. High levels of Cas proteins can be toxic to host cells even in the absence of guide-polynucleotides (eg, Ryan et al ., 2014 and Jacobs et al ., 2014). see) it may be convenient to avoid too high levels of Cas protein in the host cell. The person skilled in the art knows how to control the expression level, for example by selecting a weaker, repressive or inducible promoter for the expression of the Cas protein. Examples of promoters suitable for expression of proteins are described elsewhere herein.

In the composition according to the invention in which the guide-polynucleotide according to the invention is encoded by a polynucleotide, expression of the guide-polynucleotide can be promoted by a promoter operably linked to the encoding polynucleotide. Such promoters may be any suitable promoter known to those skilled in the art. Many types of promoters can be used. For convenience, an RNA polymerase III promoter or an RNA polymerase II promoter may be used. Background information on RNA polymerase III and its promoters can be found, for example, in Marck et al., 2006. Correspondingly, it is convenient to use the RNA polymerase II promoter, which is known to the person skilled in the art and is reviewed, for example, in Kornberg, 1999. However, transcripts from RNA II polymerases often have complex transcription terminators and transcripts are polyadenylated; This may interfere with the requirement of the guide-polynucleotide as it is necessary to precisely define both the 5' and 3' ends to achieve the secondary structure needed to generate a functional CRISPR-Cas system. However, this drawback can be avoided. When an RNA polymerase II promoter is used, the polynucleotide encoding the guide-polynucleotide may also encode a self-processing ribozyme and may be operably linked to an RNA polymerase II promoter; As such, the polynucleotide encodes the guide-polynucleotide and a pre-guide-polynucleotide comprising a self-processing ribozyme, wherein the guide-polynucleotide is transcribed from the pre-guide-polynucleotide transcript upon transcription. released by self-engineering ribozymes. Preferred constructs comprising a polynucleotide encoding a pre-guide-polynucleotide according to the invention operably linked to an RNA polymerase II promoter are those described in Examples 1-4 herein. Background information on such structures can be found, for example, in Gao et al., 2014.

Preferably, in the composition according to the invention, said guide-polynucleotide is encoded by a polynucleotide.

Preferably, in the composition according to the invention, wherein said guide-polynucleotide is encoded by a polynucleotide, said polynucleotide is operably linked to an RNA polymerase II promoter and comprises said guide-polynucleotide and a self-processing ribozyme and encodes a pre-guide-polynucleotide, wherein the guide-polynucleotide is released by a self-processing ribozyme from the pre-guide-polynucleotide transcript upon transcription. Preferred constructs comprising a polynucleotide encoding a pre-guide-polynucleotide according to the invention operably linked to an RNA polymerase II promoter are those described in Examples 1-4 herein. For convenience, multiple pre-guide-polynucleotides and multiple self-processing ribozymes may be encoded by a single polynucleotide operably linked to one or more RNA polymerase II promoters.

The composition according to the first aspect of the present invention may conveniently be used to modulate the expression of polynucleotides in a host cell. Correspondingly, in a second aspect, the invention provides a method of modulating the expression of a polynucleotide in a host cell, said method comprising contacting the host cell with a composition according to the first aspect of the invention, wherein The guide-polynucleotide directs binding of the Cas protein to the target-polynucleotide in the host cell to form a CRISPR-Cas complex.

The term "expression" in the context of the present invention refers herein to the process by which a polynucleotide is transcribed from a polynucleotide template (eg a DNA template polynucleotide is transcribed into an mRNA polynucleotide transcript or other RNA transcript) and/or It is defined as the process by which mRNA transcripts are subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be referred to collectively as “gene products”. Where the polynucleotide transcript is derived from genomic template DNA, expression may include splicing of the mRNA transcript in a host cell. The term “regulated expression” refers herein to increased or decreased expression as compared to a parental host cell whose expression is not regulated when assayed using the same conditions. Reduced expression may be a reduced amount of a transcript such as mRNA and/or a reduced amount of a translation product such as a polypeptide. Increased expression may be an enhanced amount of a transcript such as mRNA and/or an enhanced amount of a translation product such as a polypeptide.

Preferably, the CRISPR-Cas complex cleaves one or both polynucleotide strands at the location of the target-polynucleotide resulting in regulated expression of the gene product. The CRISPR-Cas complex may also have altered nuclease activity and is substantially devoid of the ability to cleave one or both strands of the target-polynucleotide; In such cases, expression is regulated by binding of the complex to the target-polynucleotide. Cas proteins lacking substantially all enzymatic activity can conveniently be used for gene silencing or downregulation of expression, since the CRISPR-Cas complex will interfere with transcription from the target-polynucleotide. Alternatively, the Cas protein can be modified as a transcription factor for programmable transcriptional activation or silencing of a gene of interest (Larson, et al., 2013).

The composition according to the first aspect of the present invention may be conveniently used for deletion of polynucleotides. In one embodiment, when the composition according to the first aspect of the invention comprises at least one or two sources of intra-polynucleotides and/or comprises at least one source of Cas proteins, the target-polynucleotides At least one CRISPR-Cas complex or two different CRISPR-Cas complexes is formed, which cleaves one or both polynucleotide strands at one or different positions resulting in deletion of a polynucleotide fragment from the target-polynucleotide do. Preferably, such a composition according to the invention comprising at least one or two guide-polynucleotides and/or a source of at least one Cas protein comprises at least one or and an exogenous polynucleotide, as defined herein below, that is at least partially complementary to the two target-polynucleotides. The polynucleotide fragment or the deleted fragment to be deleted may be several nucleotides to several thousand nucleotides in length, and the entire gene may be deleted or a cluster of genes may be deleted. Correspondingly, the present invention provides a method of modulating the expression of a polynucleotide in a host cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide.

In one embodiment, the expression control method comprises cleavage of one or both polynucleotide strands at at least one position in the target-polynucleotide followed by modification of the target-polynucleotide by homologous recombination with an exogenous polynucleotide. includes In such a case, the composition according to the first aspect of the present invention preferably further comprises such an exogenous polynucleotide. Such modifications may result in an insertion, deletion or substitution of at least one nucleotide in the target-polynucleotide, wherein the insertion or substitution nucleotide may originate from the exogenous polynucleotide. Modifications can also be made when the exogenous polynucleotide is a non-integrating entity as described in Dong et al. and Beetham et al.; In this case, the target-polynucleotide is modified but the nucleotides of the exogenous polynucleotide are introduced into the target-polynucleotide. Consequently, the production host is a non-recombinant host cell when the Cas-protein according to the invention is introduced into the host cell as a protein. The exogenous polynucleotide may be any polynucleotide of interest, for example a polynucleotide encoding a compound of interest as defined herein below, or a portion of such polynucleotide or a variant thereof. Such exogenous polynucleotides are referred to herein as exogenous polynucleotides according to the present invention and may be single-stranded or double-stranded.

Various uses are contemplated by those skilled in the art for the compositions and methods according to the present invention. Polynucleotides (or genes) in the genome can be modified, edited or disrupted using the compositions and methods according to the invention. For example, when using a fully active Cas protein that cleaves both strands of the target-polynucleotide and when an exogenous polynucleotide is not present as a suitable repair template, double-strand breaks are NHEJ). During NHEJ insertions and/or deletions of one or multiple nucleotides (which may be understood as substitutions in some cases) may occur, which are randomly inserted or deleted at the repair site; This is characteristic of NHEJ. Such insertions and/or deletions can affect the reading frame of the coding sequence, which in the case of the occurrence of (early)stop codons or alteration of splicing sites produces amino acid changes in the gene product or even in the truncated protein. can do it

When an exogenous polynucleotide is present as a repair template, a polynucleotide (or gene) in the genome is used in the present invention using homology end attachment repair (HEJ) (also known as homology-directed repair (HDR)). It can be modified, edited, or disrupted using the compositions and methods according to the present invention. For example, when an exogenous polynucleotide having a sequence consistent with the target-polynucleotide (ie upstream (5') and downstream (3') of the double-strand break) is present with the CRISPR-Cas system according to the present invention. , HDR will introduce (or actually regenerate) the corresponding nucleotides of the exogenous polynucleotide to a double strand break in the target-polynucleotide. Preferably, the exogenous polynucleotide according to the present invention does not contain a functional PAM sequence following the target sequence itself, so that the exogenous polynucleotide itself or the modified target-polynucleotide risk (re)cleavage by the CRISPR-Cas system avoid

In an embodiment of the invention, if the CRISPR-Cas system according to the invention comprises an exogenous polynucleotide (donor polynucleotide, donor DNA, repair template), the CRISPR-Cas system according to the invention preferably comprises one or more separate at least two guide-polynucleotides encoded by or present on the polynucleotide or vector of make it possible to form In the method according to the present invention, the CRISPR-Cas system as described above according to the present invention can be conveniently used to regulate expression in two or more target-polynucleotides, that is, it can be used in a method for targeting multiple target sites. . Such a CRISPR-Cas system according to the present invention will inadvertently form one, two or more CRISPR-Cas complexes in one or more target-polynucleotides. Such methods can be used to generate one or more insertions, deletions, substitutions, optionally together with one or more exogenous polynucleotides, in the genome of a host cell, or to regulate the expression of genes through the formed CRISPR-Cas complex.

host cell

In the method according to this aspect of the invention, a preferred host cell comprises a polynucleotide encoding a compound of interest as defined elsewhere herein.

In the method according to this aspect of the invention, the host cell may be a recombinant host cell or a non-recombinant host cell.

In some embodiments, the host cell is a labyrinthulomycet, preferably a member of the order Troystochytriales, preferably a member of the family Thraustochytriaceae, more preferably Aurantiochytrium, Ober A member of the genus selected from the group consisting of Longichytrium, Schizochytrium, Troustochytrium and Ulkenia, even more preferably Schizochytrium sp. ATCC# 20888.

The method for regulating the expression of a polynucleotide in a host cell according to this aspect of the invention preferably results in a modified host cell comprising the components of the composition according to the first aspect of the invention. Correspondingly, in a third aspect, the invention provides a host cell comprising a composition according to the first aspect of the invention. Such host cell may be any host cell as defined herein and may further comprise a polynucleotide encoding a compound of interest as defined elsewhere herein.

In a fourth aspect, the invention provides a method for producing a host cell, said method comprising contacting said host cell with a composition according to the first aspect of the invention, wherein said guide-polynucleotide comprises said host cell It directs the binding of Cas protein at the target-polynucleotide in the CRISPR-Cas complex to form. In one embodiment, the contacting with the composition according to the first aspect of the invention can be carried out in two steps, wherein said host cell is first contacted with a source of Cas protein according to the invention and subsequently said host The cell is contacted with a source of an intra-polynucleotide according to the invention and optionally an exogenous polynucleotide according to the invention. The host cell in this embodiment of the invention may be any type of host cell as defined herein and may comprise a polynucleotide encoding a compound of interest as defined elsewhere herein. A preferred method for producing a host cell according to the present invention comprises the step of generating a progeny host cell, wherein in said progeny host cell the component of the CRISPR-Cas system according to the present invention is no longer present.

The composition according to the first aspect of the present invention may be any such composition as defined herein. Contacting the host cell with the composition according to the invention can be effected by any means known to the person skilled in the art. The host cells according to the invention can simply be brought into solution comprising the composition according to the invention. Any means of delivering a composition according to the invention to a host cell may be employed. Those skilled in the art are aware of such methods (see, for example, Sambrook & Russell, supra; Ausubel), and include, but are not limited to, electroporation methods, particle bombardment or particle accelerator bombardment. , it includes the protoplast method, and Agrobacterium (Agrobacterium) mediated transfection (AMT). Labyrinthulomycetes can be transformed using any method known in the art. General techniques for genetic transformation of thraustochytrids are described in US Pat. Nos. 7,001,772 and 8,637,651 and Cheng et al . (2012)], all of which are incorporated herein by reference in their entirety.

Preferably, said CRISPR-Cas complex cleaves one or both polynucleotide strands at the location of said target-polynucleotide resulting in regulated expression of said gene product. The CRISPR-Cas complex may also have altered nuclease activity and may lack the ability to cleave one or both strands of the target-polynucleotide; In such cases, expression is regulated by binding of the complex to the target-polynucleotide.

In one embodiment, when the composition according to the first aspect of the present invention comprises at least one or two sources of intra-polynucleotides and/or at least one source of Cas proteins, one of said target-polynucleotides At least one CRISPR-Cas complex or two different CRISPR-Cas complexes are formed that cleave one or both polynucleotide strands at a location or at a different location resulting in deletion of the polynucleotide fragment from the target-polynucleotide. Preferably, such a composition according to the invention comprising at least one or two guide-polynucleotides and/or a source of at least one Cas protein comprises said at least one or and an exogenous polynucleotide, as defined herein below, that is at least partially complementary to the two target-polynucleotides. The polynucleotide fragment or the deleted fragment to be deleted may be several nucleotides to several thousand nucleotides in length, and the entire gene may be deleted or a cluster of genes may be deleted. Correspondingly, the present invention provides a method of modulating the expression of a polynucleotide in a host cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide.

In one embodiment, a method of regulating the expression of a polynucleotide in a host cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide, comprises contacting the host cell with a composition as described herein, wherein the guide- The polynucleotide directs the binding of the Cas protein to the target-polynucleotide in the host cell to form a CRISPR-Cas complex. Preferably, the method for regulating the expression of a polynucleotide in a host cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide, comprises contacting the host cell with a composition as described herein, wherein the guide-polynucleotide comprises: The target-polynucleotide in the host cell directs the binding of the Cas protein to form a CRISPR-Cas complex. In another preferred embodiment, a method for regulating the expression of a polynucleotide in a host cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide, comprises contacting the host cell with a composition as described herein, wherein the instructions -polynucleotide directs binding of said Cas protein at target-polynucleotide in said host cell to form a CRISPR-Cas complex, wherein the composition as described herein does not comprise an exogenous or donor polynucleotide. In another embodiment of a method of regulating the expression of a polynucleotide in a host cell, the composition is comprised in an autonomously replicating vector.

Accordingly, the present invention relates, in one embodiment, to a method of modulating the expression of a polynucleotide in a cell, wherein the polynucleotide fragment is deleted from the target-polynucleotide, wherein the method comprises treating the host cell as described herein. contacting with a composition, but preferably not comprising a donor polynucleotide as defined herein, wherein said guide-polynucleotide directs binding of a Cas protein at a target-polynucleotide in said host cell to thereby CRISPR-Cas complex is formed.

In a preferred embodiment, the Cas protein has the activity to direct cleavage of both polynucleotide strands at the position of the target-sequence, wherein the cleavage, upon cleavage by the Cas protein, rejoins each other to form two phases. Occurs among regions of the genome comprised between regions of homology that result in a deletion of the polynucleotide comprised between those regions. Preferably, the degree of homology between the two regions of homology is such that homologous recombination is permitted. Preferably, said two regions of homology have at least 60%, 70%, 80%, 90%, 99% or 100% sequence identity over the entire length of said regions of homology. Surprisingly, it has been found that the length of the regions of homology can be very short even in labyrinthulomycetes, where a length of at least 1 or several kbp is usually required to allow for homologous recombination. Thus, in a preferred embodiment, the length of the region of homology is preferably 1 kb or less, 0.5 kb or less, 100 bp or less, 50 bp or less, 40 bp or less, 30 bp or less, 20 bp or less, 10 bp or less.

Preferably, the distance between the two regions of homology is 10 kb or less, 9 or less, 8 kb or less, 7 kb or less, 6 kb or less, 5 kb or less, 4 kb or less, 3 kb or less, 2 kb or less, 1 kb or less, 0.5 kb or less, 100 bp or less, 50 bp or less, 40 bp or less, 30 bp or less, 20 bp or less, 10 bp or less.

In one aspect, the present invention provides for targeting one or more PAM sites and including between about 7-20 bp of homology regions of the neighbours of said PAM sites to design a method for generating deletions of polynucleotides without the use of donor DNA. It relates to a software algorithm that can identify PAM sites in the genome.

The method can be used for efficient removal of polynucleotide sequences in a designed manner. For example, when introducing a Cas9 expression cassette into the genomic DNA and after several rounds of modification mediated by the CRISPR/CAS9 system, the CAS9 expression cassette can be used for introduction of a gRNA targeting a site in the Cas9 expression cassette. wherein the Cas9 expression cassette is between two regions of homology as defined above, preferably 100-bp in length, more preferably 20-bp, 15-bp in length or shorter, truncating a large portion of the Cas9 open reading frame or the expression cassette.

The method can also be used for transient inactivation of genes. For example, by inserting a polynucleotide sequence into the ORF of a carotenoid synthase or saturated fatty acid synthase or polyunsaturated fatty acid synthase gene comprising two regions of homology at the 5′-end and the 3′-end, respectively. A gene (eg carotinoed synthase or saturated fatty acid synthase or polyunsaturated fatty acid synthase) may be rendered non-functional, wherein preferably said region of homology is 100-bp, more preferably 20 -bp, 15-bp long or shorter. The aforementioned synthase gene can be made functional again using the CRISPR-Cas9 system without donor DNA as described above.

In one embodiment, the expression control method comprises cleavage of one or both polynucleotide strands at at least one position of the target-polynucleotide followed by homologous recombination with an exogenous polynucleotide of the target-polynucleotide. include transformations. In such a case, the composition according to the first aspect of the present invention preferably further comprises such an exogenous polynucleotide. Such modifications may result in an insertion, deletion or substitution of at least one nucleotide in the target-polynucleotide, wherein the insertion or substitution nucleotide may or may not originate from the exogenous polynucleotide. In one embodiment, the exogenous polynucleotide comprises a region of homology with the target-polynucleotide. Preferably, the degree of homology between these regions of homology is such that it permits homologous recombination. Preferably said regions of homology have at least 60%, 70%, 80%, 90%, 99% or 100% sequence identity over the entire length of said regions of homology. Modifications may also be effected when the exogenous polynucleotide is a non-integrating entity; In this case, the target-polynucleotide is modified but the nucleotides of the exogenous polynucleotide are not introduced into the target-polynucleotide. Consequently, the resulting host is a non-recombinant host when introducing the Cas-protein according to the invention as a protein into the host cell. Thus, in the method according to this aspect of the invention, the host cell may be a recombinant host cell or a non-recombinant host cell. The exogenous polynucleotide may be any polynucleotide of interest, for example a polynucleotide encoding a compound of interest as defined herein, or a portion of such polynucleotide or a variant thereof.

In another aspect, the present invention provides a method for the preparation of a compound of interest, said method being in a host cell according to the third or fourth aspect of the invention or in the second aspect of the invention under conditions conducive to said compound of interest. culturing the host cell obtained by the method according to the present invention, or the host cell obtainable by the method according to the fourth aspect of the present invention, and optionally purifying or isolating said compound of interest.

In the context of all embodiments of the invention, the compound of interest may be any biological compound. The biological compound may be a biomass or a biopolymer or an antagonist. The biological compound may be encoded by a single polynucleotide or a series of polynucleotides constituting a biosynthetic or metabolic pathway or may be the product of a single polynucleotide or a direct result of the product of a series of polynucleotides, wherein the polynucleotide may be a gene and the series of polynucleotides may be a gene cluster. In all embodiments of the present invention, a single polynucleotide or series of polynucleotides encoding said compound of biological interest or a biosynthetic or metabolic pathway associated with said compound of biological interest is a preferred target for the compositions and methods according to the present invention. The biological compound may be native to the host cell or heterologous to the host cell.

The term "heterologous biological compound" as used herein refers to a biological compound that is not native to the cell; or as a native biological compound in which a structural modification has been made to alter the native biological compound.

The term "biopolymer" is defined herein as a chain of identical, similar or different subunits (monomers). The biopolymer may be any biopolymer. The biopolymer can be, for example, but not limited to, a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide.

The biopolymer may be a polypeptide. The polypeptide may be any polypeptide having a biological activity of interest. The term "polypeptide" is not meant herein to refer to an encoded product of a particular length, and thus includes peptides, oligopeptides, and proteins. The term polypeptide refers to a polymer of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The term also includes modified amino acid polymers; For example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein, the term "amino acid" includes natural and/or unnatural or synthetic amino acids, such as glycine and both D or L optical isomers, and amino acid analogs and peptidomites. Polypeptides further include native alleles and engineered modifications of the above-mentioned polypeptides and hybrid polypeptides. The polypeptide may be native or heterologous to the host cell. The polypeptide may be collagen or gelatin, or a variant or hybrid thereof. The polypeptide is an antibody or portion thereof, antigen, coagulation factor, enzyme, hormone or hormonal variant, receptor or portion thereof, regulatory protein, structural protein, reporter, or transport protein, protein involved in the secretion process, protein involved in the folding process , chephrons, peptide amino acid transporters, glycosylation factors, transcription factors, synthetic peptides or oligopeptides, intracellular proteins. The intracellular protein may be an enzyme such as a protease, ceramidase, epoxide hydrolase, aminopeptidase, acylase, aldolase, hydroxylase, aminopeptidase, lipase. The polypeptide may also be an extracellularly secreted enzyme. Such enzymes are oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, catalase, cellulase, chitinase, cutinase, deoxyribonuclease, dextranase, S It may belong to the group of therase. Said enzyme is a carbohydrase, for example a cellulase, for example an endoglucanase, β-glucanase, cellobiohydrolase or β-glucosidase, hemicellulase or pectinase, for example For xylanase, xylosidase, mannanase, galactanase, galactosidase, pectin methyl esterase, pectin lyase, pectate lyase, endo polygalacturonase, exopolygalacturonase rhamnogalacturonase, arabanase, arabinofuranosidase, arabinoxylan hydrolase, galacturonase, lyase, or starch degrading enzyme; hydrolases, isomerases, or ligases, phosphatases such as phytases, esterases such as lipases, proteases, oxidoreductases such as oxidases, transferases, or isomeras can be the best The enzyme may be phytase. The enzymes are aminopeptidase, asparaginase, amylase, maltogenic amylase, carbohydrase, carboxypeptidase, endo-protease, metallo-protease, serine-protease catalase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, haloperoxidase, Protein deaminase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinase, peroxidase, phospholipase, galactolipase, chlorophyllase, polyphenoloxidase, ribo nuclease, transglutaminase, or glucose oxidase, hexose oxidase, monooxygenase.

According to the present invention, the compound of interest may be a polypeptide or enzyme with improved secretion characteristics as described in WO2010/102982. According to the present invention, the compound of interest may be a fused, fused or hybrid polypeptide in which another polypeptide is fused to the N-terminus or C-terminus of said polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding one or more polypeptides to a nucleic acid sequence (or portion thereof) encoding another polypeptide.

Techniques for generating fusion polypeptides are known in the art and include ligating the coding sequences encoding the polypeptide so that they are in frame and expression of the fused polypeptide is under the control of the same promoter(s) and terminator. do. The hybrid polypeptide may comprise a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides, wherein one or more may be heterologous to the host cell. Examples of fusion polypeptides and signal sequence fusions are as described, for example, in WO2010/121933.

The biopolymer may be a polysaccharide. The polysaccharide can be any polysaccharide, including but not limited to mucopolysaccharides (eg heparin and hyaluronic acid) and nitrogen-containing polysaccharides (eg chitin). In a preferred option, the polysaccharide is hyaluronic acid.

Polynucleotides encoding said compound of interest or encoding a compound involved in the production of said compound of interest according to the present invention may be used in the synthesis of primary or secondary metabolites such as organic acids, carotenoids, (beta-lactam) antibiotics and vitamins. It can encode related enzymes. Such metabolites can be regarded as biological compounds according to the present invention.

The term "metabolite" includes both primary and secondary metabolites; The metabolite may be any metabolite. Preferred metabolites are unsaturated fats and lipids, including but not limited to the fatty acids docosahexaenoic acid, docosapentaenoic acid, erucic acid, paulinic acid, baxenoic acid (cis or trans), eicosapentaenoic acid, eicosa. Tetraenoic acid (n-3), arachidonic acid (n-6), oxadecapentaenoic acid, stearidonic acid, linolenic acid (n6 or n3), linoleic acid, oleic acid, palmitoleic acid, octacosaoctaenoic acid, and these lipids), saturated fats and lipids (including but not limited to fatty acids: caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, and lipids contained therein), sulfated lipids, sophorolipids, lactones, ceramides, phospholipids, fatty alcohols, fatty acid esters, fatty acid ethers, fatty acid aldehydes, sterols, carotenoids, oxylipins, resorbin , leukotrienes, prostaglandins, organic acids (including but not limited to acetic acid, butyric acid, citric acid, gluconic acid, adipic acid, fumaric acid, itaconic acid, malic acid, mevalonic acid and succinic acid), sugar alcohols and sugar acids.

A metabolite may be encoded by, for example, one or more genes in a biosynthetic or metabolic pathway. Primary metabolites are products of the cell's primary or general metabolism, which relate to energy metabolism, growth and structure. Secondary metabolites are products of secondary metabolism (see, eg, R. B. Herbert, The Biosynthesis of Secondary Metabolites, Chapman and Hall, New York, 1981).

The primary metabolite may be, but is not limited to, an amino acid, a fatty acid, a nucleoside, a nucleotide, a sugar, a triglyceride, or a vitamin.

The secondary metabolite may be, but is not limited to, an alkaloid, coumarin, flavonoid, polyketide, quinine, steroid, peptide or terpene. The secondary metabolite may be an antibiotic, an eating inhibitor, an attractant, a bactericide, a fungicide, a hormone, an insecticide, or a rodenticide.

The biological compound may also be the product of a selectable marker. A selectable marker is a product of a polynucleotide of interest for which the product provides biocide or viral resistance, heavy metal resistance, prototrophic auxotrophs, and the like. Selectable markers include, but are not limited to, nptII (neomycin phosphotransferase II), ALS (acetolactate synthase), bsd (blasticidin-S-deaminase), and Sh ble (pleomycin binding), as well as but also includes equivalents thereof.

According to the invention, the compound of interest is preferably a polypeptide as described in the list of compounds of interest.

According to another embodiment of the invention, the compound of interest is preferably a metabolite.

The host cell according to the invention is already capable of producing said compound of interest. The host cell may also be provided with a homologous or heterologous nucleic acid construct encoding a polypeptide, wherein the polypeptide may be the compound of interest or a polypeptide involved in the production of the compound of interest. One of ordinary skill in the art knows how to modify avian host cells to produce such compounds of interest.

general definition

Throughout this specification and the appended claims, the words "comprises", "contains" and "having" and variations such as "comprises", "comprising", "contains" and "comprising" are used throughout. should be interpreted comprehensively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically specified where the context permits.

The term “a” refers to one or more than one (ie, one or at least one) of the grammatical objects of the article herein. By way of example, “an element” may mean one element or more than one element.

The word "about" or "approximately" when used in conjunction with a numerical value (eg about 10) preferably means that the value can be greater than or less than 1% of the given value (10) above.

Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this specification belongs.

Preferred nucleotide analogs or equivalents include modified backbones. Examples of such main chains include morpholino main chain, carbamate main chain, siloxane main chain, sulfide, sulfoxide and sulfone main chain, formacetyl and thioformacetyl main chain, methyleneformacetyl main chain, riboacetyl main chain, alkene-containing main chain, sulfamate , sulfonate and sulfonamide backbones, methyleneimino and methylenehydrazino backbones, and amide backbones. Bonds between residues in the backbone do not contain phosphorus atoms, such as short chain alkyl or cycloalkyl internucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl internucleoside bonds, or one or more short chain heteroatoms. Or it is more preferably formed by a heterocyclic internucleoside bond.

Preferred nucleotide analogs or equivalents include peptide nucleic acids (PNAs) having a modified polyamide backbone (Nielsen, et al . (1991) Science 254, 1497-1500). PNA-based molecules are concerned with base pair recognition. It is a true analogue of a DNA molecule.The main chain of the PNA is composed of N-(2-aminoethyl)-glycine units linked by peptide bonds, wherein the nucleobase is linked to the main chain by a methylene carbonyl bond. Another backbone comprises a 1-carbon extended pyrrolidine PNA monomer (Govindaraju and Kumar (2005) Chem. Commun, 495-497). Since the backbone of the PNA molecule does not contain a charged phosphate group, the PNA -RNA hybrids are usually more stable than RNA-RNA or RNA-DNA hybrids, respectively (Egholm et al . (1993) Nature 365, 566-568).

A more preferred backbone comprises a morpholino nucleotide analog or equivalent, wherein a ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring. Most preferred nucleotide analogues or equivalents include phosphorodiamidate morpholino oligomers (PMOs), wherein the ribose or deoxyribose sugar is replaced by a 6-membered morpholino ring and adjacent morpholino rings Anionic phosphodiester bonds between the rings are replaced by non-ionic phosphorodiamidate bonds.

Further preferred nucleotide analogs or equivalents comprise substitution of at least one of the non-bridging oxygens in the phosphodiester linkage. This modification slightly destabilizes the base-pairing but adds considerable resistance to nuclease degradation. Preferred nucleotide analogs or equivalents are phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphorotriesters, aminoalkylphosphotriesters, H-phosphonates, 3′-alkylene phosphonates, 5 methyl and other alkyl phosphonates, including '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidates and aminoalkylphosphoamidates, thionophos sporamidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates or boranophosphates.

More preferred nucleotide analogs or equivalents include one or more sugar moieties mono- or disubstituted at the 2', 3' and/or 5' positions, for example -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, aryl, or aralkyl, which may be interrupted by one or more heteroatoms; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; O-, S-, or N-allyl; O-alkyl-O-alkyl, -methoxy, -aminopropoxy; aminooxy, methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy. The sugar moiety may be pyranose or a derivative thereof, or deoxypyranose or a derivative thereof, preferably ribose or a derivative thereof, or deoxyribose or a derivative thereof. Preferred such derivatized sugar moieties include locked nucleic acids (LNAs), wherein the 2'-carbon atom is bonded to the 3' or 4' carbon atom of the sugar ring to form a bicyclic sugar moiety. Preferred LNAs include 2'-0,4'-C-ethylene-crosslinked nucleic acids (Morita et al . 2001. Nucleic Acid Res Supplement No. 1: 241-242). These substitutions render the nucleotide analog or equivalent resistant to RNase H and nuclease and increase affinity for the target.

"Sequence identity" or "identity" of an amino acid- or nucleic acid-sequence in the context of the present invention means two or more amino acids (peptides, polypeptides, or proteins), as determined by comparison between the sequences herein. It is defined as a sequence or relationship between two or more nucleic acid (nucleotide, oligonucleotide, polynucleotide) sequences. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleotide sequences, as the case may be, as measured by the agreement between strings of sequences. Within the present invention, sequence identity with a particular sequence preferably means sequence identity over the entire length of said particular polypeptide or polynucleotide sequence.

"Similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one peptide or polypeptide and its conserved amino acid substitutions to the sequence of a second peptide or polypeptide. In a preferred embodiment, identity or similarity is assessed over the entire sequence (SEQ ID NO:) as identified herein. “Identity” and “similarity” are defined by known methods, including, but not limited to, Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988).

Preferred methods for determining identity are designed to provide maximum agreement between the sequences tested. Methods for measuring concordance and similarity are systematically documented in publicly available computer programs. Preferred computer program methods for determining identity and similarity between two sequences include, for example, the GCG program package (Devereux, J., et al ., Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, SF et al ., J. Mol. Biol. 215:403-410 (1990)). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al ., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al . , J. Mol. Biol. 215:403-410 (1990)). The well-known Smith Waterman algorithm can also be used to measure concordance.

Preferred parameters for polypeptide sequence comparison are: Algorithm: Needleman and Wunsch (J. Mol. Biol. 48:443-453 (1970)); Comparison matrix: BLOSSUM62 (Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992)); Break Penalty: 12; and Break Length Penalties: 4. Programs useful for these parameters are publicly available as the "Ogap" program from the Genetics Computer Group of Madison, Wisconsin. The parameters mentioned above are the default parameters for amino acid comparison (with no penalty for end breaks).

Preferred parameters for nucleic acid comparison are: Algorithm: Needleman and Preparative (J. Mol. Biol. 48:443-453 (1970)); Comparison matrix: agreement = +10, mismatch = 0; Break Penalty: 50; Break Length Penalties: 3. Available as a break program from Genetics Computer Group, Madison, Wisconsin, USA. Default parameters for nucleic acid comparison are provided above.

Optionally, in determining the degree of amino acid similarity, the skilled person may also consider so-called "conservative" amino acid substitutions, as will be clear to the skilled artisan. Conservative amino acid substitutions refer to compatibility of residues with similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine and isoleucine; A group of amino acids having aliphatic-hydroxyl side chains are serine and threonine; A group of amino acids having amide-containing side chains are asparagine and glutamine; A group of amino acids having aromatic side chains is phenylalanine, tyrosine and tryptophan; A group of amino acids having basic side chains are lysine, arginine and histidine; A group of amino acids having sulfur-containing side chains are cysteine and methionine. Preferred conservative amino acid substituents are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted instead. Preferably, said amino acid change is conservative. Preferred conservative substitutions for each natural amino acid are: Ala to ser; Arg to lys; Asn to gln or his; Asp to Glu; Cys to ser or ala; Gln to asn; Glu to asp; Gly to pro; His to asn or gln; Ile to leu or val; Leu to ile or val; Lys to arg; with gln or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and from Val to ile or leu.

A polynucleotide according to the present invention is represented by a nucleotide sequence. A polypeptide according to the present invention is represented by an amino acid sequence. Nucleic acid constructs according to the present invention are defined as polynucleotides isolated from native genes or modified to contain segments of polynucleotides that are joined or juxtaposed in a manner not otherwise present in nature. Optionally, the polynucleotides present in the nucleic acid construct according to the invention are operably linked to one or more regulatory sequences, said sequences directing the production or expression of the encoded product in a host cell or cell-free system.

Sequence information as provided herein should not be construed narrowly as requiring the inclusion of misidentified bases. The skilled person can identify such misidentified bases and knows how to correct such errors.

All embodiments of the present invention, namely a composition according to the invention, a method for regulating expression, a host cell comprising the composition according to the invention, a method for producing a host cell according to the invention, a host cell according to the invention, and the present invention The method for producing a compound of interest according to the present invention preferably refers to a host cell rather than a cell-free in vitro system; That is, the CRISPR-Cas system according to the present invention is preferably a host cell system rather than a cell-free in vitro system.

All embodiments of the invention, for example a composition according to the invention, a method for regulating expression, a host cell comprising the composition according to the invention, a method for producing a host cell according to the invention, a host cell according to the invention, and In the method for producing the compound of interest according to the present invention, the host cell may be a haploid, diploid or diploid host cell.

The host cell according to the present invention is a labyrinthulomycetes host cell, preferably of the order Traustochytrales, more preferably of the family Traustochytriaceae, more preferably of Aurantiochytrium, Oblongikit a member of the genus selected from the group consisting of lyum, Schizochytrium, Thraustochytrium and Ulkenia, even more preferably Schizochytrium sp. ATCC# 20888.

Preferably a modification in the genome is understood herein as one or more modifications. Preferably, the modification in the genome of the host cell according to the invention comprises:

a) subjecting the parental host cell to recombinant genetic engineering techniques and/or

b) subjecting (classical) mutagenesis to the parental host cell;

c) adding an inhibitory compound or composition to the parental host cell

can be performed by

A modification of the genome of a host cell is defined herein as any event that results in a change in the polynucleotide sequence in the genome of said host cell.

Preferably, the host cell according to the invention preferably exhibits modifications in its genome that, when assayed under the same conditions, do not produce or reduce unnecessary compounds as defined herein when compared to an unmodified parental host cell. have

Modifications can be introduced by any means known to those skilled in the art, for example by classical strain improvement, random mutagenesis followed by selection. Modifications can also be introduced by site-directed mutagenesis.

Modifications may be effected by introduction (insertion), substitution (replacement), or removal (deletion) of one or more nucleotides in the polynucleotide sequence. Whole or partial deletions of polynucleotides encoding unnecessary compounds, such as polypeptides, can be achieved. An unnecessary compound may be any unnecessary compound listed elsewhere herein; They may also be proteins and/or enzymes in the biological synthesis pathway of undesirable compounds such as metabolites. Alternatively, the polynucleotide encoding the unnecessary compound may be partially or completely replaced with a polynucleotide sequence that does not encode the unnecessary compound or encodes a partially or completely inactive form of the unnecessary compound. In another alternative, one or more nucleotides may be inserted into the polynucleotide encoding the undesired compound to result in disruption of the polynucleotide and consequently partial or complete inactivation of the undesired compound encoded by the disrupted polynucleotide. can

In one embodiment, the mutant microbial host cell according to the invention comprises

a) a complete or partial deletion of a polynucleotide encoding an unnecessary compound;

b) complete or partial replacement of the polynucleotide encoding the unnecessary compound by a polynucleotide sequence that does not encode the unnecessary compound or which encodes a partially or completely inactive form of the unnecessary compound;

c) disruption of said polynucleotide by insertion of one or more nucleotides in a polynucleotide sequence encoding an undesired compound and consequent partial or complete inactivation of said undesired compound by said disrupted polynucleotide

a modification in its genome selected from

Such modifications may be in, for example, coding sequences or regulatory elements necessary for the transcription or translation of the unnecessary compound. For example, nucleotides may be inserted or removed to create a frame-shift or introduction of a stop codon, removal of an initiation codon, or a change in the open reading frame of the coding sequence. Modification of the coding sequence or its regulatory elements can be performed by site-directed or random mutagenesis, DNA shuffling methods, DNA assembly methods, gene synthesis (see, e.g., Young and Dong (2004), Nucleic Acids Research 32(7) electronic access at nar.oupjournals.org/cgi/reprint/32/7/e59 or Gupta et al . (1968), Proc. Natl. Acad. Sci USA, 60: 1338-1344]; Scarpulla et al . (1982), Anal. Biochem. 121: 356-365; Stemmer et al . (1995), Gene 164: 49-53), or by PCR generated mutagenesis according to methods known in the art. Examples of random mutagenesis procedures are well known in the art, eg chemical (eg NTG) mutagenesis or physical (eg UV) mutagenesis. Examples of site-directed mutagenesis procedures include the QuickChange(TM) site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla, CA), The Altered Sites ( 'The Altered Sites® II in vitro mutagenesis systems (Promega Corporation) or Ho et al ., "Site-directed mutagenesis by overlap extension using the polymerase chain reaction", Gene, 1989 Apr 15, 77(1):51-9, or as described in Molecular Biology: Current Innovations and Future Trends., Eds. AM Griffin and HG Griffin. ISBN 1-898486-01-8; 1995 Horizon Scientific Press, PO Box 1, Wymondham, Norfolk, UK by overlap extension using PCR.

Preferred methods of modification are based on recombinant genetic engineering techniques, for example partial or complete gene replacement or partial or complete gene deletion.

For example, in the case of replacement of a polynucleotide, nucleic acid construct or expression cassette, a suitable DNA sequence can be introduced at the target locus to be replaced. Suitable DNA sequences are preferably present on a cloning vector. Preferred integrative cloning vectors include DNA fragments that are homologous to polynucleotides and/or homologous to polynucleotides flanking the locus to be replaced in order to target integration of the cloning vector to a given locus. has To facilitate targeted integration, the cloning vector is preferably linearized prior to transformation of the cells. Preferably, the linearization is carried out so that at least one, preferably either end, of the cloning vector is flanking a sequence homologous to the DNA sequence (or flanking sequence) to be replaced. This process is called homologous recombination and the technique can also be used to achieve (partial) gene deletion.

For example, a polynucleotide corresponding to an endogenous polynucleotide can be replaced by a defective polynucleotide, ie a polynucleotide that fails to produce a (fully functional) polypeptide. By homologous recombination, the defective polynucleotide replaces the endogenous polynucleotide. The defective polynucleotide may also preferably encode a marker, and the marker may be used for selection of transformants in which the nucleic acid sequence is modified.

Modifications that do not produce or reduce the production of undesired compounds can be obtained by different methods, for example by antibodies or chemical inhibitors or protein inhibitors or physical inhibitors against such undesired compounds (see [ Tour O. et al ., "Genetically targeted chromophore-assisted light inactivation", (2003) Nat. Biotech]). On the one hand, or in combination with the aforementioned techniques, reduced or no production of unnecessary compounds can also be achieved, for example, by UV or chemical mutagenesis (Lian et al ., "Increase of docosahexaenoic acid production by Schizochytrium sp. through mutagenesis and enzyme assay" (2010) Appl Biochem Biotechnol 162(4):935-941]) or the use of inhibitors that inhibit the enzymatic activity of unwanted polypeptides as described herein (e.g. β-glucosida It can be obtained by nojirimycin (Ren et al ., "Effect of biotin and cerulenin addition on DHA production by Schizochytrium sp." (2012-01) Chinese J Bioprocess Engineering), which functions as an agent inhibitor.

In one embodiment of the invention, the modification in the genome of the host cell according to the invention is a modification at at least one position of the polynucleotide encoding an unnecessary compound.

Defects in a cell in the production of a compound, e.g., an unwanted compound, e.g., an unwanted polypeptide and/or enzyme, are defined herein, preferably in the genome, in an unmodified parental host cell when the cell is analyzed under identical conditions. In comparison, a) less or substantially no production of said undesired compound and/or b) said undesired compound having reduced activity or reduced specific activity, or an undesired compound having no activity or no specific activity, and a mutant microbial host cell that has been modified to produce a phenotypic characteristic that results in a combination of one or more of the above possibilities.

Preferably, the modified host cell according to the present invention has less than 1% of said undesired compound, at least 5% less than said undesired compound, at least 10% less than said undesired compound compared to a parental host cell that is not modified and measured under the same conditions. compound, at least less than 20% of the undesired compound, at least less than 30% of the undesired compound, at least less than 40% of the undesired compound, at least less than 50% of the undesired compound, at least less than 60% of the undesired compound, at least 70% less than the undesired compound, at least less than 80% of the undesired compound, at least less than 90% of the undesired compound, at least less than 91% of the undesired compound, at least less than 92% of the undesired compound, at least less than 93% of the undesired compound , at least less than 94% of the undesired compound, at least less than 95% of the undesired compound, at least less than 96% of the undesired compound, at least less than 97% of the undesired compound, at least less than 98% of the undesired compound, at least less than 99% of, at least 99.9% of the unwanted compounds, or most preferably less than 100% of the unwanted compounds.

Sequence information as provided herein should not be construed narrowly as requiring the inclusion of misidentified bases. The skilled person can identify such misidentified bases and knows how to correct such errors.

The disclosure of each reference presented herein is incorporated herein by reference in its entirety.

The invention is further illustrated by the following examples:

Example

Example 1

Design and formation of Cas9 vectors for transformation

The Streptococcus pyogenes MGAS5005 Cas9 sequence was codon-optimized for expression in Schizochytrium. The basic Cas9 peptide sequence used was essentially identical to that used in Jinek et al., 2013, without the described HA-tag or GFP fusion (see below). After synthesizing the Cas9 (DNA2.0, Newark, CA), it was cloned into the pCL122 vector containing the paromomycin selection cassette to generate a vector designated as pCL122-Cas9 (SEQ ID NO: ). OrfA/Pfa1 flanking was synthesized and cloned into pCL121 (with Zeocin selection cassette) (Genscript USA, Piscataway, NJ) and the final vector was designated pYB31 (SEQ ID NO: 2); See, for example, US Pat. No. 8,940,884. The Cas9 gene was combined with BamHI and Nde I restriction sites and enzymes (New England Biolabs, Ipswich, MA) ( FIG. 3 ) and Rapid DNA Ligation kit (Rosche ( Roche), Ritchie-Rotkreuz, Switzerland) was subcloned from the pCL122-Cas9 vector into the pYB31 vector via cleavage and ligation. NEB10β chemically soluble cells were transformed (New England Biolabs) and the resulting colonies were harvested with primers 121 Tub seq F (SEQ ID NO: 13) and pYB32/3C R1 (SEQ ID NO: 14) (Table 2) and 5% DMSO (v:v). ) and selected colonies were selected by colony PCR using GoTaq Green Master Mix (Promega, Chicago, IL) and the following cycling conditions were applied to the reaction: 95° C. 5 min, (95 ℃ 30 sec, 59 ℃ 30 sec, 72 ℃ 1 min) x 35 cycles, 72 ℃ 5 min (Fig. 4). Plasmids were isolated from positive colonies by PCR and sequenced, and one resulting vector was designated pYB32 (SEQ ID NO: 3).

Primer name SEQ ID NO: Primer sequence, 5'→ 3' 121 Tub seq F 13 GGATCTCATGCTGGAGTTCTTC pYB32/3C R1 14 GTACTTCTCGTGGTAGGCAACC

As mentioned previously, other studies have indicated that the level of Cas9 expression is important for optimization of transformant viability and nuclease activity. In the pYB32 plasmid, the Cas9 gene is under the control of the alpha-tubulin promoter, which is a medium-strength promoter. A weak promoter from the carotene synthase (CS) gene was also selected for testing and was subjected to InFusion PCR cloning (Clontech/Takara Bio USA Inc., Mountain View, CA, USA). ) into pYB31. pYB31 the plasmid in preparation for infusion cloned was digested with Kpn I and Nde I enzyme (New England Bio Labs). Plasmid pTH043 with CS promoter, 5% DMSO (v:v), KOD HotStart Master Mix (EMD Millipore, Billerica, MA) and CS promoter used as template together with CS pro KpnI IF F1 (SEQ ID NO: 15) and CS pro BamHI IF R1 primers (SEQ ID NO: 16) (Table 3). Reaction cycle conditions were as follows: 95 °C 2 min, (95 °C 20 sec, 66 °C 10 sec, 70 °C 20 sec) x 35 cycles, 70 °C 2 min. Cas9, with 5% DMSO (v:v), KOD hotstart master mix, and pCL122-Cas9 used as template, CS pro BamHI IF F2 (SEQ ID NO: 17) and CS pro NdeI IF R2 (SEQ ID NO: 18) Amplified with primers (Table 3). Reaction cycle conditions were as follows: 95 °C 2 min, (95 °C 20 sec, 65 °C 10 sec, 70 °C 1 min 45 sec) x 35 cycles, 70 °C 2 min.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' CS pro Kpn IF F1 15 GTCTGAATTCCCGGGGTACCGAGCGGGCGATTCCACCGTC CS pro BamH IF R1 16 GTACTTCTTATCCATGGATCCCTCGGTCTCCGAGCGAGCGAG CS pro BamH IF F2 17 TCGCTCGCTCGGAGACCGAGGGATCCATGGATAAGAAGTAC CS pro Nde IF R2 18 GATTCACTAGTTTAGATCATATGTTAGACCTTGCGCTTCTTCTTAGGGTCC

PCR products were run on 1% agarose gel (Lonza, Basel, Switzerland), bands of the expected size were excised and gel purified using the QIAquick gel extraction kit (Qiagen, Hilden, Germany). (FIG. 3). Following the manufacturer's protocol for infusion cloning, the Cas9 PCR fragment, CS promoter PCR fragment and linearized pYB31 fragment were ligated, NEB10β chemically soluble cells were transformed, and the resulting colonies were selected by colony PCR as described above. (Fig. 4) (with an extension time of 1 min 30 s at 72 °C). After sequence confirmation, one of the production vectors containing Cas9 operably linked to the CS promoter was designated pYB33 (SEQ ID NO: 4).

Cloning of pYB32 and pYB33 was performed through a combination of cleavage, ligation and infusion PCR cloning. As shown in FIG. 3 , all fragments were generated and had bands of the expected size after column purification. The digested plasmid and PCR amplified fragments were run on 1% agarose gel. Fragments of the expected size were observed in all lanes as follows: pYB31-BamHI+NdeI=838 bp+6555 bp, pYB31-KpnI+NdeI=1289bp+6104bp, Cas9-BamHI+NdeI=4157bp+5773bp, CS PCR fragment =1046 bp, Cas9 PCR fragment=4189 bp. The molecular weight marker used for this gel and all subsequent gels was DNA Quanti-Ladder (Origene, Rockville, MD), and the fragment size is shown in the right panel of FIG. 3 .

Colonies generated from pYB32 and pYB33 bacterial transformation were analyzed by colony PCR, and colonies having an amplification product of the expected size are indicated in bold in FIG. 4 . These colonies are pYB32-2, -4, -9, -14, -15, -24, -25, -28, and pYB33-16 and pYB33D-1, -14. pYB32-2 and pYB33-16 were among those identified to have the correct sequence and were used for subsequent studies. For the colony PCR results from the cloning of pYB32 and pYB33, the expected amplification product sizes were: pYB32=1028 bp, pYB33=1584 bp.

Example 2

Transformation and selection of Cas9 transformants

Transformation of a wild-type strain of Schizochytrium sp., ATCC 20888 with pYB32 and pYB33 using the particle bombardment method and gene gun equipment (Bio-Rad, Raleigh, NC) as described below was used for Briefly, 20888 was grown in 25 ml of M50-20 medium (see, eg, US Pat. No. 8,003,772) in a 250 ml flat-bottomed Erlenmeyer flask at 27° C. at 200 rpm with shaking overnight. Subsequently, the culture was diluted 1/100 in 50 ml of M2B medium (see, for example, US Pat. No. 8,003,772) in a 250 ml shake flask and grown overnight under the same conditions. When the Schizochytrium culture was in the initial log phase (0.6-2 OD units/ml), the culture was harvested by centrifugation at 3,220×g for 10 minutes. The supernatant is decanted, the pellet is resuspended in M2B to a final concentration of 20 OD units/ml and 100 μl of the resulting cell suspension is annularized onto approximately 1/3 of a non-selective M2B agar plate (approximately 4 cm diameter). smeared with movement. Plasmids pYB32 and pYB33 were digested with Swa I at 25° C. overnight and purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany). Then, 5 μg of each purified plasmid was _{mixed with 50 μl of 2.5 M CaCl 2} , 20 μl of 0.1 M spermidine and 50 μl of the prepared M10 tungsten beads (Bio-Rad, according to the manufacturer's protocol), and 1 The beads were allowed to settle by vortexing for minutes and then incubating for 10 minutes at room temperature. The DNA-coated beads were washed once with 250 μl of 100% ethanol, and then the beads were resuspended in 60 μl of 100% ethanol. Each prepared macrocarrier (according to the manufacturer's protocol for macrocarrier assembly preparation) had 10 μl of coated beads in ethanol spotted on the center of a macrocarrier disc and the ethanol was dried. The bursting disk holder had a 1,100 psi-designated bursting disk placed inside after short sterilization in 70% isopropanol, the assembled macrocarrier was installed on the gene gun platform in the top shelf position, and an M2B agar plate with cell patches of Schizochytrium was installed. Placed cell side up on the third shelf from the top. Once the vacuum reached about 27 psi inside the gene gun chamber, helium was fired until the rupture disk broke, the helium flow was shut off, the chamber vented to atmosphere, and the shock plate was removed from the chamber. The above bombardment procedure was repeated for all samples and controls, and the pYB32 bombarded Schizochytrium species 20888 was designated T188 and the pYB33 bombarded Schizochytrium culture was designated T189. The shock plate was incubated at 27° C. for 4 hours, after which time the cells were washed from the plate with about 1 ml of M2B and 0.4% random-methylated β-cyclodextrin (CTD Holdings, Inc.) , High Springs, FL, USA) in 0.5 mM DHA (Nu-Chek Prep, Waterville, Minn.) and 50 μg/ml Zeocin (ThermoFisher Scientific, Waltham, Mass.) material) was equally distributed among 4 M2B agar plates containing Cells were plated with 3 mm sterile glass beads, beads removed, plates were wrapped, and incubated at 27° C. for about 7-10 days. When the size of the colonies reached 2-4 millimeters, each colony was treated with or without DHA (which was complexed with randomly methylated β-cyclodextrin as described above) containing 100 μg/ml zeocin. The auxotrophs induced by the disruption of the OrfA/Pfa1 gene were selected by repeating over M2B agar plates.

Colonies found to be auxotrophic for DHA are picked and inoculated into 50 ml M50-20 supplemented with 500 μl of 40% β-cyclodextrin and 50 mM DHA solution in 250 ml flat bottom Erlenmeyer flasks, 27° C. shaker at 200 rpm for 48 h. After 48 h of incubation, 2 ml of the culture was collected by centrifugation at 5,000×g for 10 min, the supernatant decanted and the pellet used for genomic DNA isolation following modified phenol-chloroform extraction. Genomic DNA was extracted and used as PCR template with GoTaq Green Mastermix (Promega, Durham, NC) and primers, GoTaq Green Master Mix and cycling conditions as described for colony PCR selection for pYB32 and pYB33 were applied. was used to confirm the presence of the zeocin cassette and Cas9 gene (FIG. 5). The disruption of the OrfA/Pfa1 gene in the T188 and T189 transformants was confirmed by PCR. Specifically, the 5' flanking region was prepared using O A1-KO F (SEQ ID NO: 19) and pYB32/3 SV40 R1 (SEQ ID NO: 20) primers (Table 4), GoTaq Green Mastermix, 5% DMSO (v: v) and T188/T189 gDNA as template, and cycled conditions were as follows: 95 °C 2 min, (95 °C 30 sec, 60 °C 30 sec, 72 °C 2 min 15 sec) x 35 cycles, 72 C 5 min. Furthermore, the 3' flanking region was prepared with O A1-KO R (SEQ ID NO: 21) and pYB32/2 CF1 (SEQ ID NO: 22) primers (Table 4), GoTaq Green Mastermix, 5% DMSO (v: v) and It was interrogated by PCR with T188/T189 gDNA as a template, and the cycling conditions were as follows: 95 °C 2 min, (95 °C 30 sec, 59 °C 30 sec, 72 °C 2 min) x 35 cycles, 72 °C 5 min (Fig. 6).

Primer name SEQ ID NO: Primer sequence, 5'→ 3' O A1-KO F 19 CCAAGTTCGCCAAGGCTTC pYB32/3 SV40 R1 20 GTGGAATCGAAATCTCGTAGCAC O A1-EN R 21 GCTGTTGCAACTTTGCTCCAC pYB32/3C F1 22 GTTAAGAAGACCGAGGTCCAGAC

Positive cultures by PCR for Cas9 gene integration and disruption in OrfA/Pfa1 were inoculated into 25 ml of M50-20 supplemented with randomly methylated β-cyclodextrin and DHA and for 24 h as previously described. proliferated. The OD600 of the above cultures was measured, and 2 OD units of each culture were inoculated into 50 ml of SPFM, pH 6.75 supplemented with randomly methylated β-cyclodextrin and DHA in a 250 ml shaken Erlenmeyer flask, pH 6.75 and shaker at 27° C. After growth for 48 hours at 200 rpm, 5% glycerol (v:v) was added for cryopreservation. Two clones, one from each transgenic group, were selected for further studies - T188-1-20 and T189-1-20.

Wild-type Schizochytrium sp. 20888 was transformed with pYB32 and pYB33 by shock to generate DHA auxotrophs during 20888 due to insertion of Cas9 at the OrfA/PFA1 locus of polyunsaturated fatty acid (PUFA) synthase. Colonies were counted and padded repeatedly on selectivity plates with or without DHA. Colonies auxotrophic for DHA were randomly selected from both transgenic groups and used for further characterization.

As shown in Table 5 below, the transformation efficiency with the pYB33 plasmid was lower than that of the pYB32 plasmid, and a similar tendency was observed for the fraction of the found auxotrophic colonies.

transformation Total colonies per 5 μg DNA auxotrophic colonies knockout% T188: pYB32—Tub pro-Cas9 160 80 50% T189: pYB33-CS pro-Cas9 96 37 38.5%

T188 and T189 transformants were interrogated for the presence of a promoter bound to Cas9 and the region upstream of the Cas9 gene. For the T188 clone, the expected amplification product size was 1028 bp and for T189 was 1584 bp. As shown in Figure 5, all but clone T189-1-30 produced the expected amplification product size and these were used for further testing.

Integration of Cas9 in the OrfA/Pfa1 locus was confirmed by PCR, and both the 5' and 3' flanking regions were amplified with a combination of a wild-type-specific outer primer and a Cas9-specific inner primer, so that the amplification product was only integrated It could only be achieved if it occurred ( FIG. 6 ). The expected amplification product size for the 5' side of the Cas9 integration site was 2229 bp and for the 3' side it was 1973 bp. All of the tested strains were positive for integration of Cas9 at the OrfA/Pfa1 locus.

Example 3

Design and formation of gRNA vectors

All of the guide RNA (gRNA) cassettes were designed to be expressed by the elongation factor 1α (EF-1α) promoter derived from Schizochytrium. In each case, the gRNA sequence is flanked by two ribozyme sequences, a hemmerhead and HDV (see Gao Y and Zhao Y "Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo"). for CRISPR-mediated genome editing" J Integr Plant Biol. 56(4):343-349 (2014)]). Four target sequences containing the “NGG” protospacer-adjacent motif were identified within the carotene synthase gene and 20 bp immediately upstream of each was selected as the target sequence. For both ribozymes, one cassette containing the target sequence and guide RNA was synthesized and cloned into pCL122 vector using Bgl II and Nde I sites (DNA2.0) to pCL401-precursor plasmid for further cloning (SEQ ID NO: A vector denoted by 7) was generated. To prepare the final gRNA cassette vector, plasmid pSP73 (Promega) was digested with Nde I and HPa I and the resulting larger fragment was gel purified. A fragment of Schizochytrium fatty acid synthase fragment (FAS) was prepared with 5' FAS PmeNde (SEQ ID NO: 23) and 3' FAS PmeHpa (SEQ ID NO: 24) primers (Table 6), KOD Hot Start Mastermix, and 5% DMSO Together, from Schizochytrium sp. 20888 genomic DNA was amplified by PCR, using the following cycling conditions: 95 °C 2 min, (95 °C 20 sec, 62 °C 10 sec, 70 °C 51 sec) x 40 cycles, 70 °C 5 min (Figure 7). The resulting fragment was digested with Hpa I and Nde I restriction enzymes and purified.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' 5′ FAS PmeNde 23 TAGCATATGTTTAAACTCGCGGCGTCTTTCGC 3′ FAS PmeHpa 24 AGTTAACGTTTAAACAGAGGAGGTGGCTGGC

Appropriate purified and digested pSP73 and FAS fragments were ligated using a rapid DNA ligation kit (Roche) and transformed into NEB10β cells (New England Biolabs) to generate vector pCL399 (SEQ ID NO: 5). Next, the pCL399 vector was digested with Nde I endonuclease alone, the end was truncated with mung bean nuclease (New England Biolabs), and the vector was re-ligated with a rapid DNA ligation kit to remove the Nde I site. The resulting vector was designated as pCL400 (SEQ ID NO: 6). The paromomycin expression cassette and gRNA cassette were amplified by infusion PCR cloning, using pCL401 (SEQ ID NO: 7) as a template to be inserted into pCL400 pre-cleaved with Xho I, to generate vector pCL402 (SEQ ID NO: 8). Briefly, pCL402 IF F (SEQ ID NO: 25) and PCL402 IF R (SEQ ID NO: 26) primers (Table 7), 5% DMSO (v: v), KOD Hot Start Mastermix, pCL401 plasmid template were used and the following cycling conditions were used. was used to amplify the desired fragment from pCL401: 95 °C 2 min, (95 °C 20 sec, 60 °C 10 sec, 70 °C 1 min 25 sec) x 35 cycles, 70 °C 5 min (FIG. 8). The resulting vector was designated pCL402.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pCL402 IF F 25 GAGGCGCTGACCGCCGGCCAAGCTTCCAATTTTAGGCC pCL402 IF R 26 GCAGGTGCCGAGTTTCTCGAGAAGAATCTGAACTCACGTC

Four genomic carotene synthase target sequences were synthesized with Bgl II and Nde I flanking regions (Eurofins, Mybain, NC). These fragments were designated gRNA3 CS1, CS2, CS3 and CS4. All four fragments and vector pCL0402 were digested with Bgl II and Nde I. All suitable fragments were gel or column purified and then ligated together using a rapid DNA ligation kit (Roche) and the resulting vectors were pYB36 (gRNA3 CS1; SEQ ID NO: 9), pYB37 (gRNA3 CS2; SEQ ID NO: 10), pYB38 ( gRNA3 CS3; SEQ ID NO: 11), and pYB39 (gRNA3 CS4; SEQ ID NO: 12).

To remove gene editing components from Schizochytrium, both Cas9 and guide RNA cassettes (“knockouts”) were designed to disrupt the gene, thereby inducing auxotrophs. The auxotrophic mutation by Cas9 selection was for DHA, whereas the auxotroph induced for gRNA insertion was for palmitic acid due to disruption of the fatty acid synthase locus (FAS). A portion of the FAS gene was amplified from Schizochytrium sp. 20888 genomic DNA and then run on a 1% agarose gel ( FIG. 8 ). The expected size of the amplification product was 2530 bp. Two samples were prepared and loaded on the gel, the bands of the expected size were the main product of the PCR, but other smaller size bands were present, which could make the PCR conditions less ideal and may need to be optimized later. imply that there is The 2.5 kbp band was excised, gel purified and used for cloning vector pCL399.

PCR was set up for cloning of paromomycin and gRNA cassettes into the FAS locus in vector pCL400. The expected size of the amplification product was 3376 bp, which was the main band on the gel (FIG. 8). This fragment was then cloned into pCL400 to generate pCL402.

Example 4

Transformation and selection of gRNA constructs

T188-1-20 and T189-1-20 strains (both were confirmed by PCR to contain Cas9 expression cassettes under the control of different promoters, alpha-tubulin and Cs, respectively, and were inserted into the OrfA/PFA1 locus of PUFA synthase ) were inoculated into flat-bottom Erlenmeyer flasks containing 25 ml of M50-20 supplemented with 0.4% random methylated β-cyclodextrin with 0.5 mM DNA and grown overnight at 27°C, 200 rpm. Both strains were diluted 1/50 in shake flasks containing 50 ml of M2B supplemented with β-cyclodextrin and DHA as described above and grown overnight at 27°C. T188 and T189 cultures were harvested the next day as described above and preparations for shock were performed as described above. The pYB36-39 plasmids were digested prior to bombardment with Pme I, column purified, and all four digested plasmids were used to transform the two strains to produce a transformation designated T202-209 (each pYB36-39, respectively). T188 with pYB36-39, T189 with pYB36-39). The resulting transformants were harvested 4 hours after recovery from shock with 0.5 mM DHA, 0.5 mM C16:0 (palmitic acid, Sigma-Aldrich, St. Louis, MO) and 50 μg/ml Paromo. Plates were plated on M2B plates containing 0.4% β-cyclodextrin along with mycin. The plate was wrapped and incubated at 27 °C for 7 to 10 days. Once 2-4 mm in diameter, colonies were repeatedly overlaid on M2B+0.4% β-cyclodextrin+0.5 mM DHA+0.5 μg/ml paromomycin in the presence or absence of 0.5 mM palmitic acid to the FAS locus. A auxotrophic mutation for palmitic acid produced as a result of gRNA cassette insertion was confirmed. 10 colonies were picked from each of the 8 transformations found to be auxotrophic for both DHA and palmitic acid, and 25 ml of M50- supplemented with 0.4% β-cyclodextrin, 0.5 mM DHA and 0.5 mM palmitic acid A flat-bottom Erlenmeyer flask containing 20 was inoculated, and the cultures were grown at 27° C., 200 rpm for 48 hours, at which time 2 ml of each culture was collected for genomic DNA preparation. After extraction of genomic DNA with phenol:chloroform, PCR was performed to amplify the carotene synthase locus containing the regions targeted to the gRNA cassette. gDNA from transformants selected from T202, 203, 204, 207, 208 was prepared using the following cycling conditions with pYB36 CS1 F (SEQ ID NO: 27) and pYB36 CS3 R (SEQ ID NO: 29) primers (Table 8), 5% Amplified by PCR using DMSO (v:v), KOD hot start mastermix, each gDNA as template: 95 °C 2 min, (95 °C 20 sec, 61 °C 10 sec, 70 °C 21 sec) x 35 Cycle, 70 °C 5 min (Figure 9). gDNA from T206 was amplified with pYB36 CS1 F and pYB36 CS1 R (SEQ ID NO: 28) primers (Table 8), 5% DMSO (v:v), KOD Hot Start Mastermix using the following cycling conditions: 95 °C 2 min, (95 °C 20 sec, 61 °C 10 sec, 70 °C 11 sec) x 35 cycles, 70 °C 5 min (Fig. 10). gDNA from T205 and T209 was prepared using the following cycling conditions with pYB36 CS4 F (SEQ ID NO: 30) and pYB36 CS4 R (SEQ ID NO: 31) primers (Table 8), 5% DMSO (v:v), KOD Hot Start Mastermix was amplified with: 95 °C 2 min, (95 °C 20 sec, 61 °C 10 sec, 70 °C 21 sec) x 35 cycles, 70 °C 5 min (FIG. 9).

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pYB36 CS1 F 27 GAGTCGAAGGAGACGTTGTCG pYB36 CS1 R 28 GTCATTGCGAATGATGCGATATG pYB36 CS3 R 29 GGTCATCATGGAATACAACGCAG pYB36 CS4 F 30 CGAGCTCATTTGTGCTACACTCTATG pYB36 CS4 R 31 CACAAGATTTGCAGGATTGATGC

The resulting PCR amplification product was column purified, cloned into pJet1.2 vector (Thermo Fisher, Waltham, Mass.), a small amount of plasmid was extracted from the resulting bacterial transformant, and the insert was sequenced with the primers provided in the kit. analyzed. Sequences were aligned using Geneious software.

Transformation of two Cas9 backgrounds (T188 and T189) with vectors encoding gRNAs was successfully performed and resulted in a number of dual auxotrophic strains (designated T202-209) as shown in Table 9 below. Selected strains were later analyzed at the genetic level to detect any mutations in the carotenoid synthase locus, indicating a non-homologous end attachment (NHEJ) event.

transformation total colonies
(per 3ug DNA) 16:0 Number of auxotrophs KO percent T202 (T188+gRNA1) 103 17/32 53% T203 (T188+gRNA2) 93 15/32 46% T204 (T188+gRNA3) 65 15/32 46% T205 (T188+gRNA4) 50 15/32 46% T206 (T189+gRNA1) 53 12/32 37% T207 (T189+gRNA2) 28 8/20 40% T208 (T189+gRNA3) 38 9/29 31% T209 (T189+gRNA4) 28 9/22 41%

After isolation of gDNA from gRNA + Cas9 transformants that were shown to be auxotrophic (requiring both DNA and palmitic acid to be supplemented), one PCR was used to contain the first 3 CS gRNA targets as one amplification product was amplified and the gRNA3 CS4 target was amplified separately using another PCR (Fig. 9). The expected size for the amplification product from the gRNA3 CS1-3 transformant DNA was 1040 bp and that from the gRNA 3 CS4 transformant was 715 bp. In the case of amplicons against the gRNA CS1-3 target, the sample from the T188 line had a single band of the correct size. However, samples from T189 (including gDNA from the T189 parent strain itself) had multiple bands with the most prominent about 1 kbp band and the second most prominent about 1.5 kbp band. The 1.5 kbp band was determined to be the product of non-specific amplification. Optimization of the PCR was not performed to reduce the presence of non-specific bands, and an approximately 1 kbp band was excised from the gel for all of the transformants and used for pJet1.2 cloning. All CS4 amplicons were single bands of the correct size. A large number of pJet transformant colonies having amplification products from each of the above generated Cas9/gRNA transformants were sent for sequencing to determine whether Cas9/gRNA had any effect on the CS sequence.

Additionally, analysis was performed on the T206 line of clones. As shown in FIG. 9 , the T206 transformant was gDNA extracted and used as a template for PCR to amplify only the gRNA3 CS1 target sequence and the expected amplification product size was 689 bp. A band of this size was observed on the gel, which was the main band among others, was the one with the higher molecular weight, and was similar to that observed in the preceding figure. A gel fragment of the expected size of about 700 bp was cut and purified, and the fragment was used for pJet1.2 cloning and sequencing to determine whether Cas9-gDNA induced any sequence change in the CS gene (FIG. 10).

When sequencing multiple pJet vectors containing amplification products of the CS locus from clones transformed with both Cas9 and gRNA encoding vectors, several types of changes were observed (Table 10). Previous studies have demonstrated that CAS9 cleaves DNA and generates a double-stranded break at a 3 base pair position upstream of the PAM sequence (Jinek et al. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity" Science 337 (6096):816-821, 2012]). It is known that mutations may arise from imprecise non-homologous end attachment (NHEJ)-mediated repair, which may result in insertion and/or deletion mutations of varying lengths at the double-stranded cleavage site (Sander and Joung, "CRISPR-Cas systems for editing, regulating and targeting genomes" Nat Biotechnol. 32(4):347-355, 2014]). All observed changes occur at position -3 relative to PAM (in this case AGG), as expected. Exemplary mutations of the carotenoid synthase of Schizochytrium sp. 20888 detected in Cas9+gRNA transformants are shown in Table 10, with deletions shown in dashes and insertions underlined.

wild-type nucleotide position # 15 16 17 18 19 20 PAM/NGG wild type A C G C G C AGG CS1 Target Variant #1 A C G C - - AGG CS1 Target Variant #2 A C - C G C AGG CS1 Target Variant #3 A C G C C G C AGG CS1 Target Variant #4 A C G T C G C AGG

All references cited herein are incorporated herein by reference as if each reference were specifically and individually indicated to be incorporated by reference. Citation of any reference is for its disclosure prior to the filing date and is not to be construed as an admission that this disclosure is not entitled to antedate such reference because of prior invention.

It will be appreciated that each of the aforementioned elements, or two or more elements together, may also find useful use in other types of methods different from those described above. Without further analysis, the foregoing sufficiently sets forth the subject matter of the present disclosure so that others, by applying their present knowledge, from the standpoint of the prior art, fairly share the essential features of the general or specific aspects of the present disclosure set forth in the appended claims. The above specification can be readily adapted to various uses without omitting constituting features. The above embodiments are provided by way of example only; The scope of the present disclosure is limited only by the following claims.

Example 5

Design and formation of untargeted Cas9 vector (pYB61)

Previously, a Cas9 plasmid was designed for targeted integration in the PUFA synthase gene (OrfA subunit; see pYB32 and pYB33). Integration of the Cas9 cassette designed in this way resulted in a knockout of the OrfA gene and a DHA auxotroph. Induction of auxotrophs allows easier selection of transformants for subsequent integration at the OrfA locus, but makes differentiation of CRISPR-mediated carotene synthase knockouts more difficult. Plasmids with an expression cassette for Cas9 without targeting to any chromosomal locus were formed to test the effect of ectopic, random integration. Plasmid pCL122-Cas9 (SEQ ID NO: 1) was digested with BamHI-HF (NEB) and NdeI (NEB) to generate two fragments, 4140 bp and 5780 bp in size. The 4140 bp fragment was isolated on 1% agarose gel, excised, and purified using the QIAquick gel extraction kit (Qiagen) (FIG. 11). Plasmid pYB30 (SEQ ID NO: 32) contains a partial fragment of the alpha-tubulin promoter driving expression of GFP and zeocin resistance. The plasmid was digested with BamHI-HF (NEB) and NdeI (NEB) to generate two fragments 838 bp and 4724 bp. The 4724 bp fragment was isolated on 1% agarose gel, excised, and purified using the QIAquick gel extraction kit (Qiagen) (FIG. 11). The two fragments of interest were ligated using a rapid DNA ligation kit (Roche). NEB10β chemically soluble cells (NEBs) were then transformed as part of the ligation reaction. The resulting colonies were used as templates for selection by PCR with 2x GoTaq Green Master Mix (Promega), primers 121 Tub seq F and pYB32/3C R1 and 5% final DMSO. The following cycling conditions were applied: 95° C. 5 min, [95° C. 30 sec, 59° C. 30 sec, 72° C. 1 min] for 35 cycles, and 72° C. 5 min (described previously) ( FIG. 12 ). The plasmid was extracted from the colonies identified as positive transformants by PCR, sequenced, and the resulting vector was designated pYB61 (SEQ ID NO: 33).

Primer name SEQ ID NO: Primer sequence, 5'→3' 121 Tub seq F 13 GGATCTCATGCTGGAGTTCTTC pYB32/3C R1 14 GTACTTCTCGTGGTAGGCAACC

Example 6

Design and formation of untargeted gRNA vector (pYB66)

Previously, a gRNA plasmid was targeted to the fatty acid synthase (FAS) gene locus, creating an auxotrophic requirement for palmitic acid. These auxotrophs masked the phenotype resulting from CRISPR-mediated carotene synthase inactivation. To better identify CRISPR-mediated phenotypic changes at loci involved in carotenoid biosynthesis, untargeted gRNA vectors were constructed. Plasmid pCL122 (SEQ ID NO: 37) was digested with BamHI-HF (NEB) and NdeI (NEB) to remove the reading frame encoding GFP, resulting in two fragments of 838 bp and 5773 bp in size. The 5773 bp fragment was separated on a 1% agarose gel, excised, and purified using the QIAquick gel extraction kit (Qiagen) (FIG. 13). The cassette encoding gRNA3 CS1 was prepared by PCR using plasmid pYB36 (SEQ ID NO: 9) as a template along with 2x KOD hot start master mix (EMD Millipore), primers pYB66 BamBgl F and pYB66 Nde R, and 5% final DMSO. amplified. The following cycling conditions were applied: 95° C. 2 min, [95° C. 20 sec, 59° C. 10 sec, 70° C. 5 sec] for 35 cycles, and 72° C. 2 min (described previously) ( FIG. 14 ). The resulting PCR fragment was column purified using a QIAquick PCR purification kit (Qiagen) and digested with BamHI-HF (NEB) and NdeI (NEB). Following cleavage, the resulting DNA fragment was purified again using a QIAquick PCR purification kit (FIG. 15). The cleaved pCL122 and gRNA fragments were ligated using a rapid DNA ligation kit (Roche). NEB10β chemically soluble cells were then transformed as part of the above ligation reaction and the resulting colonies were transformed using 2x GoTaq Green Master Mix (Promega), primers pYB66 EF1seq F and pCL122 OrfC R and 5% final volume of DMSO, in the following cycle: The conditions were selected by colony PCR: 95 °C 10 min, [95 °C 30 sec, 60 °C 30 sec, 72 °C 45 sec] for 35 cycles, and 72 °C 5 min (FIG. 16). The plasmid was extracted from the positive colonies by PCR and sequenced, and the resulting vector was designated pYB66 (SEQ ID NO: 34).

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pYB66 BamBgl F 38 CAAGGGATCCAGATCTTCCGCACTGATGAGTC pYB66 Nde R 39 AACTCATATGGTCCCATTCGCCA pYB66 EF1seq F 40 GAGAGGATAGTATCTTGCGTGCTTG pCL122 OrfC R 41 GCAAGGTTGGAACATTACGATCAAG

Example 7

Design and formation of Cas9 and gRNA vectors (pYB73)

The efficiency of such an arrangement for genome editing was tested by generating vectors containing both Cas9 and gRNA cassettes on the same vector with a single dominant selectable marker. Plasmid pYB61 was digested with PstI (NEB) and purified by QIAquick PCR purification kit (Qiagen) (FIG. 17). The gRNA expression cassette was amplified from pYB36 using PCR with: 2x KOD hot start master mix (Novagen), primers pYB73 gRNA Pst Kpn IF F and pYB73 gRNA Xho Pst IF R, and 5% final DMSO. Cycling conditions were used as follows: 95° C. 2 min, [95° C. 20 sec, 58° C. 10 sec, 70° C. 38 sec] for 35 cycles, and 70° C. 2 min (FIG. 18). The resulting PCR fragment was column purified using the QIAquick PCR Cleanup Kit (Qiagen). The purified, cleaved pYB61 fragment was ligated to the purified, cleaved gRNA PCR fragment using an infusion kit (Clontech) according to the manufacturer's protocol. NEB10β chemically soluble cells were transformed as part of the above infusion reaction and the resulting bacterial colonies were selected by PCR with 2x GoTaq Green Master Mix (Promega), primers pYB73 seq F and pYB73 seq R and 5% final DMSO. The following cycling conditions were applied: 95° C. 10 min, [95° C. 30 sec, 60° C. 30 sec, 72° C. 2 min] for 35 cycles, and 72° C. 5 min ( FIG. 19 ). The plasmid was extracted from the positive colonies by PCR and sequenced, and the resulting vector was designated pYB73 (SEQ ID NO: 35). Plasmid pYB73 is not designed for targeting to any particular gene.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pYB73 gRNA Pst Kpn IF F 42 CATACATGGTCGACCTGCAGGGTACCTCTTATCTGCCTCGC pYB73 gRNA Xho Pst IF R 43 ATTAATGCAGGTTCCTGCAGCTCGAGAAGAATCTGAACTCACGTC pYB73 seq F 44 CACCCCAACTTGTTTATTGCAG pYB73 seq R 45 GAGCGAGGAAGCGGAAGAG

Example 8

Design, Formation and Transformation of CarG Strains

To improve the distinction between transformants with CRIPSR-mediated carotene synthase gene inactivation (white colony phenotype) and transformants without CRIPSR-mediated carotene synthase gene inactivation (yellow-orange colony phenotype) For this purpose, the CarG gene (geranylgeranyl pyrophosphate synthase) from Mucor circinelloides was codon-optimized for expression in Schizochytrium. The CarG gene (which would increase the total amount of carotenoids produced and make the transformants more orange) was synthesized by DNA2.0 and cloned into a Schizochytrium expression vector containing a blasticidin selection cassette. . The resulting vector was named pCL310 (SEQ ID NO: 36).

A wild-type strain of Schizochytrium sp. ATCC 20888 was used for transformation to pCL310 via the particle bombardment method (Bio Rad). ATCC 20888 was grown in 25 ml of M50-20 medium in a 250 ml flat bottom Erlenmeyer flask at +27° C. with shaking at 200 rpm overnight. The 20888 culture was then diluted 1/100 in 50 ml M2B medium in a 250 ml shake flask and grown overnight under the conditions previously used. When the 20888 culture was in the initial log phase (0.6-2 OD units/ml), the culture was harvested by centrifugation at 3,220×g for 10 minutes. The supernatant was decanted and the pellet resuspended in M2B to a final concentration of 20 OD units/ml. 100 μl of the resulting cell suspension was plated onto approximately 1/3 of a non-selective M2B agar plate (approximately 2 in diameter). 5 μg of plasmid DNA and 5 μg of pCL310 were mixed with 50 μl of 2.5 M CaCl ₂ , 20 μl of 0.1 M spermidine and 50 μl of prepared M10 tungsten beads (according to manufacturer's protocol) and vortexed for 1 minute. and then incubated for 10 minutes at room temperature to allow the beads to precipitate. The DNA-coated beads were washed once with 250 μl of 100% ethanol, and then the beads were resuspended in 60 μl of 100% ethanol. Each prepared macrocarrier (according to the manufacturer's protocol for preparing the macrocarrier assembly) was subjected to 10 μl of the coated beads in ethanol that were centrally spotted under conditions that induce minimal vibration from the hood and thus allow the ethanol to dry. had The bursting disk holder had a 1,100 psi bursting disk after short sterilization in 70% isopropanol. The assembled macrocarrier platform was placed in the top shelf position and the M2B agar plate with the 20888 cell patch was placed cell side up on the third shelf from the top. Once the vacuum reached about 27 inches of mercury inside the gun chamber, helium was fired until the rupture disk was broken. The helium flow was then shut off and the chamber vented to atmosphere. The shock plate was then removed from the chamber. The shock procedure was repeated for all samples and controls. The 20888 strain shocked with pCL310 was designated T212. The shock plate was incubated for 4 hours in a +27° C. incubator, after which the cells were washed from the plate with about 1 ml of M2B and between 4 M2B agar plates containing 100 μg/ml blasticidin (ThermoFisher). evenly distributed in Cells were plated with 3 mm sterile glass beads. After bead removal, the plates were wrapped and incubated at +27 °C for 5-8 days. When the colonies reached 2-4 millimeters in size, they were overlaid on M2B agar plates containing 100 μg/ml blasticidin. Colonies found to be resistant to blasticidin were picked, inoculated into 50 ml of M50-20 in a 250 ml flat bottom Erlenmeyer flask, and placed on a shaker at +27° C. and 200 rpm for 48 hours. After 48 hours of incubation, 2 milliliters of culture were collected by centrifugation at 4,000×g for 10 minutes, the supernatant decanted and the pellet used for genomic DNA isolation following modified phenol-chloroform extraction. Genomic DNA was extracted and used as PCR template with GoTaq Green Mastermix (Promega) and primers pYB13 YB1 seq F and pCL122 OrfC R and DMSO at 5% final concentration to confirm the presence of the Cas9 cassette. The following cycling conditions were applied: 95° C. 2 min, [95° C. 30 sec, 63° C. 30 sec, 72° C. 1 min 45 sec] for 35 cycles, and 72° C. 5 min ( FIG. 20 ). A number of transformants positive for the presence of pCL130 transforming DNA as determined by PCR and exhibiting a darker orange color compared to the wild-type control were analyzed for total carotenoids by the UV-Vis method. In the above analysis, two strains, T212-3-1 and T212-3-2, were identified with higher total carotenoids. T212-3-2 is selected for subsequent studies on genome editing elements.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pYB13 pYB1 seq F 46 GAGAGGATAGTATTCTTGCGTGCTTGG pCL122 OrfC R 41 GCAAGGTTGGAACATTACGATCAAG

Example 9

Transformation of T212 and 20888 with pYB61, pYB66 and pYB73

A number of transformations were performed using the particle bombardment method described above to test the effect of untargeted vectors on editing efficiency in Schizochytrium. The transformation was set up as follows: the T280-T212-3-2 strain was transformed with pYB61 and the T285-ATCC 20888 wild-type strain was transformed with pYB61. Both transformations were performed to generate recipient strains pre-expressing Cas9 for gRNA testing studies. Subsequent transformations were set up as follows: the T281-T212-3-2 strain was co-transformed with pYB61 and pYB66, and the T286-ATCC 20888 wild-type strain was co-transformed with pYB61 and pYB66. T281 and T286 transformations were performed to evaluate the efficiency of editing with plasmids not designed for targeting to any specific locus in the genome. The T282-T212-3-2 strain transformed with pYB73, and the T287-ATCC 20888 wild-type strain transformed with pYB73 were completed to evaluate the editing efficiency by a single plasmid with both elements for genome editing. . T280, T282, T285, T287 transformations were selected on M2B plates supplemented with 50 μg/ml of Zeocin (Thermo Fisher). T281 and T286 transformations were selected on M2B plates supplemented with 50 μg/ml zeocin and 100 μg/ml paromomycin (Sigma). Colonies resulting from both of these transformations were plated onto selective M2B plates containing either 100 μg/ml zeocin alone or 100 μg/ml zeocin and 100 μg/ml paromomycin. Patches that grew robustly on the patch plates and displayed a white colony phenotype where applicable were selected for further analysis. The strains were removed from the patch plate and inoculated into 25 ml of M50-20 medium in a 250 ml Erlenmeyer flat bottom flask. Flasks were incubated at +27° C., 200 rpm for approximately 24 hours. An aliquot of each inoculum of 2 ml was taken, placed in a microcentrifuge tube, and spun at 7,500 x g for 10 minutes. The supernatant was decanted and the pellet used for the preparation of genomic DNA using a modified phenol-chloroform extraction method. The resulting gDNA was subjected to analysis by PCR for the presence of the selection cassette and the gene of interest. For T280, T281, T285, T286, the junction between the terminator of the selection cassette and the start of the Cas9 gene was amplified using: 2X GoTaq Green Master Mix, primers 121 Tub seq F and pYB32/3 CR1, 5 DMSO, and gDNA as % final concentrations. The following conditions were applied: 95° C. 2 min, [95° C. 30 sec, 58° C. 30 sec, 72° C. 1 min 2 sec] for 35 cycles, and 72° C. 5 min ( FIG. 21 ). For T281 and T286, the presence of the gRNA cassette was assessed by PCR amplification of the entire gRNA cassette as follows: 2X GoTaq Green Master Mix, primers pYB66 EF1 seq F and pCL122 OrfC R, DMSO at 5% final concentration, and gDNA. The following cycling conditions were applied: 95° C. 2 min, [95° C. 30 sec, 60° C. 30 sec, 72° C. 47 sec] for 35 cycles, and 72° C. 5 min ( FIG. 22 ). For T282 and T287, the presence of the gRNA cassette was assessed by PCR amplification as follows: 2X GoTaq Green Master Mix, primers pYB66 EF1 seq F and TT pYB73 HDV R, DMSO at 5% final concentration, and gDNA. The following cycling conditions were applied: 95° C. 2 min, [95° C. 30 sec, 60.9° C. 30 sec, 72° C. 16 sec] for 35 cycles, and 72° C. 5 min ( FIG. 23 ). PCR was applied to T281, T282, T286 and T287 transformants that tested positive by PCR for Cas9 and gRNA to sequence the PCR amplicons and to observe the types of indels generated from the gene editing experiments, The gRNA amplified the parts of the CS gene that affected the change. PCR to amplify the relevant portion of the CS gene was prepared by: 2X KOD Hot Star Master Mix, primers pYB36 CS1 F and pYB36 CS1 R, DMSO at 5% final concentration, and gDNA. The following cycling conditions were applied: 95° C. 2 min, [95° C. 20 sec, 61° C. 10 sec, 70° C. 11 sec] for 35 cycles, and 70° C. 5 min ( FIG. 24 ). PCR fragments were column purified using QIAquick PCR purification kit (Qiagen) and sequenced with pYB36 CS1 F and pYB36 CS1 R.

Primer name SEQ ID NO: Primer sequence, 5'→ 3' pYB66 EF1 seq F 40 GAGAGGATAGTATCTTGCGTGCTTG pCL122 OrfC R 41 GCAAGGTTGGAACATTACGATCAAG TT pYB73 HDV R 47 GAAGCATGTTGCCCAGCC pYB36 CS1 F 27 GAGTCGAAGGAGACGTTGTCG pYB36 CS1 R 28 GTCATTGCGAATGATGCGATATG

SEQUENCE LISTING <110> DSM IP Assets B.V. <120> A CRISPR-CAS SYSTEM FOR AN ALGAL HOST CELL <130> 32176-WO-PCT <140> PCT/US2017/041949 <141> 2017-07-13 <150> US 62/361,741 <151> 2016-07-13 <160> 47 <170> PatentIn version 3.5 <210> 1 <211> 9920 <212> DNA <213> Artificial Sequence <220> <223> pCL122-Cas9 vector <220> <221> misc_feature <222> (1)..(1064) <223> EF-1 alpha promoter <220> <221> misc_feature <222> (1070)..(5209) <223> Cas9 <220> <221> misc_feature <222> (5229)..(5868) <223> OrfC_terminator <220> <221> misc_feature <222> (7153)..(8013) <223> AmpR_gene <220> <221> misc_feature <222> (8403)..(8851) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (8852)..(9646) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (9647)..(9920) <223> SV40_terminator <400> 1 ctcttatctg cctcgcgccg ttgaccgccg cttgactctt ggcgcttgcc gctcgcatcc 60 tgcctcgctc gcgcaggcgg gcgggcgagt gggtgggtcc gcagccttcc gcgctcgccc 120 gctagctcgc tcgcgccgtg ctgcagccag cagggcagca ccgcacggca ggcaggtccc 180 ggcgcggatc gatcgatcca tcgatccatc gatccatcga tcgtgcggtc aaaaagaaag 240 gaagaagaaa ggaaaaagaa aggcgtgcgc acccgagtgc gcgctgagcg cccgctcgcg 300 gtcccgcgga gcctccgcgt tagtccccgc cccgcgccgc gcagtccccc gggaggcatc 360 gcgcacctct cgccgccccc tcgcgcctcg ccgattcccc gcctcccctt ttccgcttct 420 tcgccgcctc cgctcgcggc cgcgtcgccc gcgccccgct ccctatctgc tccccagggg 480 ggcactccgc accttttgcg cccgctgccg ccgccgcggc cgccccgccg ccctggtttc 540 ccccgcgagc gcggccgcgt cgccgcgcaa agactcgccg cgtgccgccc cgagcaacgg 600 gtggcggcgg cgcggcggcg ggcggggcgc ggcggcgcgt aggcggggct aggcgccggc 660 taggcgaaac gccgcccccg ggcgccgccg ccgcccgctc cagagcagtc gccgcgccag 720 accgccaacg cagagaccga gaccgaggta cgtcgcgccc gagcacgccg cgacgcgcgg 780 cagggacgag gagcacgacg ccgcgccgcg ccgcgcgggg ggggggaggg agaggcagga 840 cgcgggagcg agcgtgcatg tttccgcgcg agacgacgcc gcgcgcgctg gagaggagat 900 aaggcgcttg gatcgcgaga gggccagcca ggctggaggc gaaaatgggt ggagaggata 960 gtatcttgcg tgcttggacg aggagactga cgaggaggac ggatacgtcg atgatgatgt 1020 gcacagagaa gaagcagttc gaaagcgact actagcaagc aagggatcca tggataagaa 1080 gtactcgatc ggcctcgaca ttggcaccaa cagcgtcggc tgggccgtca ttactgatga 1140 gtacaaggtc ccgtcgaaga agtttaaggt cctcggcaac actgaccgcc actccatcaa 1200 gaagaacctc atcggtgccc tcctttttga ctccggcgag accgctgagg ccactcgcct 1260 caagcgcact gcccgccgcc gttacacccg ccgcaagaac cgcatctgct acctccagga 1320 gattttctcg aacgaaatgg ccaaggtcga tgactccttt ttccaccgtc tcgaagaatc 1380 gttcctcgtc gaggaggaca agaagcacga gcgccacccc atcttcggta acatgtcga 1440 tgaggttgcc taccacgaga agtacccgac catctaccac ctccgcaaga agctcgtcga 1500 ctccaccgac aaggccgatc tccgccttat ctacctcgcc ctcgcccaca tgatcaagtt 1560 ccgcggccac tttcttatcg agggtgatct caaccctgat aactctgacg tcgacaagct 1620 tttcatccag ctcgtccaga cttacaacca gctcttcgag gagaacccca tcaacgcttc 1680 cggcgtcgac gcgaaggcca ttctcagcgc ccgcctcagc aagtcccgcc gcctcgaaaa 1740 cctcattgcc cagcttcccg gcgagaagaa gaacggcctc ttcggcaacc tcattgccct 1800 cagccttggc ctcaccccta acttcaagtc gaactttgac ctcgccgagg acgccaagct 1860 ccagctttcc aaggacactt acgacgacga tctcgacaac ctcctcgctc agattggcga 1920 ccagtacgct gacctcttcc tcgccgccaa gaaccttagc gatgccatcc tcctctccga 1980 catccttcgt gttaacacgg aaatcacgaa ggctccgctc tccgcctcca tgatcaagcg 2040 ttacgacgag caccatcagg acctcaccct cctcaaggcc ctcgtccgcc agcagctccc 2100 cgagaagtac aaggagatct tcttcgacca gagcaagaac ggctacgccg gctacattga 2160 cggcggcgcg tcgcaggagg agttttacaa gtttatcaag cccattcttg agaagatgga 2220 cggcaccgag gagctcctcg tcaagctcaa ccgtgaggac cttctccgca agcagcgcac 2280 gttcgacaac ggctctattc cccatcagat ccacctcggt gagcttcacg cgattcttcg 2340 ccgccaggaa gacttttacc cgttcctcaa ggacaaccgc gagaagattg agaagatcct 2400 cacctttcgc attccctact acgtcggccc cctcgcccgc ggcaactcgc gctttgcttg 2460 gatgacccgc aagtccgagg agaccatcac cccgtggaac ttcgaagagg tcgtcgacaa 2520 gggcgcctcc gcgcagtctt tcatcgagcg catgactaac tttgacaaga acctcccgaa 2580 cgagaaggtc ctccccaagc acagcctcct ttacgaatac tttacggtgt acaacgagct 2640 cacgaaggtc aagtacgtca ctgagggcat gcgcaagccg gcgttccttt cgggcgagca 2700 gaagaaggct atcgtcgacc tccttttcaa gaccaaccgc aaggttaccg tcaagcagct 2760 caaggaggac tacttcaaga agatcgagtg ctttgactcg gtcgagattt cgggcgtgga 2820 ggaccgtttc aacgcctccc tcggcactta ccacgacctt ctcaagatca tcaaggacaa 2880 ggactttctc gacaacgagg agaacgagga cattctcgag gacatcgtcc tcacgctcac 2940 cctctttgag gaccgtgaga tgatcgagga gcgcctcaag acctacgccc atctctttga 3000 cgacaaggtc atgaagcagc tcaagcgccg ccgctacacc ggctggggcc gcctttcccg 3060 caagctcatc aacggcatcc gcgacaagca gtctggcaag accatccttg actttcttaa 3120 gtctgatggt ttcgccaacc gcaacttcat gcagctcatc cacgacgaca gcctcacttt 3180 caaggaggac attcagaagg cccaggtctc cggccagggt gactctctcc acgaacacat 3240 cgccaacctt gctggcagcc cggctatta gaagggcatc ctccagaccg tcaaggtcgt 3300 cgacgagctc gtcaaggtta tgggccgcca caagcccgag aacatcgtca ttgagatggc 3360 tcgcgaaaac cagaccaccc agaagggtca gaagaactcc cgcgagcgca tgaagcgtat 3420 cgaggagggc atcaaggagc tcggcagcca gatcctcaag gagcacccgg tcgagaacac 3480 ccagctccag aacgaaaagc tctacctcta ctacctccag aacggccgtg acatgtacgt 3540 tgaccaggag ctcgacatta accgcctctc cgattacgac gtcgaccata ttgtccccca 3600 gagctttctc aaggacgaca gcatcgacaa caaggtcctc acccgctcgg acaagaaccg 3660 cggcaagtcc gacaacgtcc cttccgagga ggtcgtgaag aagatgaaga actactggcg 3720 ccagcttctc aacgctaagc ttattactca gcgcaagttc gataacctca ccaaggccga 3780 acgcggcggc ctctccgagc tcgacaaggc cggttttatc aagcgccagc tcgttgagac 3840 tcgccagatc accaagcacg tggcgcagat cctcgactcg cgcatgaaca cgaagtacga 3900 cgagaacgac aagctcatcc gcgaggtcaa ggtcatcacc cttaagtcga agctcgtgtc 3960 cgactttcgc aaggacttcc agttctacaa ggtccgtgaa attaacaact accaccacgc 4020 tcacgacgct tacctcaacg cggtcgtggg taccgcgctc atcaagaagt acccgaagct 4080 cgagtcggag tttgtctacg gcgactacaa ggtctacgac gtgcgcaaga tgatcgccaa 4140 gtccgagcag gagatcggca aggccacggc caagtacttt ttctactcca acattatgaa 4200 cttctttaag actgagatca cccttgccaa cggcgagatc cgcaagcgcc cccttatcga 4260 gaccaacggc gagaccggcg aaattgtgtg ggataagggt cgcgactttg ccaccgtccg 4320 caaggtcctc agcatgcccc aggtcaacat tgttaagaag accgaggtcc agacgggcgg 4380 ctttagcaag gagtctatcc tccccaagcg taacagcgac aagctcatcg cccgcaagaa 4440 ggactgggac cctaagaagt acggcggctt cgattcgcct acggtcgcct acagcgtcct 4500 cgtcgtcgcc aaggtcgaga agggcaagtc caagaagctc aagtccgtca aggagctcct 4560 cggcatcacg atcatggagc gctccagctt tgagaagaac cccattgact tcctcgaggc 4620 taagggttac aaggaggtca agaaggacct tatcatcaag ctccccaagt actccctctt 4680 tgagctcgaa aacggccgca agcgtatgct cgctagcgct ggcgaactcc agaagggcaa 4740 cgagctcgcc ctccccagca agtacgtcaa ctttctctac ctcgcctccc actacgagaa 4800 gctcaagggt agcccggagg ataacgagca gaagcagctt tttgtggagc agcacaagca 4860 ctaccttgac gagatcattg aacagatctc cgagttctcc aagcgtgtta ttcttgctga 4920 cgccaacctc gataaggtgc tctccgcgta caacaagcac cgcgacaagc ctatccgcga 4980 gcaggccgag aacatcatcc acctctttac cctcaccaac ctcggcgccc cggccgcctt 5040 taagtacttt gatacgacta tcgaccgcaa gcgctacact tcgactaagg aggtcctcga 5100 cgctaccctc attcaccagt ccattaccgg cctctacgag acccgcattg acctttcgca 5160 gctcggtggc gactcgcgtg cggaccctaa gaagaagcgc aaggtctaac atatgagtta 5220 tgagatccga aagtgaacct tgtcctaacc cgacagcgaa tggcgggagg gggcgggcta 5280 aaagatcgta ttacatagta tttttcccct actctttgtg tttgtctttt tttttttttt 5340 gaacgcattc aagccacttg tctgggttta cttgtttgtt tgcttgcttg cttgcttgct 5400 tgcctgcttc ttggtcagac ggcccaaaaa agggaaaaaa ttcattcatg gcacagataa 5460 gaaaaagaaa aagtttgtcg accaccgtca tcagaaagca agagaagaga aacactcgcg 5520 ctcacattct cgctcgcgta agaatcttag ccacgcatac gaagtaattt gtccatctgg 5580 cgaatcttta catgagcgtt ttcaagctgg agcgtgagat catacctttc ttgatcgtaa 5640 tgttccaacc ttgcataggc ctcgttgcga tccgctagca atgcgtcgta ctcccgttgc 5700 aactgcgcca tcgcctcatt gtgacgtgag ttcagattct tctcgagacc ttcgagcgct 5760 gctaatttcg cctgacgctc cttcttttgt gcttccatga cacgccgctt caccgtgcgt 5820 tccacttctt cctcagacat gcccttggct gcctcgacct gctcggtaaa acgggcccca 5880 gcacgtgcta cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat 5940 cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt 6000 cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac 6060 aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat 6120 caatgtatct tatcatacat ggtcgacctg caggaacctg cattaatgaa tcggccaacg 6180 cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 6240 gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 6300 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 6360 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga 6420 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 6480 ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 6540 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg 6600 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 6660 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 6720 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 6780 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaagaacagt 6840 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 6900 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 6960 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 7020 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 7080 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 7140 ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 7200 tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt 7260 accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 7320 atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 7380 cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 7440 tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 7500 tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 7560 gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 7620 agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 7680 aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 7740 gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 7800 tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 7860 gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 7920 tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 7980 aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 8040 catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 8100 acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat 8160 tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg 8220 tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 8280 tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 8340 gtgtcggggc tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccaagc 8400 ttccaatttt aggcccccca ctgaccgagg tctgtcgata atccactttt ccattgattt 8460 tccaggtttc gttaactcat gccactgagc aaaacttcgg tctttcctaa caaaagctct 8520 cctcacaaag catggcgcgg caacggacgt gtcctcatac tccactgcca cacaaggtcg 8580 ataaactaag ctcctcacaa atagaggaga attccactga caactgaaaa caatgtatga 8640 gagacgatca ccactggagc ggcgcggcgg ttgggcgcgg aggtcggcag caaaaacaag 8700 cgactcgccg agcaaacccg aatcagcctt cagacggtcg tgcctaacaa cacgccgttc 8760 taccccgcct tcttcgcgcc ccttcgcgtc caagcatcct tcaagtttat ctctctagtt 8820 caacttcaag aagaacaaca ccaccaacac catgattgaa caagatggat tgcacgcagg 8880 ttctccggcc gcttgggtgg agaggctatt cggctatgac tgggcacaac agacaatcgg 8940 ctgctctgat gccgccgtgt tccggctgtc agcgcagggg cgcccggttc tttttgtcaa 9000 gaccgacctg tccggtgccc tgaatgaact gcaggacgag gcagcgcggc tatcgtggct 9060 ggccacgacg ggcgttcctt gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga 9120 ctggctgcta ttgggcgaag tgccggggca ggatctcctg tcatctcacc ttgctcctgc 9180 cgagaaagta tccatcatgg ctgatgcaat gcggcggctg catacgcttg atccggctac 9240 ctgcccattc gaccaccaag cgaaacatcg catcgagcga gcacgtactc ggatggaagc 9300 cggtcttgtc gatcaggatg atctggacga agagcatcag gggctcgcgc cagccgaact 9360 gttcgccagg ctcaaggcgc gcatgcccga cggcgatgat ctcgtcgtga cccatggcga 9420 tgcctgcttg ccgaatatca tggtggaaaa tggccgcttt tctggattca tcgactgtgg 9480 ccggctgggt gtggcggacc gctatcagga catagcgttg gctacccgtg atattgctga 9540 agagcttggc ggcgaatggg ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga 9600 ttcgcagcgc atcgccttct atcgccttct tgacgagttc ttctgacacg tgctacgaga 9660 tttcgattcc accgccgcct tctatgaaag gttgggcttc ggaatcgttt tccgggacgc 9720 cggctggatg atcctccagc gcggggatct catgctggag ttcttcgccc accccaactt 9780 gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 9840 agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca 9900 tgtctgaatt cccggggtac 9920 <210> 2 <211> 7393 <212> DNA <213> Artificial Sequence <220> <223> pYB31 vector <220> <221> misc_feature <222> (2)..(450) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (457)..(549) <223> Sec1_signal_for_eGFP <220> <221> misc_feature <222> (550)..(1266) <223> eGFP <220> <221> misc_feature <222> (1294)..(2293) <223> OrfA_terminator <220> <221> misc_feature <222> (4971)..(5970) <223> OrfA_UP_homology <220> <221> misc_feature <222> (5974)..(6289) <223> OrfC_terminator <220> <221> misc_feature <222> (6296)..(6744) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (6745)..(7119) <223> Sh_ble_gene <220> <221> misc_feature <222> (7120)..(7393) <223> SV40_terminator <400> 2 cccaatttta ggccccccac tgaccgaggt ctgtcgataa tccacttttc cattgatttt 60 ccaggtttcg ttaactcatg ccactgagca aaacttcggt ctttcctaac aaaagctctc 120 ctcacaaagc atggcgcggc aacggacgtg tcctcatact ccactgccac acaaggtcga 180 taaactaagc tcctcacaaa tagaggagaa ttccactgac aactgaaaac aatgtatgag 240 agacgatcac cactggagcg gcgcggcggt tgggcgcgga ggtcggcagc aaaaacaagc 300 gactcgccga gcaaacccga atcagccttc agacggtcgt gcctaacaac acgccgttct 360 accccgcctt cttcgcgccc cttcgcgtcc aagcatcctt caagtttatc tctctagttc 420 aacttcaaga agaacaacac caccaacacc ggatccatga agttcgcgac ctcggtcgca 480 attttgcttg tggccaacat agccaccgcc ctcgcgcaga gcgatggctg cacccccacc 540 gaccagacga tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 600 gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat 660 gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc 720 tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac 780 cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc 840 accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 900 gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc 960 ctgggacaca agctggagta caactacaac agccacaacg tctatatcat ggccgacaag 1020 cagaagaacg gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg 1080 cagctcgccg accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc 1140 gacaaccact acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 1200 cacatggtcc tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg 1260 tacaagcacc accatcacca ccactaacat atgatctaaa ctagtgaatc gcgacaagtt 1320 gtctttttgt tactctacgt actgctcttt ctaattttac gacgtatgct tctgctcttg 1380 acgacgacaa ccatggcaat aaaagtaagg caagaagtga gtgcgtgctc gctcacaagg 1440 tctaggccga aacgaggcgc cttaggattg gttgtctccg tcgtaagtca tgacggagcg 1500 taggacaccg acggcctgcc gcgcaaatat acgaaccgct gcacaattct tttcgttgag 1560 aacaacctcg aacggcctgc cttgctgagc tgccgacacg gtggaaggaa gcatagcggc 1620 caatcgaggg gatgctatta attaggcttg gcgctgctgc cgccgtgcct gaagatgtgc 1680 gcaagcgtgg caacaccgtc caccttgcca ttaaagtcat gcactccaaa tacctcgaac 1740 agagcctctc gcatgtttgg ccaagcacct tcgaagagagt ctggactctc actccttcct 1800 caccgttgtc gccattctca gcgagctcat gcaatcacca ggacggagag acggccagct 1860 gcttttctgc tttccattgt tattagagaa acgcttctcg ctctcatcgt cttagtagac 1920 attccgatgg cttcgttcgc caatttgtca cctaagtaag ctagagtgtt aagtctaaat 1980 gcctttgacc cgcgtacggc gtcacgtaga tgcctgtcct tgccagcaaa cgctagttcg 2040 cggtgtgcgt aatttggccc gcattatgct ggctctcaaa atcaaccgcc accactcgcg 2100 gctgcacgat gattttcgtg cactcatgac atgagaaatg tgatactcaa actagtatag 2160 acctcctact cctactgctg cttttctcgt cagagctgtc tccggaaaag ttgacaagtt 2220 gttggccttc ttcttctctg ctagtaagta gatcatcatg gatgagacga tgatgataat 2280 gatgatgatg ataatttaaa tctcgagacc ttcgagcgct gctaatttcg cctgacgctc 2340 cttcttttgt gcttccatga cacgccgctt caccgtgcgt tccacttctt cctcagacat 2400 gcccttggct gcctcgacct gctcggtaaa acgggcccca gcacgtgcta cgagatttcg 2460 attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg gacgccggct 2520 ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc aacttgttta 2580 ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat 2640 ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatacat 2700 ggtcgacctg caggaacctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 2760 gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 2820 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 2880 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 2940 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 3000 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 3060 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 3120 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt 3180 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 3240 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 3300 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 3360 tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc 3420 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 3480 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 3540 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 3600 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 3660 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 3720 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct 3780 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg 3840 caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag 3900 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta 3960 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 4020 ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 4080 gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct 4140 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta 4200 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg 4260 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc 4320 cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg 4380 gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga 4440 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg 4500 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat 4560 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc 4620 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca 4680 catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct 4740 ataaaaatag gcgtatcacg aggccctttc gtctcgcgcg tttcggtgat gacggtgaaa 4800 acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg gatgccggga 4860 gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg gtgtcggggc tggcttaact 4920 atgcggcatc agagcagatt gtactgagag tgcaccaagc ttatttaaat ctttatcggt 4980 gtggcgcgcc ttgacggccg cctcggattc acttcgcagg gcacttctga cgcgctcaag 5040 cgtgcccagc gtggtgccat ctttggcctc tgcaagacca tcggcctcga gtggtccgag 5100 tctgacgtct tttcccgcgg cgtggacatt gctcagggca tgcaccccga ggatgccgcc 5160 gtggcgattg tgcgcgagat ggcgtgcgct gacattcgca ttcgcgaggt cggcattggc 5220 gcaaaccagc agcgctgcac gatccgtgcc gccaagctcg agaccggcaa cccgcagcgc 5280 cagatcgcca aggacgacgt gctgctcgtt tctggcggcg ctcgcggcat cacgcctctt 5340 tgcatccggg agatcacgcg ccagatcgcg ggcggcaagt acattctgct tggccgcagc 5400 aaggtctctg cgagcgaacc ggcatggtgc gctggcatca ctgacgagaa ggctgtgcaa 5460 aaggctgcta cccaggagct caagcgcgcc tttagcgctg gcgagggccc caagcccacg 5520 ccccgcgctg tcactaagct tgtgggctct gttcttggcg ctcgcgaggt gcgcagctct 5580 attgctgcga ttgaagcgct cggcggcaag gccatctact cgtcgtgcga cgtgaactct 5640 gccgccgacg tggccaaggc cgtgcgcgat gccgagtccc agctcggtgc ccgcgtctcg 5700 ggcatcgttc atgcctcggg cgtgctccgc gaccgtctca tcgagaagaa gctccccgac 5760 gagttcgacg ccgtctttgg caccaaggtc accggtctcg agaacctcct cgccgccgtc 5820 gaccgcgcca acctcaagca catggtcctc ttcagctcgc tcgccggctt ccacggcaac 5880 gtcggccagt ctgactacgc catggccaac gaggccctta acaagatggg cctcgagctc 5940 gccaaggacg tctcggtcaa gtcgatctgc taagaaagtg aaccttgtcc taacccgaca 6000 gcgaatggcg ggagggggcg ggctaaaaga tcgtattaca tagtattttc ccctactctt 6060 tgtgtttgtc tttttttttt ttgaacgcat tcaagccact tgtcttggtt tacttgtttg 6120 tttgcttgct tgcttgcttg cttgcctgct tcttggtcag acggacccaa aaaagggaaa 6180 aaattcattc atggcacaga taagaaaaag aaaaagtttg tcgaccaccg tcatcagaaa 6240 gcaagagaag agaaacactc gcgctcacat tctcgctcgc gtaagaatca agcttccaat 6300 tttaggcccc ccactgaccg aggtctgtcg ataatccact tttccattga ttttccaggt 6360 ttcgttaact catgccactg agcaaaactt cggtctttcc taacaaaagc tctcctcaca 6420 aagcatggcg cggcaacgga cgtgtcctca tactccactg ccacacaagg tcgataaact 6480 aagctcctca caaatagagg agaattccac tgacaactga aaacaatgta tgagagacga 6540 tcaccactgg agcggcgcgg cggttgggcg cggaggtcgg cagcaaaaac aagcgactcg 6600 ccgagcaaac ccgaatcagc cttcagacgg tcgtgcctaa caacacgccg ttctaccccg 6660 ccttcttcgc gccccttcgc gtccaagcat ccttcaagtt tatctctcta gttcaacttc 6720 aagaagaaca acaccaccaa caccatggcc aagttgacca gtgccgttcc ggtgctcacc 6780 gcgcgcgacg tcgccggagc ggtcgagttc tggaccgacc ggctcgggtt ctcccgggac 6840 ttcgtggagg acgacttcgc cggtgtggtc cgggacgacg tgaccctgtt catcagcgcg 6900 gtccaggacc aggtggtgcc ggacaacacc ctggcctggg tgtgggtgcg cggcctggac 6960 gagctgtacg ccgagtggtc ggaggtcgtg tccacgaact tccgggacgc ctccgggccg 7020 gccatgaccg agatcggcga gcagccgtgg gggcgggagt tcgccctgcg cgacccggcc 7080 ggcaactgcg tgcacttcgt ggccgaggag caggactgac acgtgctacg agatttcgat 7140 tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga cgccggctgg 7200 atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa cttgtttatt 7260 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt 7320 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatgtctga 7380 attcccgggg tac 7393 <210> 3 <211> 10702 <212> DNA <213> Artificial Sequence <220> <223> pYB32 vector <220> <221> misc_feature <222> (2)..(450) <223> alpha tubulin promoter <220> <221> misc_feature <222> (457)..(4596) <223> Cas9 <220> <221> misc_feature <222> (4603)..(5602) <223> OrfA terminator <220> <221> misc_feature <222> (8280)..(9279) <223> OrfA UP homology <220> <221> misc_feature <222> (9283)..(9598) <223> OrfC terminator <220> <221> misc_feature <222> (9605)..(10053) <223> alpha tubulin promoter <220> <221> misc_feature <222> (10054)..(10428) <223> Sh ble gene <220> <221> misc_feature <222> (10429)..(10702) <223> SV40_terminator <400> 3 cccaatttta ggccccccac tgaccgaggt ctgtcgataa tccacttttc cattgatttt 60 ccaggtttcg ttaactcatg ccactgagca aaacttcggt ctttcctaac aaaagctctc 120 ctcacaaagc atggcgcggc aacggacgtg tcctcatact ccactgccac acaaggtcga 180 taaactaagc tcctcacaaa tagaggagaa ttccactgac aactgaaaac aatgtatgag 240 agacgatcac cactggagcg gcgcggcggt tgggcgcgga ggtcggcagc aaaaacaagc 300 gactcgccga gcaaacccga atcagccttc agacggtcgt gcctaacaac acgccgttct 360 accccgcctt cttcgcgccc cttcgcgtcc aagcatcctt caagtttatc tctctagttc 420 aacttcaaga agaacaacac caccaacacc ggatccatgg ataagaagta ctcgatcggc 480 ctcgacattg gcaccaacag cgtcggctgg gccgtcatta ctgatgagta caaggtcccg 540 tcgaagaagt ttaaggtcct cggcaacact gaccgccact ccatcaagaa gaacctcatc 600 ggtgccctcc tttttgactc cggcgagacc gctgaggcca ctcgcctcaa gcgcactgcc 660 cgccgccgtt acacccgccg caagaaccgc atctgctacc tccaggagat tttctcgaac 720 gaaatggcca aggtcgatga ctcctttttc caccgtctcg aagaatcgtt cctcgtcgag 780 gaggacaaga agcacgagcg ccaccccatc ttcggtaaca ttgtcgatga ggttgcctac 840 cacgagaagt acccgaccat ctaccacctc cgcaagaagc tcgtcgactc caccgacaag 900 gccgatctcc gccttatcta cctcgccctc gcccacatga tcaagttccg cggccacttt 960 cttatcgagg gtgatctcaa ccctgataac tctgacgtcg acaagctttt catccagctc 1020 gtccagactt acaaccagct cttcgaggag aaccccatca acgcttccgg cgtcgacgcg 1080 aaggccattc tcagcgcccg cctcagcaag tcccgccgcc tcgaaaacct cattgcccag 1140 cttcccggcg agaagaagaa cggcctcttc ggcaacctca ttgccctcag ccttggcctc 1200 acccctaact tcaagtcgaa ctttgacctc gccgaggacg ccaagctcca gctttccaag 1260 gacacttacg acgacgatct cgacaacctc ctcgctcaga ttggcgacca gtacgctgac 1320 ctcttcctcg ccgccaagaa ccttagcgat gccatcctcc tctccgacat ccttcgtgtt 1380 aacacggaaa tcacgaaggc tccgctctcc gcctccatga tcaagcgtta cgacgagcac 1440 catcaggacc tcaccctcct caaggccctc gtccgccagc agctccccga gaagtacaag 1500 gagatcttct tcgaccagag caagaacggc tacgccggct acatgacgg cggcgcgtcg 1560 caggaggagt tttacaagtt tatcaagccc attcttgaga agatggacgg caccgaggag 1620 ctcctcgtca agctcaaccg tgaggacctt ctccgcaagc agcgcacgtt cgacaacggc 1680 tctattcccc atcagatcca cctcggtgag cttcacgcga ttcttcgccg ccaggaagac 1740 ttttacccgt tcctcaagga caaccgcgag aagattgaga agatcctcac ctttcgcatt 1800 ccctactacg tcggccccct cgcccgcggc aactcgcgct ttgcttggat gacccgcaag 1860 tccgaggaga ccatcacccc gtggaacttc gaagaggtcg tcgacaaggg cgcctccgcg 1920 cagtctttca tcgagcgcat gactaacttt gacaagaacc tcccgaacga gaaggtcctc 1980 cccaagcaca gcctccttta cgaatacttt acggtgtaca acgagctcac gaaggtcaag 2040 tacgtcactg agggcatgcg caagccggcg ttcctttcgg gcgagcagaa gaaggctatc 2100 gtcgacctcc ttttcaagac caaccgcaag gttaccgtca agcagctcaa ggaggactac 2160 ttcaagaaga tcgagtgctt tgactcggtc gagatttcgg gcgtggagga ccgtttcaac 2220 gcctccctcg gcacttacca cgaccttctc aagatcatca aggacaagga ctttctcgac 2280 aacgaggaga acgaggacat tctcgaggac atcgtcctca cgctcaccct ctttgaggac 2340 cgtgagatga tcgaggagcg cctcaagacc tacgcccatc tctttgacga caaggtcatg 2400 aagcagctca agcgccgccg ctacaccggc tggggccgcc tttcccgcaa gctcatcaac 2460 ggcatccgcg acaagcagtc tggcaagacc atccttgact ttcttaagtc tgatggtttc 2520 gccaaccgca acttcatgca gctcatccac gaggacagcc tcactttcaa ggaggacatt 2580 cagaaggccc aggtctccgg ccagggtgac tctctccacg aacacatcgc caaccttgct 2640 ggcagcccgg ctattaagaa gggcatcctc cagaccgtca aggtcgtcga cgagctcgtc 2700 aaggttatgg gccgccacaa gcccgagaac atcgtcattg agatggctcg cgaaaaccag 2760 accacccaga agggtcagaa gaactcccgc gagcgcatga agcgtatcga ggagggcatc 2820 aaggagctcg gcagccagat cctcaaggag cacccggtcg agaacaccca gctccagaac 2880 gaaaagctct acctctacta cctccagaac ggccgtgaca tgtacgttga ccaggagctc 2940 gacattaacc gcctctccga ttacgacgtc gaccatattg tcccccagag ctttctcaag 3000 gacgacagca tcgacaacaa ggtcctcacc cgctcggaca agaaccgcgg caagtccgac 3060 aacgtccctt ccgaggaggt cgtgaagaag atgaagaact actggcgcca gcttctcaac 3120 gctaagctta ttactcagcg caagttcgat aacctcacca aggccgaacg cggcggcctc 3180 tccgagctcg acaaggccgg ttttatcaag cgccagctcg ttgagactcg ccagatcacc 3240 aagcacgtgg cgcagatcct cgactcgcgc atgaacacga agtacgacga gaacgacaag 3300 ctcatccgcg aggtcaaggt catcaccctt aagtcgaagc tcgtgtccga ctttcgcaag 3360 gacttccagt tctacaaggt ccgtgaaatt aacaactacc accacgctca cgacgcttac 3420 ctcaacgcgg tcgtgggtac cgcgctcatc aagaagtacc cgaagctcga gtcggagttt 3480 gtctacggcg actacaaggt ctacgacgtg cgcaagatga tcgccaagtc cgagcaggag 3540 atcggcaagg ccacggccaa gtactttttc tactccaaca ttatgaactt ctttaagact 3600 gagatcaccc ttgccaacgg cgagatccgc aagcgccccc ttatcgagac caacggcgag 3660 accggcgaaa ttgtgtggga taagggtcgc gactttgcca ccgtccgcaa ggtcctcagc 3720 atgccccagg tcaacattgt taagaagacc gaggtccaga cgggcggctt tagcaaggag 3780 tctatcctcc ccaagcgtaa cagcgacaag ctcatcgccc gcaagaagga ctgggaccct 3840 aagaagtacg gcggcttcga ttcgcctacg gtcgcctaca gcgtcctcgt cgtcgccaag 3900 gtcgagaagg gcaagtccaa gaagctcaag tccgtcaagg agctcctcgg catcacgatc 3960 atggagcgct ccagctttga gaagaacccc attgacttcc tcgaggctaa gggttacaag 4020 gaggtcaaga aggaccttat catcaagctc cccaagtact ccctctttga gctcgaaaac 4080 ggccgcaagc gtatgctcgc tagcgctggc gaactccaga agggcaacga gctcgccctc 4140 cccagcaagt acgtcaactt tctctacctc gcctcccact acgagaagct caagggtagc 4200 ccggaggata acgagcagaa gcagcttttt gtggagcagc acaagcacta ccttgacgag 4260 atcattgaac agatctccga gttctccaag cgtgttattc ttgctgacgc caacctcgat 4320 aaggtgctct ccgcgtacaa caagcaccgc gacaagccta tccgcgagca ggccgagaac 4380 atcatccacc tctttaccct caccaacctc ggcgccccgg ccgcctttaa gtactttgat 4440 acgactatcg accgcaagcg ctacacttcg actaaggagg tcctcgacgc taccctcatt 4500 caccagtcca ttaccggcct ctacgagacc cgcattgacc tttcgcagct cggtggcgac 4560 tcgcgtgcgg accctaagaa gaagcgcaag gtctaacata tgatctaaac tagtgaatcg 4620 cgacaagttg tctttttgtt actctacgta ctgctctttc taattttacg acgtatgctt 4680 ctgctcttga cgacgacaac catggcaata aaagtaaggc aagaagtgag tgcgtgctcg 4740 ctcacaaggt ctaggccgaa acgaggcgcc ttaggattgg ttgtctccgt cgtaagtcat 4800 gacggagcgt aggacaccga cggcctgccg cgcaaatata cgaaccgctg cacaattctt 4860 ttcgttgaga acaacctcga acggcctgcc ttgctgagct gccgacacgg tggaaggaag 4920 catagcggcc aatcgagggg atgctattaa ttaggcttgg cgctgctgcc gccgtgcctg 4980 aagatgtgcg caagcgtggc aacaccgtcc accttgccat taaagtcatg cactccaaat 5040 acctcgaaca gagcctctcg catgtttggc caagcacctt cgagagagtc tggactctca 5100 ctccttcctc accgttgtcg ccattctcag cgagctcatg caatcaccag gacggagaga 5160 cggccagctg cttttctgct ttccattgtt attagagaaa cgcttctcgc tctcatcgtc 5220 ttagtagaca ttccgatggc ttcgttcgcc aatttgtcac ctaagtaagc tagagtgtta 5280 agtctaaatg cctttgaccc gcgtacggcg tcacgtagat gcctgtcctt gccagcaaac 5340 gctagttcgc ggtgtgcgta atttggcccg cattatgctg gctctcaaaa tcaaccgcca 5400 ccactcgcgg ctgcacgatg attttcgtgc actcatgaca tgagaaatgt gatactcaaa 5460 ctagtataga cctcctactc ctactgctgc ttttctcgtc agagctgtct ccggaaaagt 5520 tgacaagttg ttggccttct tcttctctgc tagtaagtag atcatcatgg atgagacgat 5580 gatgataatg atgatgatga taatttaaat ctcgagacct tcgagcgctg ctaatttcgc 5640 ctgacgctcc ttcttttgtg cttccatgac acgccgcttc accgtgcgtt ccacttcttc 5700 ctcagacatg cccttggctg cctcgacctg ctcggtaaaa cgggccccag cacgtgctac 5760 gagattcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg 5820 acgccggctg gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccacccca 5880 acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 5940 ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 6000 atcatacatg gtcgacctgc aggaacctgc attaatgaat cggccaacgc gcggggagag 6060 gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 6120 ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 6180 caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 6240 aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 6300 atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 6360 cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 6420 ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 6480 gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 6540 accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 6600 cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 6660 cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct 6720 gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 6780 aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 6840 aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 6900 actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt 6960 taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca 7020 gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca 7080 tagttgcctg actccccgtc gtgtagataa ctacgatacg ggagggctta ccatctggcc 7140 ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcaataa 7200 accagccagc cggaagggcc gagcgcagaa gtggtcctgc aactttatcc gcctccatcc 7260 agtctatta ttgttgccgg gaagctagag taagtagttc gccagttaat agtttgcgca 7320 acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgtttggt atggcttcat 7380 tcagctccgg ttcccaacga tcaaggcgag ttacatgatc ccccatgttg tgcaaaaaag 7440 cggttagctc cttcggtcct ccgatcgttg tcagaagtaa gttggccgca gtgttatcac 7500 tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgctttt 7560 ctgtgactgg tgagtactca accaagtcat tctgagaata gtgtatgcgg cgaccgagtt 7620 gctcttgccc ggcgtcaata cgggataata ccgcgccaca tagcagaact ttaaaagtgc 7680 tcatcattgg aaaacgttct tcggggcgaa aactctcaag gatcttaccg ctgttgagat 7740 ccagttcgat gtaacccact cgtgcaccca actgatcttc agcatctttt actttcacca 7800 gcgtttctgg gtgagcaaaa acaggaaggc aaaatgccgc aaaaaaggga ataagggcga 7860 cacggaaatg ttgaatactc atactcttcc tttttcaata ttattgaagc atttatcagg 7920 gttattgtct catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 7980 ttccgcgcac atttccccga aaagtgccac ctgacgtcta agaaaccatt attatcatga 8040 cattaaccta taaaaatagg cgtatcacga ggccctttcg tctcgcgcgt ttcggtgatg 8100 acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt ctgtaagcgg 8160 atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg tgtcggggct 8220 ggcttaacta tgcggcatca gagcagattg tactgagagt gcaccaagct tatttaaatc 8280 tttatcggtg tggcgcgcct tgacggccgc ctcggattca cttcgcaggg cacttctgac 8340 gcgctcaagc gtgcccagcg tggtgccatc tttggcctct gcaagaccat cggcctcgag 8400 tggtccgagt ctgacgtctt ttcccgcggc gtggacattg ctcagggcat gcaccccgag 8460 gatgccgccg tggcgattgt gcgcgagatg gcgtgcgctg acattcgcat tcgcgaggtc 8520 ggcattggcg caaaccagca gcgctgcacg atccgtgccg ccaagctcga gaccggcaac 8580 ccgcagcgcc agatcgccaa ggacgacgtg ctgctcgttt ctggcggcgc tcgcggcatc 8640 acgcctcttt gcatccggga gatcacgcgc cagatcgcgg gcggcaagta cattctgctt 8700 ggccgcagca aggtctctgc gagcgaaccg gcatggtgcg ctggcatcac tgacgagaag 8760 gctgtgcaaa aggctgctac ccaggagctc aagcgcgcct ttagcgctgg cgagggcccc 8820 aagcccacgc cccgcgctgt cactaagctt gtgggctctg ttcttggcgc tcgcgaggtg 8880 cgcagctcta ttgctgcgat tgaagcgctc ggcggcaagg ccatctactc gtcgtgcgac 8940 gtgaactctg ccgccgacgt ggccaaggcc gtgcgcgatg ccgagtccca gctcggtgcc 9000 cgcgtctcgg gcatcgttca tgcctcgggc gtgctccgcg accgtctcat cgagaagaag 9060 ctccccgacg agttcgacgc cgtctttggc accaaggtca ccggtctcga gaacctcctc 9120 gccgccgtcg accgcgccaa cctcaagcac atggtcctct tcagctcgct cgccggcttc 9180 cacggcaacg tcggccagtc tgactacgcc atggccaacg aggcccttaa caagatgggc 9240 ctcgagctcg ccaaggacgt ctcggtcaag tcgatctgct aagaaagtga accttgtcct 9300 aacccgacag cgaatggcgg gagggggcgg gctaaaagat cgtattacat agtattttcc 9360 cctactcttt gtgtttgtct tttttttttt tgaacgcatt caagccactt gtcttggttt 9420 acttgtttgt ttgcttgctt gcttgcttgc ttgcctgctt cttggtcaga cggacccaaa 9480 aaagggaaaa aattcattca tggcacagat aagaaaaaga aaaagtttgt cgaccaccgt 9540 catcagaaag caagagaaga gaaacactcg cgctcacatt ctcgctcgcg taagaatcaa 9600 gcttccaatt ttaggccccc cactgaccga ggtctgtcga taatccactt ttccattgat 9660 tttccaggtt tcgttaactc atgccactga gcaaaacttc ggtctttcct aacaaaagct 9720 ctcctcacaa agcatggcgc ggcaacggac gtgtcctcat actccactgc cacacaaggt 9780 cgataaacta agctcctcac aaatagagga gaattccact gacaactgaa aacaatgtat 9840 gagagacgat caccactgga gcggcgcggc ggttgggcgc ggaggtcggc agcaaaaaca 9900 agcgactcgc cgagcaaacc cgaatcagcc ttcagacggt cgtgcctaac aacacgccgt 9960 tctaccccgc cttcttcgcg ccccttcgcg tccaagcatc cttcaagttt atctctctag 10020 ttcaacttca agaagaacaa caccaccaac accatggcca agttgaccag tgccgttccg 10080 gtgctcaccg cgcgcgacgt cgccggagcg gtcgagttct ggaccgaccg gctcgggttc 10140 tcccgggact tcgtggagga cgacttcgcc ggtgtggtcc gggacgacgt gaccctgttc 10200 atcagcgcgg tccaggacca ggtggtgccg gacaacaccc tggcctgggt gtgggtgcgc 10260 ggcctggacg agctgtacgc cgagtggtcg gaggtcgtgt ccacgaactt ccgggacgcc 10320 tccgggccgg ccatgaccga gatcggcgag cagccgtggg ggcgggagtt cgccctgcgc 10380 gacccggccg gcaactgcgt gcacttcgtg gccgaggagc aggactgaca cgtgctacga 10440 gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 10500 gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 10560 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 10620 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 10680 catgtctgaa ttcccggggt ac 10702 <210> 4 <211> 11332 <212> DNA <213> Artificial Sequence <220> <223> pYB33 vector <220> <221> misc_feature <222> (2)..(1006) <223> CS_promoter <220> <221> misc_feature <222> (1013)..(5152) <223> Cas9 <220> <221> misc_feature <222> (5159)..(6158) <223> OrfA_terminator <220> <221> misc_feature <222> (8836)..(9835) <223> OrfA_UP_homology <220> <221> misc_feature <222> (9839)..(10154) <223> OrfC_terminator <220> <221> misc_feature <222> (10161)..(10609) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (10610)..(10984) <223> Sh_ble_gene <220> <221> misc_feature <222> (10985)..(11258) <223> SV40_terminator <400> 4 cgagcgggcg attccaccgt caactggtct tcgcctgtgc cttccagcgc agtgcgcctt 60 gccccgctcg gtcttattat tcttggcgct ctcgtcaatg tgatcatgat ctagtcgaac 120 gtgcaatcta gccaatgaaa aaagagtcca gttctatctg aatttttcac tttctaaatc 180 tcgcatcgac aatctacttt tcaaatctcg caacaaagct gatcttgttt ctccctcacc 240 cagttctatc tgaatttttc cttttctgaa gctcgcgtta acaatctact tttcgaatct 300 gtcaacaaag ctgatcttgt ttctcccccc tatccccttc cctcccccct tctttgggat 360 cttgttgtgc gtgtcgcccc ttcaacttct ttgttcgacg atgacctcca cctagcctgt 420 gaagctcatc gtctccgagt atttctggcc tgctccaatt cctctcttcc attctccatc 480 gcatacatgc atgttctttg gtctcactcc gagccatgct tcttcggtca ctacttcatc 540 tatttgacta ggcctctgtt cgagcgacga accctccgtg ttcgcgggtg ttcattctct 600 gcaaagtggt ccgtaaccgt gactaccgga cacctcgcgt acactacatt cgggacggac 660 gcggccgagc gcgacgtctc tgggcccggc ctgccgcccc cggggccgcg gcttcctcgc 720 gccgccagcc gcgtccaagt cgccagcgcg aggtcgcgcg agtcgaagga gacgttgtcg 780 atctcgaccc tcgccatgcg cgtgacgggt gaccgcctca ccggatcccg ccctccgcgc 840 gctgccttca ttccttcatt ccttcattcc ttcactcaat cctgcatcat ccatcgcccg 900 cccgcccgct cgcacgcacc agaggcgcgc attgcgggcc agggcgccgc ctgcagaccg 960 ccatcgcgcc cgccttctgc cgcgcctcgc tcgctcggag accgagggat ccatggataa 1020 gaagtactcg atcggcctcg acattggcac caacagcgtc ggctgggccg tcattactga 1080 tgagtacaag gtcccgtcga agaagtttaa ggtcctcggc aacactgacc gccactccat 1140 caagaagaac ctcatcggtg ccctcctttt tgactccggc gagaccgctg aggccactcg 1200 cctcaagcgc actgcccgcc gccgttacac ccgccgcaag aaccgcatct gctacctcca 1260 ggagattttc tcgaacgaaa tggccaaggt cgatgactcc tttttccacc gtctcgaaga 1320 atcgttcctc gtcgaggagg acaagaagca cgagcgccac cccatcttcg gtaacattgt 1380 cgatgaggtt gcctaccacg agaagtaccc gaccatctac cacctccgca agaagctcgt 1440 cgactccacc gacaaggccg atctccgcct tatctacctc gccctcgccc acatgatcaa 1500 gttccgcggc cactttctta tcgagggtga tctcaaccct gataactctg acgtcgacaa 1560 gcttttcatc cagctcgtcc agacttacaa ccagctcttc gaggagaacc ccatcaacgc 1620 ttccggcgtc gacgcgaagg ccattctcag cgcccgcctc agcaagtccc gccgcctcga 1680 aaacctcatt gcccagcttc ccggcgagaa gaagaacggc ctcttcggca acctcattgc 1740 cctcagcctt ggcctcaccc ctaacttcaa gtcgaacttt gacctcgccg aggacgccaa 1800 gctccagctt tccaaggaca cttacgacga cgatctcgac aacctcctcg ctcagattgg 1860 cgaccagtac gctgacctct tcctcgccgc caagaacctt agcgatgcca tcctcctctc 1920 cgacatcctt cgtgttaaca cggaaatcac gaaggctccg ctctccgcct ccatgatcaa 1980 gcgttacgac gagcaccatc aggacctcac cctcctcaag gccctcgtcc gccagcagct 2040 ccccgagaag tacaaggaga tcttcttcga ccagagcaag aacggctacg ccggctacat 2100 tgacggcggc gcgtcgcagg aggagtttta caagtttatc aagcccattc ttgagaagat 2160 ggacggcacc gaggagctcc tcgtcaagct caaccgtgag gaccttctcc gcaagcagcg 2220 cacgttcgac aacggctcta ttccccatca gatccacctc ggtgagcttc acgcgattct 2280 tcgccgccag gaagactttt acccgttcct caaggacaac cgcgagaaga ttgagaagat 2340 cctcaccttt cgcattccct actacgtcgg ccccctcgcc cgcggcaact cgcgctttgc 2400 ttggatgacc cgcaagtccg aggagaccat caccccgtgg aacttcgaag aggtcgtcga 2460 caagggcgcc tccgcgcagt ctttcatcga gcgcatgact aactttgaca agaacctccc 2520 gaacgagaag gtcctcccca agcacagcct cctttacgaa tactttacgg tgtacaacga 2580 gctcacgaag gtcaagtacg tcactgaggg catgcgcaag ccggcgttcc tttcgggcga 2640 gcagaagaag gctatcgtcg acctcctttt caagaccaac cgcaaggtta ccgtcaagca 2700 gctcaaggag gactacttca agaagatcga gtgctttgac tcggtcgaga tttcgggcgt 2760 ggaggaccgt ttcaacgcct ccctcggcac ttaccacgac cttctcaaga tcatcaagga 2820 caaggacttt ctcgacaacg aggagaacga ggacattctc gaggacatcg tcctcacgct 2880 caccctcttt gaggaccgtg agatgatcga ggagcgcctc aagacctacg cccatctctt 2940 tgacgacaag gtcatgaagc agctcaagcg ccgccgctac accggctggg gccgcctttc 3000 ccgcaagctc atcaacggca tccgcgacaa gcagtctggc aagaccatcc ttgactttct 3060 taagtctgat ggtttcgcca accgcaactt catgcagctc atccacgacg acagcctcac 3120 tttcaaggag gacattcaga aggcccaggt ctccggccag ggtgactctc tccacgaaca 3180 catcgccaac cttgctggca gcccggctat taagaagggc atcctccaga ccgtcaaggt 3240 cgtcgacgag ctcgtcaagg ttatgggccg ccacaagccc gagaacatcg tcattgagat 3300 ggctcgcgaa aaccagacca cccagaaggg tcagaagaac tcccgcgagc gcatgaagcg 3360 tatcgaggag ggcatcaagg agctcggcag ccagatcctc aaggagcacc cggtcgagaa 3420 cacccagctc cagaacgaaa agctctacct ctactacctc cagaacggcc gtgacatgta 3480 cgttgaccag gagctcgaca ttaaccgcct ctccgattac gacgtcgacc atattgtccc 3540 ccagagcttt ctcaaggacg acagcatcga caacaaggtc ctcacccgct cggacaagaa 3600 ccgcggcaag tccgacaacg tcccttccga ggaggtcgtg aagaagatga agaactactg 3660 gcgccagctt ctcaacgcta agcttattac tcagcgcaag ttcgataacc tcaccaaggc 3720 cgaacgcggc ggcctctccg agctcgacaa ggccggtttt atcaagcgcc agctcgttga 3780 gactcgccag atcaccaagc acgtggcgca gatcctcgac tcgcgcatga acacgaagta 3840 cgacgagaac gacaagctca tccgcgaggt caaggtcatc acccttaagt cgaagctcgt 3900 gtccgacttt cgcaaggact tccagttcta caaggtccgt gaaattaaca actaccacca 3960 cgctcacgac gcttacctca acgcggtcgt gggtaccgcg ctcatcaaga agtacccgaa 4020 gctcgagtcg gagtttgtct acggcgacta caaggtctac gacgtgcgca agatgatcgc 4080 caagtccgag caggagatcg gcaaggccac ggccaagtac tttttctact ccaacattat 4140 gaacttcttt aagactgaga tcacccttgc caacggcgag atccgcaagc gccccccttat 4200 cgagaccaac ggcgagaccg gcgaaattgt gtgggataag ggtcgcgact ttgccaccgt 4260 ccgcaaggtc ctcagcatgc cccaggtcaa cattgttaag aagaccgagg tccagacggg 4320 cggctttagc aaggagtcta tcctccccaa gcgtaacagc gacaagctca tcgcccgcaa 4380 gaaggactgg gaccctaaga agtacggcgg cttcgattcg cctacggtcg cctacagcgt 4440 cctcgtcgtc gccaaggtcg agaagggcaa gtccaagaag ctcaagtccg tcaaggagct 4500 cctcggcatc acgatcatgg agcgctccag ctttgagaag aaccccattg acttcctcga 4560 ggctaagggt tacaaggagg tcaagaagga ccttatcatc aagctcccca agtactccct 4620 ctttgagctc gaaaacggcc gcaagcgtat gctcgctagc gctggcgaac tccagaaggg 4680 caacgagctc gccctcccca gcaagtacgt caactttctc tacctcgcct cccactacga 4740 gaagctcaag ggtagcccgg aggataacga gcagaagcag ctttttgtgg agcagcacaa 4800 gcactacctt gacgagatca ttgaacagat ctccgagttc tccaagcgtg ttattcttgc 4860 tgacgccaac ctcgataagg tgctctccgc gtacaacaag caccgcgaca agcctatccg 4920 cgagcaggcc gagaacatca tccacctctt taccctcacc aacctcggcg ccccggccgc 4980 ctttaagtac tttgatacga ctatcgaccg caagcgctac acttcgacta aggaggtcct 5040 cgacgctacc ctcattcacc agtccattac cggcctctac gagacccgca ttgacctttc 5100 gcagctcggt ggcgactcgc gtgcggaccc taagaagaag cgcaaggtct aacatatgat 5160 ctaaactagt gaatcgcgac aagttgtctt tttgttactc tacgtactgc tctttctaat 5220 tttacgacgt atgcttctgc tcttgacgac gacaaccatg gcaataaaag taaggcaaga 5280 agtgagtgcg tgctcgctca caaggtctag gccgaaacga ggcgccttag gattggttgt 5340 ctccgtcgta agtcatgacg gagcgtagga caccgacggc ctgccgcgca aatatacgaa 5400 ccgctgcaca attcttttcg ttgagaacaa cctcgaacgg cctgccttgc tgagctgccg 5460 acacggtgga aggaagcata gcggccaatc gaggggatgc tattaattag gcttggcgct 5520 gctgccgccg tgcctgaaga tgtgcgcaag cgtggcaaca ccgtccacct tgccattaaa 5580 gtcatgcact ccaaatacct cgaacagagc ctctcgcatg tttggccaag caccttcgag 5640 agagtctgga ctctcactcc ttcctcaccg ttgtcgccat tctcagcgag ctcatgcaat 5700 caccaggacg gagagacggc cagctgcttt tctgctttcc attgttatta gagaaacgct 5760 tctcgctctc atcgtcttag tagacattcc gatggcttcg ttcgccaatt tgtcacctaa 5820 gtaagctaga gtgttaagtc taaatgcctt tgacccgcgt acggcgtcac gtagatgcct 5880 gtccttgcca gcaaacgcta gttcgcggtg tgcgtaattt ggcccgcatt atgctggctc 5940 tcaaaatcaa ccgccaccac tcgcggctgc acgatgattt tcgtgcactc atgacatgag 6000 aaatgtgata ctcaaactag tatagacctc ctactcctac tgctgctttt ctcgtcagag 6060 ctgtctccgg aaaagttgac aagttgttgg ccttcttctt ctctgctagt aagtagatca 6120 tcatggatga gacgatgatg ataatgatga tgatgataat ttaaatctcg agaccttcga 6180 gcgctgctaa tttcgcctga cgctccttct tttgtgcttc catgacacgc cgcttcaccg 6240 tgcgttccac ttcttcctca gacatgccct tggctgcctc gacctgctcg gtaaaacggg 6300 ccccagcacg tgctacgaga tttcgattcc accgccgcct tctatgaaag gttgggcttc 6360 ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct catgctggag 6420 ttcttcgccc accccaactt gtttattgca gcttataatg gttacaaata aagcaatagc 6480 atcacaaatt tcacaaataa agcatttttt tcactgcatt ctagttgtgg tttgtccaaa 6540 ctcatcaatg tatcttatca tacatggtcg acctgcagga acctgcatta atgaatcggc 6600 caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac 6660 tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata 6720 cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa 6780 aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 6840 gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 6900 agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 6960 cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca 7020 cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 7080 ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 7140 gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 7200 tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga 7260 acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 7320 tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 7380 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 7440 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc 7500 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag 7560 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt 7620 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag 7680 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca 7740 gattatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact 7800 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca 7860 gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg 7920 tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc 7980 atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg 8040 gccgcagtgt tattactcat ggttatggca gcactgcata attctcttac tgtcatgcca 8100 tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt 8160 atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc 8220 agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc 8280 ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca 8340 tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa 8400 aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat 8460 tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa 8520 aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgtctaagaa 8580 accattata tcatgacatt aacctataaa aataggcgta tcacgaggcc ctttcgtctc 8640 gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca 8700 gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt 8760 ggcgggtgtc ggggctggct taactatgcg gcatcagagc agattgtact gagagtgcac 8820 caagcttatt taaatcttta tcggtgtggc gcgccttgac ggccgcctcg gattcacttc 8880 gcagggcact tctgacgcgc tcaagcgtgc ccagcgtggt gccatctttg gcctctgcaa 8940 gaccatcggc ctcgagtggt ccgagtctga cgtcttttcc cgcggcgtgg acattgctca 9000 gggcatgcac cccgaggatg ccgccgtggc gattgtgcgc gagatggcgt gcgctgacat 9060 tcgcattcgc gaggtcggca ttggcgcaaa ccagcagcgc tgcacgatcc gtgccgccaa 9120 gctcgagacc ggcaacccgc agcgccagat cgccaaggac gacgtgctgc tcgtttctgg 9180 cggcgctcgc ggcatcacgc ctctttgcat ccgggagatc acgcgccaga tcgcgggcgg 9240 caagtacatt ctgcttggcc gcagcaaggt ctctgcgagc gaaccggcat ggtgcgctgg 9300 catcactgac gagaaggctg tgcaaaaggc tgctacccag gagctcaagc gcgcctttag 9360 cgctggcgag ggccccaagc ccacgccccg cgctgtcact aagcttgtgg gctctgttct 9420 tggcgctcgc gaggtgcgca gctctattgc tgcgattgaa gcgctcggcg gcaaggccat 9480 ctactcgtcg tgcgacgtga actctgccgc cgacgtggcc aaggccgtgc gcgatgccga 9540 gtcccagctc ggtgcccgcg tctcgggcat cgttcatgcc tcgggcgtgc tccgcgaccg 9600 tctcatcgag aagaagctcc ccgacgagtt cgacgccgtc tttggcacca aggtcaccgg 9660 tctcgagaac ctcctcgccg ccgtcgaccg cgccaacctc aagcacatgg tcctcttcag 9720 ctcgctcgcc ggcttccacg gcaacgtcgg ccagtctgac tacgccatgg ccaacgaggc 9780 ccttaacaag atgggcctcg agctcgccaa ggacgtctcg gtcaagtcga tctgctaaga 9840 aagtgaacct tgtcctaacc cgacagcgaa tggcgggagg gggcgggcta aaagatcgta 9900 ttacatagta ttttccccta ctctttgtgt ttgtcttttt tttttttgaa cgcattcaag 9960 ccacttgtct tggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg 10020 gtcagacgga cccaaaaaag ggaaaaaatt cattcatggc acagataaga aaaagaaaaa 10080 gtttgtcgac caccgtcatc agaaagcaag agaagagaaa cactcgcgct cacattctcg 10140 ctcgcgtaag aatcaagctt ccaattttag gccccccact gaccgaggtc tgtcgataat 10200 ccacttttcc attgattttc caggtttcgt taactcatgc cactgagcaa aacttcggtc 10260 tttcctaaca aaagctctcc tcacaaagca tggcgcggca acggacgtgt cctcatactc 10320 cactgccaca caaggtcgat aaactaagct cctcacaaat agaggagaat tccactgaca 10380 actgaaaaca atgtatgaga gacgatcacc actggagcgg cgcggcggtt gggcgcggag 10440 gtcggcagca aaaacaagcg actcgccgag caaacccgaa tcagccttca gacggtcgtg 10500 cctaacaaca cgccgttcta ccccgccttc ttcgcgcccc ttcgcgtcca agcatccttc 10560 aagtttatct ctctagttca acttcaagaa gaacaacacc accaacaccc caattttagg 10620 ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc aggtttcgtt 10680 aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct cacaaagcat 10740 ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata aactaagctc 10800 ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag acgatcacca 10860 ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga ctcgccgagc 10920 aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac cccgccttct 10980 tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa cttcaagaag 11040 aacaacacca ccaacaccca cgtgctacga gatttcgatt ccaccgccgc cttctatgaa 11100 aggttgggct tcggaatcgt tttccgggac gccggctgga tgatcctcca gcgcggggat 11160 ctcatgctgg agttcttcgc ccaccccaac ttgtttattg cagcttataa tggttacaaa 11220 taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca ttctagttgt 11280 ggtttgtcca aactcatcaa tgtatcttat catgtctgaa ttcccggggt ac 11332 <210> 5 <211> 4777 <212> DNA <213> Artificial Sequence <220> <223> pCL399 vector <220> <221> misc_feature <222> (1)..(2523) <223> FAS_fragment <220> <221> misc_feature <222> (2528)..(4777) <223> pSP73_fragment <400> 5 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gcctcgagca 1200 acaaaagaag cagcagcagc agcagcacga gcagcagcag cagcagcacg agcagcagca 1260 gcacgagcag cagcagcagc agcagcaaga tggcgcagcc cgagtcgacg acgccgacca 1320 tgacgcccga ggaaggccag atggaggggg cgccgcagca ggataatgcc caggtgaaga 1380 agcactgctt cgccgacgcc gatgtggcaa cctgcatcgc cgcctttggc ggtcagggaa 1440 gcgactggct cagtgagctg cgctccctcc aggaaaaggg ccagaccaac gtgcgagaaa 1500 ccatcgaact cgcactcgac aaactcgagg atcttgtcaa ggccgagccc tggtacgagg 1560 agcacggagg atgcgatatc cgcgcctggc tcgagagcga cgacaatgtc cccaacttcg 1620 acctcctccg ctacgcgccc gtctccttcc ccctcatctt cctcacccaa atgtgcaatt 1680 acatgcgtgt cctcgagaaa ctcggcacct gccatgaaga cgccctccaa aagggctggg 1740 tcaaggcctc gctcggacac agccagggcg tcgtctccgc cgccgtcgtt gccgcagcca 1800 acaccgaccg cgagctgcgc aacctcgtgg tctccggcct cgaatacatg tcaaaagtcg 1860 gcatcgccgc ccagcgcacg ctcgactacg agctcggacg ccgcaacgcc ggcccggaga 1920 ccccgatgct cgctgtacag ggaatggacg aaaaagtcct taccaaggcc ttcaaggccg 1980 ccgtctcgct ctccaacgag aagcaggcca tgatggccaa aatctcccca cggccgccgc 2040 cgccaccgcc gccccggccg ccgttagcga cgaagatcgc ttctccatcg ccctccgcaa 2100 cggccacgac gactttgtcg tctgcggcga gcccaaggac ctgcgcgtcc tccgcaaggt 2160 catcgagaaa cagagcgccg agcccggcaa ggaggcacag gcgcgcacgc ccttttccaa 2220 gcgcaagccc gtcacccaga ccaccttcct ccgcatgacg gccgtcttcc acagcgctct 2280 caacaaggac gccctcgccc agatcaacac atgggccccg gagtccgcct ttagcaaggc 2340 cttcgcccag gcctcgctcc gtgttcccgt ctttgacacc aagtctggcg ctaatctgca 2400 agatgttccc gccgccgatg ttgtcgccca tcttaccacc aacatgctca ctgagcgcgc 2460 cgacgttctc gtctccctcc gtgccgccga gaccaagacc gacgccagcc acctcctctg 2520 tttaaacgtt aacctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 2580 tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 2640 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 2700 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 2760 gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 2820 tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 2880 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 2940 ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt 3000 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 3060 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 3120 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 3180 gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 3240 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 3300 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 3360 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 3420 gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg 3480 aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 3540 aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 3600 ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 3660 gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 3720 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 3780 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 3840 tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 3900 ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt 3960 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 4020 agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 4080 gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 4140 gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 4200 acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta 4260 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg 4320 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg 4380 aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat 4440 gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt 4500 tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa 4560 aaataggcgt atcacgaggc cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct 4620 ctgacacatg cagctcccgg agacggtcac agcttgtctg taagcggatg ccgggagcag 4680 acaagcccgt cagggcgcgt cagcgggtgt tggcgggtgt cggggctggc ttaactatgc 4740 ggcatcagag cagattgtac tgagagtgca ccatatg 4777 <210> 6 <211> 4775 <212> DNA <213> Artificial Sequence <220> <223> pCL400 vector <220> <221> misc_feature <222> (1)..(2528) <223> Fas_fragment <220> <221> misc_feature <222> (2533)..(4775) <223> pSP73_fragment <400> 6 ccatggttta aactcgcggc gtcttcgccg tcgaggcgcg tctttcgagg cgggcgaggt 60 gtttttcttt tcttttcttc tcgctgcagc tgcgccgcgg cgaacgcagt tcgccgcggc 120 ggctgcgacg cgcctgcgat gtctatgcgc aggcaaggca cgacgtcttg cggcgccgct 180 tcctgcgccg ccttgcgtct tggccccgcc gacgacgcaa gcagcggcgg cgcccccccg 240 ccctcctcca ctgtgggccg cagccctcct tttcgcgcgc ccgcagccgc gcggcgcgcc 300 ccgcgaacaa agagccgccg cgccggtccg cactgcgcgg gccgccccgc aagtgccgca 360 aacgccggcc cgaaccgccg caaacgcgcc cgcagccgcg cccgcagccg cgcgcgaccc 420 gcggtgggga cgcgcgccaa gcgtcccctt ccgcgggatg acgtaggcgg cggccccgcc 480 tatgcaatac gggaggaacc aggaaccggg aggggggggg ggcggcgcgc gcgccgtcca 540 gtgcgggacc gatcggcgcc gggatgcccg ggcgggaggg acacagccag gcagtcagtc 600 agtcagccgc acagagagag cgcgcctgcg agtcccgtct ggtctcggaa ttgtatcccg 660 cgcagagctc agaatcgcag gtcgatcgat cgagcgatgg atccatcgct ctatccgtcc 720 atcgatccat cgcatccatc gcatccatcg catccatcgt tgcatcgctt gcaccgcccg 780 cttgcatcgc gtgcgtgcgc aggcgggcgg cggccacgac gcgaccgaga gcggcggcga 840 gtgcagacgc cgccggcgcc cgcggctgcg tcgccgcagg aagaaggagg ggggcgcgtg 900 tttcccgcgg gagggaggag ggagggaggg aggtggttgg gccaaaaagg gcggcctgga 960 caggcaggca ggccggaagc gacgccagcg agcgaaggaa gaggagagag ccgcgcgggc 1020 ggccagcgcg gggcgggcgg cagcaaaccc gctactcagg gtaaaagaca gacagctctt 1080 cgagcgagct tgttcacttc gcggaagcac gcgcgcaggc acgcaggcac gcaggcagca 1140 tagcgagcag cagcagcatc gcgagcagca ttgcgagagg aggcgctgac cgccggcctc 1200 gagcaacaaa agaagcagca gcagcagcag cacgagcagc agcagcagca gcacgagcag 1260 cagcagcacg agcagcagca gcagcagcag caagatggcg cagcccgagt cgacgacgcc 1320 gaccatgacg cccgaggaag gccagatgga gggggcgccg cagcaggata atgcccaggt 1380 gaagaagcac tgcttcgccg acgccgatgt ggcaacctgc atcgccgcct ttggcggtca 1440 gggaagcgac tggctcagtg agctgcgctc cctccaggaa aagggccaga ccaacgtgcg 1500 agaaaccatc gaactcgcac tcgacaaact cgaggatctt gtcaaggccg agccctggta 1560 cgaggagcac ggaggatgcg atatccgcgc ctggctcgag agcgacgaca atgtccccaa 1620 cttcgacctc ctccgctacg cgcccgtctc cttccccctc atcttcctca cccaaatgtg 1680 caattacatg cgtgtcctcg agaaactcgg cacctgccat gaagacgccc tccaaaaggg 1740 ctgggtcaag gcctcgctcg gacacagcca gggcgtcgtc tccgccgccg tcgttgccgc 1800 agccaacacc gaccgcgagc tgcgcaacct cgtggtctcc ggcctcgaat acatgtcaaa 1860 agtcggcatc gccgcccagc gcacgctcga ctacgagctc ggacgccgca acgccggccc 1920 ggagaccccg atgctcgctg tacagggaat ggacgaaaaa gtccttacca aggccttcaa 1980 ggccgccgtc tcgctctcca acgagaagca ggccatgatg gccaaaatct ccccacggcc 2040 gccgccgcca ccgccgcccc ggccgccgtt agcgacgaag atcgcttctc catcgccctc 2100 cgcaacggcc acgacgactt tgtcgtctgc ggcgagccca aggacctgcg cgtcctccgc 2160 aaggtcatcg agaaacagag cgccgagccc ggcaaggagg cacaggcgcg cacgcccttt 2220 tccaagcgca agcccgtcac ccagaccacc ttcctccgca tgacggccgt cttccacagc 2280 gctctcaaca aggacgccct cgcccagatc aacacatggg ccccggagtc cgcctttagc 2340 aaggccttcg cccaggcctc gctccgtgtt cccgtctttg acaccaagtc tggcgctaat 2400 ctgcaagatg ttcccgccgc cgatgttgtc gcccatctta ccaccaacat gctcactgag 2460 cgcgccgacg ttctcgtctc cctccgtgcc gccgagacca agaccgacgc cagccacctc 2520 ctctgtttaa acgttaacct gcattaatga atcggccaac gcgcggggag aggcggtttg 2580 cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 2640 cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 2700 aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 2760 gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 2820 tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 2880 agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 2940 ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct cagttcggtg 3000 taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 3060 gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 3120 gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 3180 ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 3240 ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 3300 gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 3360 caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt 3420 taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa 3480 aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa 3540 tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 3600 tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 3660 gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 3720 gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 3780 aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 3840 gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 3900 ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 3960 tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 4020 atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 4080 ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 4140 ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 4200 ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 4260 atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 4320 gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 4380 tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 4440 ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 4500 acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat gacattaacc 4560 tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga tgacggtgaa 4620 aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg 4680 agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac 4740 tatgcggcat cagagcagat tgtactgaga gtgca 4775 <210> 7 <211> 5991 <212> DNA <213> Artificial Sequence <220> <223> pCL401 vector <220> <221> misc_feature <222> (1)..(1063) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (1076)..(1112) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (1113)..(1132) <223> carotene_synthase_target_1 <220> <221> misc_feature <222> (1133)..(1212) <223> gRNA <220> <221> misc_feature <222> (1213)..(1280) <223> HDV_ribozyme <220> <221> misc_feature <222> (1300)..(1939) <223> OrfC_terminator <220> <221> misc_feature <222> (4474)..(4922) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (4923)..(5717) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (5718)..(5991) <223> SV40_terminator <400> 7 ctcttatctg cctcgcgccg ttgaccgccg cttgactctt ggcgcttgcc gctcgcatcc 60 tgcctcgctc gcgcaggcgg gcgggcgagt gggtgggtcc gcagccttcc gcgctcgccc 120 gctagctcgc tcgcgccgtg ctgcagccag cagggcagca ccgcacggca ggcaggtccc 180 ggcgcggatc gatcgatcca tcgatccatc gatccatcga tcgtgcggtc aaaaagaaag 240 gaagaagaaa ggaaaaagaa aggcgtgcgc acccgagtgc gcgctgagcg cccgctcgcg 300 gtcccgcgga gcctccgcgt tagtccccgc cccgcgccgc gcagtccccc gggaggcatc 360 gcgcacctct cgccgccccc tcgcgcctcg ccgattcccc gcctcccctt ttccgcttct 420 tcgccgcctc cgctcgcggc cgcgtcgccc gcgccccgct ccctatctgc tccccagggg 480 ggcactccgc accttttgcg cccgctgccg ccgccgcggc cgccccgccg ccctggtttc 540 ccccgcgagc gcggccgcgt cgccgcgcaa agactcgccg cgtgccgccc cgagcaacgg 600 gtggcggcgg cgcggcggcg ggcggggcgc ggcggcgcgt aggcggggct aggcgccggc 660 taggcgaaac gccgcccccg ggcgccgccg ccgcccgctc cagagcagtc gccgcgccag 720 accgccaacg cagagaccga gaccgaggta cgtcgcgccc gagcacgccg cgacgcgcgg 780 cagggacgag gagcacgacg ccgcgccgcg ccgcgcgggg ggggggaggg agaggcagga 840 cgcgggagcg agcgtgcatg tttccgcgcg agacgacgcc gcgcgcgctg gagaggagat 900 aaggcgcttg gatcgcgaga gggccagcca ggctggaggc gaaaatgggt ggagaggata 960 gtatcttgcg tgcttggacg aggagactga cgaggaggac ggatacgtcg atgatgatgt 1020 gcacagagaa gaagcagttc gaaagcgact actagcaagc aagagatcta gcacgctgat 1080 gagtccgtga ggacgaaacg agtaagctcg tctgcggacg tcgtggacgc gcgttttaga 1140 gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa gtggcaccga 1200 gtcggtgctt ttggccggca tggtcccagc ctcctcgctg gcgccggctg ggcaacatgc 1260 ttcggcatgg cgaatgggac catatgagtt atgagatccg aaagtgaacc ttgtcctaac 1320 ccgacagcga atggcgggag ggggcgggct aaaagatcgt attacatagt atttttcccc 1380 tactctttgt gtttgtcttt tttttttttt tgaacgcatt caagccactt gtctgggttt 1440 acttgtttgt ttgcttgctt gcttgcttgc ttgcctgctt cttggtcaga cggcccaaaa 1500 aagggaaaaa attcattcat ggcacagata agaaaaagaa aaagtttgtc gaccaccgtc 1560 atcagaaagc aagagaagag aaacactcgc gctcacattc tcgctcgcgt aagaatctta 1620 gccacgcata cgaagtaatt tgtccatctg gcgaatcttt acatgagcgt tttcaagctg 1680 gagcgtgaga tcataccttt cttgatcgta atgttccaac cttgcatagg cctcgttgcg 1740 atccgctagc aatgcgtcgt actcccgttg caactgcgcc atcgcctcat tgtgacgtga 1800 gttcagattc ttctcgagac cttcgagcgc tgctaatttc gcctgacgct ccttcttttg 1860 tgcttccatg acacgccgct tcaccgtgcg ttccacttct tcctcagaca tgcccttggc 1920 tgcctcgacc tgctcggtaa aacgggcccc agcacgtgct acgagatttc gattccaccg 1980 ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc tggatgatcc 2040 tccagcgcgg ggatctcatg ctggagttct tcgcccaccc caacttgttt attgcagctt 2100 ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 2160 tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcataca tggtcgacct 2220 gcaggaacct gcattaatga atcggccaac gcgcggggag aggcggtttg cgtattgggc 2280 gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 2340 tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 2400 agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 2460 cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 2520 ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 2580 tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 2640 gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 2700 gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 2760 gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 2820 ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 2880 ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg ctgaagccag 2940 ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 3000 gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 3060 ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 3120 tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt 3180 ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca 3240 gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg 3300 tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac 3360 cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg 3420 ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc 3480 gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgcta 3540 caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc ggttcccaac 3600 gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc 3660 ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt atggcagcac 3720 tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact ggtgagtact 3780 caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa 3840 tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt 3900 cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg atgtaaccca 3960 ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct gggtgagcaa 4020 aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa tgttgaatac 4080 tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt ctcatgagcg 4140 gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc acatttcccc 4200 gaaaagtgcc acctgacgtc taagaaacca ttattatcat gacattaacc tataaaaata 4260 ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga tgacggtgaa aacctctgac 4320 acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag 4380 cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac tatgcggcat 4440 cagagcagat tgtactgaga gtgcaccaag cttccaattt taggcccccc actgaccgag 4500 gtctgtcgat aatccacttt tccattgatt ttccaggttt cgttaactca tgccactgag 4560 caaaacttcg gtctttccta acaaaagctc tcctcacaaa gcatggcgcg gcaacggacg 4620 tgtcctcata ctccactgcc acacaaggtc gataaactaa gctcctcaca aatagaggag 4680 aattccactg acaactgaaa acaatgtatg agagacgatc accactggag cggcgcggcg 4740 gttgggcgcg gaggtcggca gcaaaaacaa gcgactcgcc gagcaaaccc gaatcagcct 4800 tcagacggtc gtgcctaaca acacgccgtt ctaccccgcc ttcttcgcgc cccttcgcgt 4860 ccaagcatcc ttcaagttta tctctctagt tcaacttcaa gaagaacaac accaccaaca 4920 ccatgattga acaagatgga ttgcaccgcag gttctccggc cgcttgggtg gagaggctat 4980 tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt 5040 cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac 5100 tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg 5160 tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc 5220 aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa 5280 tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc 5340 gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg 5400 aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg 5460 acggcgatga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa 5520 atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg 5580 acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct 5640 tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc 5700 ttgacgagtt cttctgacac gtgctacgag atttcgattc caccgccgcc ttctatgaaa 5760 ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc 5820 tcatgctgga gttcttcgcc caccccaact tgtttattgc agcttataat ggttacaaat 5880 aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 5940 gtttgtccaa actcatcaat gtatcttatc atgtctgaat tcccggggta c 5991 <210> 8 <211> 7612 <212> DNA <213> Artificial Sequence <220> <223> pCL402 vector <220> <221> misc_feature <222> (5)..(1198) <223> FAS_upstream_fragment <220> <221> misc_feature <222> (1199)..(1647) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (1648)..(2442) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (2443)..(2716) <223> SV40_terminator <220> <221> misc_feature <222> (2717)..(3779) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (3792)..(3828) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (3829)..(3848) <223> carotene_synthase_target_1 <220> <221> misc_feature <222> (3849)..(3928) <223> gRNA <220> <221> misc_feature <222> (3929)..(3996) <223> HDV_ribozyme <220> <221> misc_feature <222> (4016)..(4534) <223> OrfC_terminator <220> <221> misc_feature <222> (4535)..(5360) <223> FAS_downstream_fragment <220> <221> misc_feature <222> (5365)..(7612) <223> pSP73 <400> 8 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gcctcgagcc 1200 aattttaggc cccccactga ccgaggtctg tcgataatcc acttttccat tgattttcca 1260 ggtttcgtta actcatgcca ctgagcaaaa cttcggtctt tcctaacaaa agctctcctc 1320 acaaagcatg gcgcggcaac ggacgtgtcc tcatactcca ctgccacaca aggtcgataa 1380 actaagctcc tcacaaatag aggagaattc cactgacaac tgaaaacaat gtatgagaga 1440 cgatcaccac tggagcggcg cggcggttgg gcgcggaggt cggcagcaaa aacaagcgac 1500 tcgccgagca aacccgaatc agccttcaga cggtcgtgcc taacaacacg ccgttctacc 1560 ccgccttctt cgcgcccctt cgcgtccaag catccttcaa gtttatctct ctagttcaac 1620 ttcaagaaga acaacaccac caacaccatg attgaacaag atggattgca cgcaggttct 1680 ccggccgctt gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc 1740 tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc 1800 gacctgtccg gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc 1860 acgacgggcg ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg 1920 ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag 1980 aaagtatcca tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc 2040 ccattcgacc accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt 2100 cttgtcgatc aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc 2160 gccaggctca aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc 2220 tgcttgccga atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg 2280 ctgggtgtgg cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag 2340 cttggcggcg aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg 2400 cagcgcatcg ccttctatcg ccttcttgac gagttcttct gacacgtgct acgagatttc 2460 gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc 2520 tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc caacttgttt 2580 attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca 2640 tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc 2700 tgaattcccg gggtacctct tatctgcctc gcgccgttga ccgccgcttg actcttggcg 2760 cttgccgctc gcatcctgcc tcgctcgcgc aggcgggcgg gcgagtgggt gggtccgcag 2820 ccttccgcgc tcgcccgcta gctcgctcgc gccgtgctgc agccagcagg gcagcaccgc 2880 acggcaggca ggtcccggcg cggatcgatc gatccatcga tccatcgatc catcgatcgt 2940 gcggtcaaaa agaaaggaag aagaaaggaa aaagaaaggc gtgcgcaccc gagtgcgcgc 3000 tgagcgcccg ctcgcggtcc cgcggagcct ccgcgttagt ccccgccccg cgccgcgcag 3060 tccccccggga ggcatcgcgc acctctcgcc gccccctcgc gcctcgccga ttccccgcct 3120 ccccttttcc gcttcttcgc cgcctccgct cgcggccgcg tcgcccgcgc cccgctccct 3180 atctgctccc caggggggca ctccgcacct tttgcgcccg ctgccgccgc cgcggccgcc 3240 ccgccgccct ggtttccccc gcgagcgcgg ccgcgtcgcc gcgcaaagac tcgccgcgtg 3300 ccgccccgag caacgggtgg cggcggcgcg gcggcgggcg gggcgcggcg gcgcgtaggc 3360 ggggctaggc gccggctagg cgaaacgccg cccccgggcg ccgccgccgc ccgctccaga 3420 gcagtcgccg cgccagaccg ccaacgcaga gaccgagacc gaggtacgtc gcgcccgagc 3480 acgccgcgac gcgcggcagg gacgaggagc acgacgccgc gccgcgccgc gcgggggggg 3540 ggagggagag gcaggacgcg ggagcgagcg tgcatgtttc cgcgcgagac gacgccgcgc 3600 gcgctggaga ggagataagg cgcttggatc gcgagagggc cagccaggct ggaggcgaaa 3660 atgggtggag aggatagtat cttgcgtgct tggacgagga gactgacgag gaggacggat 3720 acgtcgatga tgatgtgcac agagaagaag cagttcgaaa gcgactacta gcaagcaaga 3780 gatctagcac gctgatgagt ccgtgaggac gaaacgagta agctcgtctg cggacgtcgt 3840 ggacgcgcgt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt 3900 gaaaaagtgg caccgagtcg gtgcttttgg ccggcatggt cccagcctcc tcgctggcgc 3960 cggctgggca acatgcttcg gcatggcgaa tgggaccata tgagttatga gatccgaaag 4020 tgaaccttgt cctaacccga cagcgaatgg cgggagggg cgggctaaaa gatcgtatta 4080 catagtattt ttcccctact ctttgtgttt gtcttttttt tttttttgaa cgcattcaag 4140 ccacttgtct gggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg 4200 gtcagacggc ccaaaaaagg gaaaaaattc attcatggca cagataagaa aaagaaaaag 4260 tttgtcgacc accgtcatca gaaagcaaga gaagagaaac actcgcgctc acattctcgc 4320 tcgcgtaaga atcttagcca cgcatacgaa gtaatttgtc catctggcga atctttacat 4380 gagcgttttc aagctggagc gtgagatcat acctttcttg atcgtaatgt tccaaccttg 4440 cataggcctc gttgcgatcc gctagcaatg cgtcgtactc ccgttgcaac tgcgccatcg 4500 cctcattgtg acgtgagttc agattcttct cgagaaactc ggcacctgcc atgaagacgc 4560 cctccaaaag ggctgggtca aggcctcgct cggacacagc cagggcgtcg tctccgccgc 4620 cgtcgttgcc gcagccaaca ccgaccgcga gctgcgcaac ctcgtggtct ccggcctcga 4680 atacatgtca aaagtcggca tcgccgccca gcgcacgctc gactacgagc tcggacgccg 4740 caacgccggc ccggagaccc cgatgctcgc tgtacaggga atggacgaaa aagtccttac 4800 caaggccttc aaggccgccg tctcgctctc caacgagaag caggccatga tggccaaaat 4860 ctccccacgg ccgccgccgc caccgccgcc ccggccgccg ttagcgacga agatcgcttc 4920 tccatcgccc tccgcaacgg ccacgacgac tttgtcgtct gcggcgagcc caaggacctg 4980 cgcgtcctcc gcaaggtcat cgagaaacag agcgccgagc ccggcaagga ggcacaggcg 5040 cgcacgccct tttccaagcg caagcccgtc acccagacca ccttcctccg catgacggcc 5100 gtcttccaca gcgctctcaa caaggacgcc ctcgcccaga tcaacacatg ggccccggag 5160 tccgccttta gcaaggcctt cgcccaggcc tcgctccgtg ttcccgtctt tgacaccaag 5220 tctggcgcta atctgcaaga tgttcccgcc gccgatgttg tcgcccatct taccaccaac 5280 atgctcactg agcgcgccga cgttctcgtc tccctccgtg ccgccgagac caagaccgac 5340 gccagccacc tcctctgttt aaacgttaac ctgcattaat gaatcggcca acgcgcgggg 5400 agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5460 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 5520 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5580 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 5640 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 5700 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 5760 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat 5820 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5880 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 5940 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 6000 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt 6060 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 6120 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 6180 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 6240 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 6300 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 6360 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 6420 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 6480 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 6540 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6600 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 6660 cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6720 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6780 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6840 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 6900 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6960 agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 7020 gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 7080 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 7140 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 7200 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 7260 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 7320 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc 7380 atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc gcgtttcggt 7440 gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 7500 gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 7560 ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca tg 7612 <210> 9 <211> 7609 <212> DNA <213> Artificial Sequence <220> <223> pYB36 vector <220> <221> misc_feature <222> (2)..(1192) <223> FAS_upstream_fragment <220> <221> misc_feature <222> (1200)..(1648) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (1679)..(2443) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (2444)..(2717) <223> SV40_terminator <220> <221> misc_feature <222> (2718)..(3780) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (3797)..(3829) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (3830)..(3849) <223> carotene_synthase_target_1 <220> <221> misc_feature <222> (3850)..(3929) <223> gRNA <220> <221> misc_feature <222> (3930)..(3997) <223> HDV_ribozyme <220> <221> misc_feature <222> (4017)..(4535) <223> OrfC_terminator <220> <221> misc_feature <222> (4536)..(5368) <223> FAS_downstream_fragment <220> <221> misc_feature <222> (6367)..(7227) <223> AmpR_gene <400> 9 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gccaagcttc 1200 caattttagg ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc 1260 aggtttcgtt aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct 1320 cacaaagcat ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata 1380 aactaagctc ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag 1440 acgatcacca ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga 1500 ctcgccgagc aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac 1560 cccgccttct tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa 1620 cttcaagaag aacaacacca ccaacaccat gattgaacaa gatggattgc acgcaggttc 1680 tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg 1740 ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac 1800 cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc 1860 cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg 1920 gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga 1980 gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg 2040 cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg 2100 tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt 2160 cgccaggctc aaggcgcgca tgcccgacgg cgatgatctc gtcgtgaccc atggcgatgc 2220 ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg 2280 gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga 2340 gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc 2400 gcagcgcatc gccttctatc gccttcttga cgagttcttc tgacacgtgc tacgagattt 2460 cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg 2520 ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt 2580 tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 2640 atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 2700 ctgaattccc ggggtacctc ttatctgcct cgcgccgttg accgccgctt gactcttggc 2760 gcttgccgct cgcatcctgc ctcgctcgcg caggcgggcg ggcgagtggg tgggtccgca 2820 gccttccgcg ctcgcccgct agctcgctcg cgccgtgctg cagccagcag ggcagcaccg 2880 cacggcaggc aggtcccggc gcggatcgat cgatccatcg atccatcgat ccatcgatcg 2940 tgcggtcaaa aagaaaggaa gaagaaagga aaaagaaagg cgtgcgcacc cgagtgcgcg 3000 ctgagcgccc gctcgcggtc ccgcggagcc tccgcgttag tccccgcccc gcgccgcgca 3060 gtcccccggg aggcatcgcg cacctctcgc cgccccctcg cgcctcgccg attccccgcc 3120 tccccttttc cgcttcttcg ccgcctccgc tcgcggccgc gtcgcccgcg ccccgctccc 3180 tatctgctcc ccaggggggc actccgcacc ttttgcgccc gctgccgccg ccgcggccgc 3240 cccgccgccc tggtttcccc cgcgagcgcg gccgcgtcgc cgcgcaaaga ctcgccgcgt 3300 gccgccccga gcaacgggtg gcggcggcgc ggcggcgggc ggggcgcggc ggcgcgtagg 3360 cggggctagg cgccggctag gcgaaacgcc gcccccgggc gccgccgccg cccgctccag 3420 agcagtcgcc gcgccagacc gccaacgcag agaccgagac cgaggtacgt cgcgcccgag 3480 cacgccgcga cgcgcggcag ggacgaggag cacgacgccg cgccgcgccg cgcggggggg 3540 gggagggaga ggcaggacgc gggagcgagc gtgcatgttt ccgcgcgaga cgacgccgcg 3600 cgcgctggag aggagataag gcgcttggat cgcgagaggg ccagccaggc tggaggcgaa 3660 aatgggtgga gaggatagta tcttgcgtgc ttggacgagg agactgacga ggaggacgga 3720 tacgtcgatg atgatgtgca cagagaagaa gcagttcgaa agcgactact agcaagcaag 3780 agatcttccg cactgatgag tccgtgagga cgaaacgagt aagctcgtct gcggacgtcg 3840 tggacgcgcg ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 3900 tgaaaaagtg gcaccgagtc ggtgcttttg gccggcatgg tcccagcctc ctcgctggcg 3960 ccggctgggc aacatgcttc ggcatggcga atgggaccat atgagttatg agatccgaaa 4020 gtgaaccttg tcctaacccg acagcgaatg gcgggagggg gcgggctaaa agatcgtatt 4080 acatagtatt tttcccctac tctttgtgtt tgtctttttt ttttttttga acgcattcaa 4140 gccacttgtc tgggtttact tgtttgtttg cttgcttgct tgcttgcttg cctgcttctt 4200 ggtcagacgg cccaaaaaag ggaaaaaatt cattcatggc acagataaga aaaagaaaaa 4260 gtttgtcgac caccgtcatc agaaagcaag agaagagaaa cactcgcgct cacattctcg 4320 ctcgcgtaag aatcttagcc acgcatacga agtaatttgt ccatctggcg aatctttaca 4380 tgagcgtttt caagctggag cgtgagatca tacctttctt gatcgtaatg ttccaacctt 4440 gcataggcct cgttgcgatc cgctagcaat gcgtcgtact cccgttgcaa ctgcgccatc 4500 gcctcattgt gacgtgagtt cagattcttc tcgagaaact cggcacctgc catgaagacg 4560 ccctccaaaa gggctgggtc aaggcctcgc tcggacacag ccagggcgtc gtctccgccg 4620 ccgtcgttgc cgcagccaac accgaccgcg agctgcgcaa cctcgtggtc tccggcctcg 4680 aatacatgtc aaaagtcggc atcgccgccc agcgcacgct cgactacgag ctcggacgcc 4740 gcaacgccgg cccggagacc ccgatgctcg ctgtacaggg aatggacgaa aaagtcctta 4800 ccaaggcctt caaggccgcc gtctcgctct ccaacgagaa gcaggccatg atggccaaaa 4860 tctccccacg gccgccgccg ccaccgccgc cccggccgcc gttagcgacg aagatcgctt 4920 ctccatcgcc ctccgcaacg gccacgacga ctttgtcgtc tgcggcgagc ccaaggacct 4980 gcgcgtcctc cgcaaggtca tcgagaaaca gagcgccgag cccggcaagg aggcacaggc 5040 gcgcacgccc ttttccaagc gcaagcccgt cacccagacc accttcctcc gcatgacggc 5100 cgtcttccac agcgctctca acaaggacgc cctcgcccag atcaacacat gggccccgga 5160 gtccgccttt agcaaggcct tcgcccaggc ctcgctccgt gttcccgtct ttgacaccaa 5220 gtctggcgct aatctgcaag atgttcccgc cgccgatgtt gtcgcccatc ttaccaccaa 5280 catgctcact gagcgcgccg acgttctcgt ctccctccgt gccgccgaga ccaagaccga 5340 cgccagccac ctcctctgtt taaacgttaa cctgcattaa tgaatcggcc aacgcgcggg 5400 gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 5460 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 5520 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 5580 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 5640 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 5700 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 5760 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 5820 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 5880 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 5940 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 6000 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 6060 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 6120 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 6180 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 6240 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 6300 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 6360 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 6420 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 6480 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 6540 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 6600 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 6660 gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 6720 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 6780 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 6840 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 6900 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 6960 gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 7020 agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 7080 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 7140 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 7200 ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 7260 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 7320 aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat 7380 catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 7440 tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 7500 agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 7560 gggctggctt aactatgcgg catcagagca gattgtactg agagtgcac 7609 <210> 10 <211> 7609 <212> DNA <213> Artificial Sequence <220> <223> pYB37 vector <220> <221> misc_feature <222> (2)..(1192) <223> FAS_upstream_fragment <220> <221> misc_feature <222> (1200)..(1648) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (1679)..(2443) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (2444)..(2717) <223> SV40_terminator <220> <221> misc_feature <222> (2718)..(3780) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (3797)..(3829) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (3830)..(3849) <223> carotene_synthase_target_2 <220> <221> misc_feature <222> (3850)..(3929) <223> gRNA <220> <221> misc_feature <222> (3930)..(3997) <223> HDV_ribozyme <220> <221> misc_feature <222> (4017)..(4535) <223> OrfC_terminator <220> <221> misc_feature <222> (4536)..(5368) <223> FAS_downstream_fragment <220> <221> misc_feature <222> (6367)..(7227) <223> AmpR_gene <400> 10 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gccaagcttc 1200 caattttagg ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc 1260 aggtttcgtt aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct 1320 cacaaagcat ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata 1380 aactaagctc ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag 1440 acgatcacca ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga 1500 ctcgccgagc aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac 1560 cccgccttct tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa 1620 cttcaagaag aacaacacca ccaacaccat gattgaacaa gatggattgc acgcaggttc 1680 tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg 1740 ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac 1800 cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc 1860 cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg 1920 gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga 1980 gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg 2040 cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg 2100 tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt 2160 cgccaggctc aaggcgcgca tgcccgacgg cgatgatctc gtcgtgaccc atggcgatgc 2220 ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg 2280 gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga 2340 gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc 2400 gcagcgcatc gccttctatc gccttcttga cgagttcttc tgacacgtgc tacgagattt 2460 cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg 2520 ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt 2580 tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 2640 atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 2700 ctgaattccc ggggtacctc ttatctgcct cgcgccgttg accgccgctt gactcttggc 2760 gcttgccgct cgcatcctgc ctcgctcgcg caggcgggcg ggcgagtggg tgggtccgca 2820 gccttccgcg ctcgcccgct agctcgctcg cgccgtgctg cagccagcag ggcagcaccg 2880 cacggcaggc aggtcccggc gcggatcgat cgatccatcg atccatcgat ccatcgatcg 2940 tgcggtcaaa aagaaaggaa gaagaaagga aaaagaaagg cgtgcgcacc cgagtgcgcg 3000 ctgagcgccc gctcgcggtc ccgcggagcc tccgcgttag tccccgcccc gcgccgcgca 3060 gtcccccggg aggcatcgcg cacctctcgc cgccccctcg cgcctcgccg attccccgcc 3120 tccccttttc cgcttcttcg ccgcctccgc tcgcggccgc gtcgcccgcg ccccgctccc 3180 tatctgctcc ccaggggggc actccgcacc ttttgcgccc gctgccgccg ccgcggccgc 3240 cccgccgccc tggtttcccc cgcgagcgcg gccgcgtcgc cgcgcaaaga ctcgccgcgt 3300 gccgccccga gcaacgggtg gcggcggcgc ggcggcgggc ggggcgcggc ggcgcgtagg 3360 cggggctagg cgccggctag gcgaaacgcc gcccccgggc gccgccgccg cccgctccag 3420 agcagtcgcc gcgccagacc gccaacgcag agaccgagac cgaggtacgt cgcgcccgag 3480 cacgccgcga cgcgcggcag ggacgaggag cacgacgccg cgccgcgccg cgcggggggg 3540 gggagggaga ggcaggacgc gggagcgagc gtgcatgttt ccgcgcgaga cgacgccgcg 3600 cgcgctggag aggagataag gcgcttggat cgcgagaggg ccagccaggc tggaggcgaa 3660 aatgggtgga gaggatagta tcttgcgtgc ttggacgagg agactgacga ggaggacgga 3720 tacgtcgatg atgatgtgca cagagaagaa gcagttcgaa agcgactact agcaagcaag 3780 agatcttccg cactgatgag tccgtgagga cgaaacgagt aagctcgtcg cagaccttaa 3840 gttcgacgcg ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 3900 tgaaaaagtg gcaccgagtc ggtgcttttg gccggcatgg tcccagcctc ctcgctggcg 3960 ccggctgggc aacatgcttc ggcatggcga atgggaccat atgagttatg agatccgaaa 4020 gtgaaccttg tcctaacccg acagcgaatg gcgggagggg gcgggctaaa agatcgtatt 4080 acatagtatt tttcccctac tctttgtgtt tgtctttttt ttttttttga acgcattcaa 4140 gccacttgtc tgggtttact tgtttgtttg cttgcttgct tgcttgcttg cctgcttctt 4200 ggtcagacgg cccaaaaaag ggaaaaaatt cattcatggc acagataaga aaaagaaaaa 4260 gtttgtcgac caccgtcatc agaaagcaag agaagagaaa cactcgcgct cacattctcg 4320 ctcgcgtaag aatcttagcc acgcatacga agtaatttgt ccatctggcg aatctttaca 4380 tgagcgtttt caagctggag cgtgagatca tacctttctt gatcgtaatg ttccaacctt 4440 gcataggcct cgttgcgatc cgctagcaat gcgtcgtact cccgttgcaa ctgcgccatc 4500 gcctcattgt gacgtgagtt cagattcttc tcgagaaact cggcacctgc catgaagacg 4560 ccctccaaaa gggctgggtc aaggcctcgc tcggacacag ccagggcgtc gtctccgccg 4620 ccgtcgttgc cgcagccaac accgaccgcg agctgcgcaa cctcgtggtc tccggcctcg 4680 aatacatgtc aaaagtcggc atcgccgccc agcgcacgct cgactacgag ctcggacgcc 4740 gcaacgccgg cccggagacc ccgatgctcg ctgtacaggg aatggacgaa aaagtcctta 4800 ccaaggcctt caaggccgcc gtctcgctct ccaacgagaa gcaggccatg atggccaaaa 4860 tctccccacg gccgccgccg ccaccgccgc cccggccgcc gttagcgacg aagatcgctt 4920 ctccatcgcc ctccgcaacg gccacgacga ctttgtcgtc tgcggcgagc ccaaggacct 4980 gcgcgtcctc cgcaaggtca tcgagaaaca gagcgccgag cccggcaagg aggcacaggc 5040 gcgcacgccc ttttccaagc gcaagcccgt cacccagacc accttcctcc gcatgacggc 5100 cgtcttccac agcgctctca acaaggacgc cctcgcccag atcaacacat gggccccgga 5160 gtccgccttt agcaaggcct tcgcccaggc ctcgctccgt gttcccgtct ttgacaccaa 5220 gtctggcgct aatctgcaag atgttcccgc cgccgatgtt gtcgcccatc ttaccaccaa 5280 catgctcact gagcgcgccg acgttctcgt ctccctccgt gccgccgaga ccaagaccga 5340 cgccagccac ctcctctgtt taaacgttaa cctgcattaa tgaatcggcc aacgcgcggg 5400 gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 5460 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 5520 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 5580 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 5640 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 5700 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 5760 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 5820 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 5880 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 5940 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 6000 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 6060 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 6120 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 6180 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 6240 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 6300 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 6360 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 6420 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 6480 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 6540 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 6600 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 6660 gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 6720 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 6780 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 6840 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 6900 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 6960 gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 7020 agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 7080 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 7140 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 7200 ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 7260 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 7320 aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat 7380 catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 7440 tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 7500 agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 7560 gggctggctt aactatgcgg catcagagca gattgtactg agagtgcac 7609 <210> 11 <211> 7609 <212> DNA <213> Artificial Sequence <220> <223> pYB38 vector <220> <221> misc_feature <222> (2)..(1192) <223> FAS_upstream_fragment <220> <221> misc_feature <222> (1200)..(1648) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (1679)..(2443) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (2444)..(2717) <223> SV40_terminator <220> <221> misc_feature <222> (2718)..(3780) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (3797)..(3829) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (3830)..(3849) <223> carotene_synthase_target_3 <220> <221> misc_feature <222> (3850)..(3929) <223> gRNA <220> <221> misc_feature <222> (3930)..(3997) <223> HDV_ribozyme <220> <221> misc_feature <222> (4017)..(4535) <223> OrfC_terminator <220> <221> misc_feature <222> (4536)..(5368) <223> FAS_downstream_fragment <220> <221> misc_feature <222> (6367)..(7227) <223> AmpR_gene <400> 11 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gccaagcttc 1200 caattttagg ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc 1260 aggtttcgtt aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct 1320 cacaaagcat ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata 1380 aactaagctc ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag 1440 acgatcacca ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga 1500 ctcgccgagc aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac 1560 cccgccttct tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa 1620 cttcaagaag aacaacacca ccaacaccat gattgaacaa gatggattgc acgcaggttc 1680 tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg 1740 ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac 1800 cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc 1860 cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg 1920 gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga 1980 gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg 2040 cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg 2100 tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt 2160 cgccaggctc aaggcgcgca tgcccgacgg cgatgatctc gtcgtgaccc atggcgatgc 2220 ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg 2280 gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga 2340 gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc 2400 gcagcgcatc gccttctatc gccttcttga cgagttcttc tgacacgtgc tacgagattt 2460 cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg 2520 ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt 2580 tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 2640 atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 2700 ctgaattccc ggggtacctc ttatctgcct cgcgccgttg accgccgctt gactcttggc 2760 gcttgccgct cgcatcctgc ctcgctcgcg caggcgggcg ggcgagtggg tgggtccgca 2820 gccttccgcg ctcgcccgct agctcgctcg cgccgtgctg cagccagcag ggcagcaccg 2880 cacggcaggc aggtcccggc gcggatcgat cgatccatcg atccatcgat ccatcgatcg 2940 tgcggtcaaa aagaaaggaa gaagaaagga aaaagaaagg cgtgcgcacc cgagtgcgcg 3000 ctgagcgccc gctcgcggtc ccgcggagcc tccgcgttag tccccgcccc gcgccgcgca 3060 gtcccccggg aggcatcgcg cacctctcgc cgccccctcg cgcctcgccg attccccgcc 3120 tccccttttc cgcttcttcg ccgcctccgc tcgcggccgc gtcgcccgcg ccccgctccc 3180 tatctgctcc ccaggggggc actccgcacc ttttgcgccc gctgccgccg ccgcggccgc 3240 cccgccgccc tggtttcccc cgcgagcgcg gccgcgtcgc cgcgcaaaga ctcgccgcgt 3300 gccgccccga gcaacgggtg gcggcggcgc ggcggcgggc ggggcgcggc ggcgcgtagg 3360 cggggctagg cgccggctag gcgaaacgcc gcccccgggc gccgccgccg cccgctccag 3420 agcagtcgcc gcgccagacc gccaacgcag agaccgagac cgaggtacgt cgcgcccgag 3480 cacgccgcga cgcgcggcag ggacgaggag cacgacgccg cgccgcgccg cgcggggggg 3540 gggagggaga ggcaggacgc gggagcgagc gtgcatgttt ccgcgcgaga cgacgccgcg 3600 cgcgctggag aggagataag gcgcttggat cgcgagaggg ccagccaggc tggaggcgaa 3660 aatgggtgga gaggatagta tcttgcgtgc ttggacgagg agactgacga ggaggacgga 3720 tacgtcgatg atgatgtgca cagagaagaa gcagttcgaa agcgactact agcaagcaag 3780 agatcttccg cactgatgag tccgtgagga cgaaacgagt aagctcgtcc cgactcgtcg 3840 accgtctcag ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 3900 tgaaaaagtg gcaccgagtc ggtgcttttg gccggcatgg tcccagcctc ctcgctggcg 3960 ccggctgggc aacatgcttc ggcatggcga atgggaccat atgagttatg agatccgaaa 4020 gtgaaccttg tcctaacccg acagcgaatg gcgggagggg gcgggctaaa agatcgtatt 4080 acatagtatt tttcccctac tctttgtgtt tgtctttttt ttttttttga acgcattcaa 4140 gccacttgtc tgggtttact tgtttgtttg cttgcttgct tgcttgcttg cctgcttctt 4200 ggtcagacgg cccaaaaaag ggaaaaaatt cattcatggc acagataaga aaaagaaaaa 4260 gtttgtcgac caccgtcatc agaaagcaag agaagagaaa cactcgcgct cacattctcg 4320 ctcgcgtaag aatcttagcc acgcatacga agtaatttgt ccatctggcg aatctttaca 4380 tgagcgtttt caagctggag cgtgagatca tacctttctt gatcgtaatg ttccaacctt 4440 gcataggcct cgttgcgatc cgctagcaat gcgtcgtact cccgttgcaa ctgcgccatc 4500 gcctcattgt gacgtgagtt cagattcttc tcgagaaact cggcacctgc catgaagacg 4560 ccctccaaaa gggctgggtc aaggcctcgc tcggacacag ccagggcgtc gtctccgccg 4620 ccgtcgttgc cgcagccaac accgaccgcg agctgcgcaa cctcgtggtc tccggcctcg 4680 aatacatgtc aaaagtcggc atcgccgccc agcgcacgct cgactacgag ctcggacgcc 4740 gcaacgccgg cccggagacc ccgatgctcg ctgtacaggg aatggacgaa aaagtcctta 4800 ccaaggcctt caaggccgcc gtctcgctct ccaacgagaa gcaggccatg atggccaaaa 4860 tctccccacg gccgccgccg ccaccgccgc cccggccgcc gttagcgacg aagatcgctt 4920 ctccatcgcc ctccgcaacg gccacgacga ctttgtcgtc tgcggcgagc ccaaggacct 4980 gcgcgtcctc cgcaaggtca tcgagaaaca gagcgccgag cccggcaagg aggcacaggc 5040 gcgcacgccc ttttccaagc gcaagcccgt cacccagacc accttcctcc gcatgacggc 5100 cgtcttccac agcgctctca acaaggacgc cctcgcccag atcaacacat gggccccgga 5160 gtccgccttt agcaaggcct tcgcccaggc ctcgctccgt gttcccgtct ttgacaccaa 5220 gtctggcgct aatctgcaag atgttcccgc cgccgatgtt gtcgcccatc ttaccaccaa 5280 catgctcact gagcgcgccg acgttctcgt ctccctccgt gccgccgaga ccaagaccga 5340 cgccagccac ctcctctgtt taaacgttaa cctgcattaa tgaatcggcc aacgcgcggg 5400 gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 5460 ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 5520 agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 5580 ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 5640 caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 5700 gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 5760 cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac gctgtaggta 5820 tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 5880 gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 5940 cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 6000 tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg 6060 tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 6120 caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 6180 aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 6240 cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 6300 ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 6360 tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 6420 atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 6480 tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 6540 aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 6600 catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 6660 gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 6720 ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 6780 aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 6840 atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 6900 cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 6960 gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 7020 agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 7080 gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 7140 caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 7200 ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 7260 tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 7320 aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat 7380 catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg 7440 tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 7500 agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 7560 gggctggctt aactatgcgg catcagagca gattgtactg agagtgcac 7609 <210> 12 <211> 7608 <212> DNA <213> Artificial Sequence <220> <223> pYB39 vector <220> <221> misc_feature <222> (2)..(1192) <223> FAS_upstream_fragment <220> <221> misc_feature <222> (1200)..(1648) <223> alpha_tubulin_promoter <220> <221> misc_feature <222> (1679)..(2443) <223> paromomycin_resistance_gene <220> <221> misc_feature <222> (2444)..(2717) <223> SV40_terminator <220> <221> misc_feature <222> (2718)..(3780) <223> EF-1_alpha_promoter <220> <221> misc_feature <222> (3792)..(3828) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (3829)..(3848) <223> carotene_synthase_target_4 <220> <221> misc_feature <222> (3848)..(3928) <223> gRNA <220> <221> misc_feature <222> (3929)..(3996) <223> HDV_ribozyme <220> <221> misc_feature <222> (4016)..(4534) <223> OrfC_terminator <220> <221> misc_feature <222> (4535)..(5367) <223> FAS_downstream_fragment <220> <221> misc_feature <222> (6366)..(7226) <223> AmpR_gene <400> 12 gtttaaactc gcggcgtctt cgccgtcgag gcgcgtcttt cgaggcgggc gaggtgtttt 60 tcttttcttt tcttctcgct gcagctgcgc cgcggcgaac gcagttcgcc gcggcggctg 120 cgacgcgcct gcgatgtcta tgcgcaggca aggcacgacg tcttgcggcg ccgcttcctg 180 cgccgccttg cgtcttggcc ccgccgacga cgcaagcagc ggcggcgccc ccccgccctc 240 ctccactgtg ggccgcagcc ctccttttcg cgcgcccgca gccgcgcggc gcgccccgcg 300 aacaaagagc cgccgcgccg gtccgcactg cgcgggccgc cccgcaagtg ccgcaaacgc 360 cggcccgaac cgccgcaaac gcgcccgcag ccgcgcccgc agccgcgcgc gacccgcggt 420 ggggacgcgc gccaagcgtc cccttccgcg ggatgacgta ggcggcggcc ccgcctatgc 480 aatacgggag gaaccaggaa ccgggagggg gggggggcgg cgcgcgcgcc gtccagtgcg 540 ggaccgatcg gcgccgggat gcccgggcgg gagggacaca gccaggcagt cagtcagtca 600 gccgcacaga gagagcgcgc ctgcgagtcc cgtctggtct cggaattgta tcccgcgcag 660 agctcagaat cgcaggtcga tcgatcgagc gatggatcca tcgctctatc cgtccatcga 720 tccatcgcat ccatcgcatc catcgcatcc atcgttgcat cgcttgcacc gcccgcttgc 780 atcgcgtgcg tgcgcaggcg ggcggcggcc acgacgcgac cgagagcggc ggcgagtgca 840 gacgccgccg gcgcccgcgg ctgcgtcgcc gcaggaagaa ggaggggggc gcgtgtttcc 900 cgcgggaggg aggagggagg gagggaggtg gttgggccaa aaagggcggc ctggacaggc 960 aggcaggccg gaagcgacgc cagcgagcga aggaagagga gagagccgcg cgggcggcca 1020 gcgcggggcg ggcggcagca aacccgctac tcagggtaaa agacagacag ctcttcgagc 1080 gagcttgttc acttcgcgga agcacgcgcg caggcacgca ggcacgcagg cagcatagcg 1140 agcagcagca gcatcgcgag cagcattgcg agaggaggcg ctgaccgccg gccaagcttc 1200 caattttagg ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc 1260 aggtttcgtt aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct 1320 cacaaagcat ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata 1380 aactaagctc ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag 1440 acgatcacca ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga 1500 ctcgccgagc aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac 1560 cccgccttct tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa 1620 cttcaagaag aacaacacca ccaacaccat gattgaacaa gatggattgc acgcaggttc 1680 tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg 1740 ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac 1800 cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc 1860 cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg 1920 gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga 1980 gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg 2040 cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg 2100 tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt 2160 cgccaggctc aaggcgcgca tgcccgacgg cgatgatctc gtcgtgaccc atggcgatgc 2220 ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg 2280 gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga 2340 gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc 2400 gcagcgcatc gccttctatc gccttcttga cgagttcttc tgacacgtgc tacgagattt 2460 cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg 2520 ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt 2580 tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 2640 atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 2700 ctgaattccc ggggtacctc ttatctgcct cgcgccgttg accgccgctt gactcttggc 2760 gcttgccgct cgcatcctgc ctcgctcgcg caggcgggcg ggcgagtggg tgggtccgca 2820 gccttccgcg ctcgcccgct agctcgctcg cgccgtgctg cagccagcag ggcagcaccg 2880 cacggcaggc aggtcccggc gcggatcgat cgatccatcg atccatcgat ccatcgatcg 2940 tgcggtcaaa aagaaaggaa gaagaaagga aaaagaaagg cgtgcgcacc cgagtgcgcg 3000 ctgagcgccc gctcgcggtc ccgcggagcc tccgcgttag tccccgcccc gcgccgcgca 3060 gtcccccggg aggcatcgcg cacctctcgc cgccccctcg cgcctcgccg attccccgcc 3120 tccccttttc cgcttcttcg ccgcctccgc tcgcggccgc gtcgcccgcg ccccgctccc 3180 tatctgctcc ccaggggggc actccgcacc ttttgcgccc gctgccgccg ccgcggccgc 3240 cccgccgccc tggtttcccc cgcgagcgcg gccgcgtcgc cgcgcaaaga ctcgccgcgt 3300 gccgccccga gcaacgggtg gcggcggcgc ggcggcgggc ggggcgcggc ggcgcgtagg 3360 cggggctagg cgccggctag gcgaaacgcc gcccccgggc gccgccgccg cccgctccag 3420 agcagtcgcc gcgccagacc gccaacgcag agaccgagac cgaggtacgt cgcgcccgag 3480 cacgccgcga cgcgcggcag ggacgaggag cacgacgccg cgccgcgccg cgcggggggg 3540 gggagggaga ggcaggacgc gggagcgagc gtgcatgttt ccgcgcgaga cgacgccgcg 3600 cgcgctggag aggagataag gcgcttggat cgcgagaggg ccagccaggc tggaggcgaa 3660 aatgggtgga gaggatagta tcttgcgtgc ttggacgagg agactgacga ggaggacgga 3720 tacgtcgatg atgatgtgca cagagaagaa gcagttcgaa agcgactact agcaagcaag 3780 agatcttctt cctgatgagt ccgtgaggac gaaacgagta agctcgtcga agaacatgta 3840 ctcttcaagt tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt 3900 gaaaaagtgg caccgagtcg gtgcttttgg ccggcatggt cccagcctcc tcgctggcgc 3960 cggctgggca acatgcttcg gcatggcgaa tgggaccata tgagttatga gatccgaaag 4020 tgaaccttgt cctaacccga cagcgaatgg cgggagggg cgggctaaaa gatcgtatta 4080 catagtattt ttcccctact ctttgtgttt gtcttttttt tttttttgaa cgcattcaag 4140 ccacttgtct gggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg 4200 gtcagacggc ccaaaaaagg gaaaaaattc attcatggca cagataagaa aaagaaaaag 4260 tttgtcgacc accgtcatca gaaagcaaga gaagagaaac actcgcgctc acattctcgc 4320 tcgcgtaaga atcttagcca cgcatacgaa gtaatttgtc catctggcga atctttacat 4380 gagcgttttc aagctggagc gtgagatcat acctttcttg atcgtaatgt tccaaccttg 4440 cataggcctc gttgcgatcc gctagcaatg cgtcgtactc ccgttgcaac tgcgccatcg 4500 cctcattgtg acgtgagttc agattcttct cgagaaactc ggcacctgcc atgaagacgc 4560 cctccaaaag ggctgggtca aggcctcgct cggacacagc cagggcgtcg tctccgccgc 4620 cgtcgttgcc gcagccaaca ccgaccgcga gctgcgcaac ctcgtggtct ccggcctcga 4680 atacatgtca aaagtcggca tcgccgccca gcgcacgctc gactacgagc tcggacgccg 4740 caacgccggc ccggagaccc cgatgctcgc tgtacaggga atggacgaaa aagtccttac 4800 caaggccttc aaggccgccg tctcgctctc caacgagaag caggccatga tggccaaaat 4860 ctccccacgg ccgccgccgc caccgccgcc ccggccgccg ttagcgacga agatcgcttc 4920 tccatcgccc tccgcaacgg ccacgacgac tttgtcgtct gcggcgagcc caaggacctg 4980 cgcgtcctcc gcaaggtcat cgagaaacag agcgccgagc ccggcaagga ggcacaggcg 5040 cgcacgccct tttccaagcg caagcccgtc acccagacca ccttcctccg catgacggcc 5100 gtcttccaca gcgctctcaa caaggacgcc ctcgcccaga tcaacacatg ggccccggag 5160 tccgccttta gcaaggcctt cgcccaggcc tcgctccgtg ttcccgtctt tgacaccaag 5220 tctggcgcta atctgcaaga tgttcccgcc gccgatgttg tcgcccatct taccaccaac 5280 atgctcactg agcgcgccga cgttctcgtc tccctccgtg ccgccgagac caagaccgac 5340 gccagccacc tcctctgttt aaacgttaac ctgcattaat gaatcggcca acgcgcgggg 5400 agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg 5460 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 5520 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 5580 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac 5640 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg 5700 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac 5760 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg ctgtaggtat 5820 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag 5880 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac 5940 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt 6000 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac agtatttggt 6060 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc 6120 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga 6180 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac 6240 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc 6300 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct 6360 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca 6420 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct 6480 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca 6540 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc 6600 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg 6660 cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt tggtatggct 6720 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa 6780 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta 6840 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc 6900 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg 6960 agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag aactttaaaa 7020 gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg 7080 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc 7140 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg 7200 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat 7260 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata 7320 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc 7380 atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtctcgc gcgtttcggt 7440 gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 7500 gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 7560 ggctggctta actatgcggc atcagagcag attgtactga gagtgcac 7608 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12 Tub seq F primer <400> 13 ggatctcatg ctggagttct tc 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pYB32/3C R1 primer <400> 14 gtacttctcg tggtaggcaa cc 22 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> CS pro Kpn IF F1 primer <400> 15 gtctgaattc ccggggtacc gagcgggcga ttccaccgtc 40 <210> 16 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> CS pro BamH IF R1 primer <400> 16 gtacttctta tccatggatc cctcggtctc cgagcgagcg ag 42 <210> 17 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> CS pro BamH IF F2 primer <400> 17 tcgctcgctc ggagaccgag ggatccatgg ataagaagta c 41 <210> 18 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> CS pro Nde IF R2 primer <400> 18 gattcactag tttagatcat atgttagacc ttgcgcttct tcttagggtc c 51 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> O A1-KO F primer <400> 19 ccaagttcgc caaggcttc 19 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB32/3 SV40 R1 primer <400> 20 gtggaatcga aatctcgtag cac 23 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> O A1-KO R primer <400> 21 gctgttgcaa ctttgctcca c 21 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB32/3C F1 primer <400> 22 gttaagaaga ccgaggtcca gac 23 <210> 23 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> 5' FAS PmeNde primer <400> 23 tagcatatgt ttaaactcgc ggcgtctttc gc 32 <210> 24 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 3' FAS PmeHpa primer <400> 24 agttaacgtt taaacagagg aggtggctgg c 31 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> pCL402 IF F primer <400> 25 gaggcgctga ccgccggcca agcttccaat tttaggcc 38 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> pCL402 IF R primer <400> 26 gcaggtgccg agtttctcga gaagaatctg aactcacgtc 40 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> pYB36 CS1 F primer <400> 27 gagtcgaagg agacgttgtc g 21 <210> 28 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB36 CS1 R primer <400> 28 gtcattgcga atgatgcgat atg 23 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB36 CS3 R primer <400> 29 ggtcatcatg gaatacaacg cag 23 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pYB36 CS4 F primer <400> 30 cgagctcatt tgtgctacac tctatg 26 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB36 CS4 R primer <400> 31 cacaagatt gcaggattga tgc 23 <210> 32 <211> 5562 <212> DNA <213> Artificial Sequence <220> <223> pYB30 vector (5562 bp) <220> <221> misc_feature <222> (2)..(450) <223> Alpha_Tubulin_promoter <220> <221> misc_feature <222> (457)..(549) <223> Sec1_secretion_sequence <220> <221> misc_feature <222> (550)..(1287) <223> eGFP <220> <221> misc_feature <222> (1307)..(1946) <223> OrfC_terminator <220> <221> misc_feature <222> (4481)..(4929) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (4930)..(5304) <223> Sh_ble_gene <220> <221> misc_feature <222> (5305)..(5562) <223> SV40_terminator <400> 32 cccaatttta ggccccccac tgaccgaggt ctgtcgataa tccacttttc cattgatttt 60 ccaggtttcg ttaactcatg ccactgagca aaacttcggt ctttcctaac aaaagctctc 120 ctcacaaagc atggcgcggc aacggacgtg tcctcatact ccactgccac acaaggtcga 180 taaactaagc tcctcacaaa tagaggagaa ttccactgac aactgaaaac aatgtatgag 240 agacgatcac cactggagcg gcgcggcggt tgggcgcgga ggtcggcagc aaaaacaagc 300 gactcgccga gcaaacccga atcagccttc agacggtcgt gcctaacaac acgccgttct 360 accccgcctt cttcgcgccc cttcgcgtcc aagcatcctt caagtttatc tctctagttc 420 aacttcaaga agaacaacac caccaacacc ggatccatga agttcgcgac ctcggtcgca 480 attttgcttg tggccaacat agccaccgcc ctcgcgcaga gcgatggctg cacccccacc 540 gaccagacga tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 600 gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat 660 gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc 720 tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac 780 cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc 840 accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 900 gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc 960 ctgggacaca agctggagta caactacaac agccacaacg tctatatcat ggccgacaag 1020 cagaagaacg gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg 1080 cagctcgccg accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc 1140 gacaaccact acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 1200 cacatggtcc tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg 1260 tacaagcacc accatcacca ccactaacat atgagttatg agatccgaaa gtgaaccttg 1320 tcctaacccg acagcgaatg gcgggagggg gcgggctaaa agatcgtatt acatagtatt 1380 tttcccctac tctttgtgtt tgtctttttt ttttttttga acgcattcaa gccacttgtc 1440 tgggtttact tgtttgtttg cttgcttgct tgcttgcttg cctgcttctt ggtcagacgg 1500 cccaaaaaag ggaaaaaatt cattcatggc acagataaga aaaagaaaaa gtttgtcgac 1560 caccgtcatc agaaagcaag agaagagaaa cactcgcgct cacatctcg ctcgcgtaag 1620 aatcttagcc acgcatacga agtaatttgt ccatctggcg aatctttaca tgagcgtttt 1680 caagctggag cgtgagatca tacctttctt gatcgtaatg ttccaacctt gcataggcct 1740 cgttgcgatc cgctagcaat gcgtcgtact cccgttgcaa ctgcgccatc gcctcattgt 1800 gacgtgagtt cagattcttc tcgagacctt cgagcgctgc taatttcgcc tgacgctcct 1860 tcttttgtgc ttccatgaca cgccgcttca ccgtgcgttc cacttcttcc tcagacatgc 1920 ccttggctgc ctcgacctgc tcggtaaaac gggccccagc acgtgctacg agatttcgat 1980 tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga cgccggctgg 2040 atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa cttgtttatt 2100 gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcattt 2160 ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta tcatacatgg 2220 tcgacctgca ggaacctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 2280 attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 2340 cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 2400 gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 2460 ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 2520 agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 2580 tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 2640 ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag 2700 gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 2760 ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 2820 gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 2880 aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg 2940 aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 3000 ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 3060 gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 3120 gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 3180 tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 3240 ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 3300 ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 3360 atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 3420 ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 3480 tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 3540 attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 3600 tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 3660 ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 3720 gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 3780 gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 3840 gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 3900 aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 3960 taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 4020 tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 4080 tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 4140 atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 4200 tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat 4260 aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga cggtgaaaac 4320 ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc 4380 agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg gcttaactat 4440 gcggcatcag agcagattgt actgagagtg caccaagctt ccaattttag gccccccact 4500 gaccgaggtc tgtcgataat ccacttttcc attgattttc caggtttcgt taactcatgc 4560 cactgagcaa aacttcggtc tttcctaaca aaagctctcc tcacaaagca tggcgcggca 4620 acggacgtgt cctcatactc cactgccaca caaggtcgat aaactaagct cctcacaaat 4680 agaggagaat tccactgaca actgaaaaca atgtatgaga gacgatcacc actggagcgg 4740 cgcggcggtt gggcgcggag gtcggcagca aaaacaagcg actcgccgag caaacccgaa 4800 tcagccttca gacggtcgtg cctaacaaca cgccgttcta ccccgccttc ttcgcgcccc 4860 ttcgcgtcca agcatccttc aagtttatct ctctagttca acttcaagaa gaacaacacc 4920 accaacacca tggccaagtt gaccagtgcc gttccggtgc tcaccgcgcg cgacgtcgcc 4980 ggagcggtcg agttctggac cgaccggctc gggttctccc gggacttcgt ggaggacgac 5040 ttcgccggtg tggtccggga cgacgtgacc ctgttcatca gcgcggtcca ggaccaggtg 5100 gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc tggacgagct gtacgccgag 5160 tggtcggagg tcgtgtccac gaacttccgg gacgcctccg ggccggccat gaccgagatc 5220 ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc cggccggcaa ctgcgtgcac 5280 ttcgtggccg aggagcagga ctgacacgtg ctacgagatt tcgattccac cgccgccttc 5340 tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat cctccagcgc 5400 ggggatctca tgctggagtt cttcgcccac cccaacttgt ttattgcagc ttataatggt 5460 tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 5520 agttgtggtt tgtccaaact catcaatgta tcttatcggt ac 5562 <210> 33 <211> 8887 <212> DNA <213> Artificial Sequence <220> <223> pYB61 vector (8887 bp) <220> <221> misc_feature <222> (2)..(450) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (457)..(4596) <223> Cas9 <220> <221> misc_feature <222> (4616)..(5255) <223> OrfC_terminator <220> <221> misc_feature <222> (6540)..(7400) <223> Ampicillin_resistance_gene <220> <221> misc_feature <222> (7790)..(8238) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (8239)..(8613) <223> Sh_ble_gene <220> <221> misc_feature <222> (8614)..(8887) <223> SV40_terminator <400> 33 cccaatttta ggccccccac tgaccgaggt ctgtcgataa tccacttttc cattgatttt 60 ccaggtttcg ttaactcatg ccactgagca aaacttcggt ctttcctaac aaaagctctc 120 ctcacaaagc atggcgcggc aacggacgtg tcctcatact ccactgccac acaaggtcga 180 taaactaagc tcctcacaaa tagaggagaa ttccactgac aactgaaaac aatgtatgag 240 agacgatcac cactggagcg gcgcggcggt tgggcgcgga ggtcggcagc aaaaacaagc 300 gactcgccga gcaaacccga atcagccttc agacggtcgt gcctaacaac acgccgttct 360 accccgcctt cttcgcgccc cttcgcgtcc aagcatcctt caagtttatc tctctagttc 420 aacttcaaga agaacaacac caccaacacc ggatccatgg ataagaagta ctcgatcggc 480 ctcgacattg gcaccaacag cgtcggctgg gccgtcatta ctgatgagta caaggtcccg 540 tcgaagaagt ttaaggtcct cggcaacact gaccgccact ccatcaagaa gaacctcatc 600 ggtgccctcc tttttgactc cggcgagacc gctgaggcca ctcgcctcaa gcgcactgcc 660 cgccgccgtt acacccgccg caagaaccgc atctgctacc tccaggagat tttctcgaac 720 gaaatggcca aggtcgatga ctcctttttc caccgtctcg aagaatcgtt cctcgtcgag 780 gaggacaaga agcacgagcg ccaccccatc ttcggtaaca ttgtcgatga ggttgcctac 840 cacgagaagt acccgaccat ctaccacctc cgcaagaagc tcgtcgactc caccgacaag 900 gccgatctcc gccttatcta cctcgccctc gcccacatga tcaagttccg cggccacttt 960 cttatcgagg gtgatctcaa ccctgataac tctgacgtcg acaagctttt catccagctc 1020 gtccagactt acaaccagct cttcgaggag aaccccatca acgcttccgg cgtcgacgcg 1080 aaggccattc tcagcgcccg cctcagcaag tcccgccgcc tcgaaaacct cattgcccag 1140 cttcccggcg agaagaagaa cggcctcttc ggcaacctca ttgccctcag ccttggcctc 1200 acccctaact tcaagtcgaa ctttgacctc gccgaggacg ccaagctcca gctttccaag 1260 gacacttacg acgacgatct cgacaacctc ctcgctcaga ttggcgacca gtacgctgac 1320 ctcttcctcg ccgccaagaa ccttagcgat gccatcctcc tctccgacat ccttcgtgtt 1380 aacacggaaa tcacgaaggc tccgctctcc gcctccatga tcaagcgtta cgacgagcac 1440 catcaggacc tcaccctcct caaggccctc gtccgccagc agctccccga gaagtacaag 1500 gagatcttct tcgaccagag caagaacggc tacgccggct acatgacgg cggcgcgtcg 1560 caggaggagt tttacaagtt tatcaagccc attcttgaga agatggacgg caccgaggag 1620 ctcctcgtca agctcaaccg tgaggacctt ctccgcaagc agcgcacgtt cgacaacggc 1680 tctattcccc atcagatcca cctcggtgag cttcacgcga ttcttcgccg ccaggaagac 1740 ttttacccgt tcctcaagga caaccgcgag aagattgaga agatcctcac ctttcgcatt 1800 ccctactacg tcggccccct cgcccgcggc aactcgcgct ttgcttggat gacccgcaag 1860 tccgaggaga ccatcacccc gtggaacttc gaagaggtcg tcgacaaggg cgcctccgcg 1920 cagtctttca tcgagcgcat gactaacttt gacaagaacc tcccgaacga gaaggtcctc 1980 cccaagcaca gcctccttta cgaatacttt acggtgtaca acgagctcac gaaggtcaag 2040 tacgtcactg agggcatgcg caagccggcg ttcctttcgg gcgagcagaa gaaggctatc 2100 gtcgacctcc ttttcaagac caaccgcaag gttaccgtca agcagctcaa ggaggactac 2160 ttcaagaaga tcgagtgctt tgactcggtc gagatttcgg gcgtggagga ccgtttcaac 2220 gcctccctcg gcacttacca cgaccttctc aagatcatca aggacaagga ctttctcgac 2280 aacgaggaga acgaggacat tctcgaggac atcgtcctca cgctcaccct ctttgaggac 2340 cgtgagatga tcgaggagcg cctcaagacc tacgcccatc tctttgacga caaggtcatg 2400 aagcagctca agcgccgccg ctacaccggc tggggccgcc tttcccgcaa gctcatcaac 2460 ggcatccgcg acaagcagtc tggcaagacc atccttgact ttcttaagtc tgatggtttc 2520 gccaaccgca acttcatgca gctcatccac gaggacagcc tcactttcaa ggaggacatt 2580 cagaaggccc aggtctccgg ccagggtgac tctctccacg aacacatcgc caaccttgct 2640 ggcagcccgg ctattaagaa gggcatcctc cagaccgtca aggtcgtcga cgagctcgtc 2700 aaggttatgg gccgccacaa gcccgagaac atcgtcattg agatggctcg cgaaaaccag 2760 accacccaga agggtcagaa gaactcccgc gagcgcatga agcgtatcga ggagggcatc 2820 aaggagctcg gcagccagat cctcaaggag cacccggtcg agaacaccca gctccagaac 2880 gaaaagctct acctctacta cctccagaac ggccgtgaca tgtacgttga ccaggagctc 2940 gacattaacc gcctctccga ttacgacgtc gaccatattg tcccccagag ctttctcaag 3000 gacgacagca tcgacaacaa ggtcctcacc cgctcggaca agaaccgcgg caagtccgac 3060 aacgtccctt ccgaggaggt cgtgaagaag atgaagaact actggcgcca gcttctcaac 3120 gctaagctta ttactcagcg caagttcgat aacctcacca aggccgaacg cggcggcctc 3180 tccgagctcg acaaggccgg ttttatcaag cgccagctcg ttgagactcg ccagatcacc 3240 aagcacgtgg cgcagatcct cgactcgcgc atgaacacga agtacgacga gaacgacaag 3300 ctcatccgcg aggtcaaggt catcaccctt aagtcgaagc tcgtgtccga ctttcgcaag 3360 gacttccagt tctacaaggt ccgtgaaatt aacaactacc accacgctca cgacgcttac 3420 ctcaacgcgg tcgtgggtac cgcgctcatc aagaagtacc cgaagctcga gtcggagttt 3480 gtctacggcg actacaaggt ctacgacgtg cgcaagatga tcgccaagtc cgagcaggag 3540 atcggcaagg ccacggccaa gtactttttc tactccaaca ttatgaactt ctttaagact 3600 gagatcaccc ttgccaacgg cgagatccgc aagcgccccc ttatcgagac caacggcgag 3660 accggcgaaa ttgtgtggga taagggtcgc gactttgcca ccgtccgcaa ggtcctcagc 3720 atgccccagg tcaacattgt taagaagacc gaggtccaga cgggcggctt tagcaaggag 3780 tctatcctcc ccaagcgtaa cagcgacaag ctcatcgccc gcaagaagga ctgggaccct 3840 aagaagtacg gcggcttcga ttcgcctacg gtcgcctaca gcgtcctcgt cgtcgccaag 3900 gtcgagaagg gcaagtccaa gaagctcaag tccgtcaagg agctcctcgg catcacgatc 3960 atggagcgct ccagctttga gaagaacccc attgacttcc tcgaggctaa gggttacaag 4020 gaggtcaaga aggaccttat catcaagctc cccaagtact ccctctttga gctcgaaaac 4080 ggccgcaagc gtatgctcgc tagcgctggc gaactccaga agggcaacga gctcgccctc 4140 cccagcaagt acgtcaactt tctctacctc gcctcccact acgagaagct caagggtagc 4200 ccggaggata acgagcagaa gcagcttttt gtggagcagc acaagcacta ccttgacgag 4260 atcattgaac agatctccga gttctccaag cgtgttattc ttgctgacgc caacctcgat 4320 aaggtgctct ccgcgtacaa caagcaccgc gacaagccta tccgcgagca ggccgagaac 4380 atcatccacc tctttaccct caccaacctc ggcgccccgg ccgcctttaa gtactttgat 4440 acgactatcg accgcaagcg ctacacttcg actaaggagg tcctcgacgc taccctcatt 4500 caccagtcca ttaccggcct ctacgagacc cgcattgacc tttcgcagct cggtggcgac 4560 tcgcgtgcgg accctaagaa gaagcgcaag gtctaacata tgagttatga gatccgaaag 4620 tgaaccttgt cctaacccga cagcgaatgg cgggaggggg cgggctaaaa gatcgtatta 4680 catagtattt ttcccctact ctttgtgttt gtcttttttt tttttttgaa cgcattcaag 4740 ccacttgtct gggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg 4800 gtcagacggc ccaaaaaagg gaaaaaattc attcatggca cagataagaa aaagaaaaag 4860 tttgtcgacc accgtcatca gaaagcaaga gaagagaaac actcgcgctc acattctcgc 4920 tcgcgtaaga atcttagcca cgcatacgaa gtaatttgtc catctggcga atctttacat 4980 gagcgttttc aagctggagc gtgagatcat acctttcttg atcgtaatgt tccaaccttg 5040 cataggcctc gttgcgatcc gctagcaatg cgtcgtactc ccgttgcaac tgcgccatcg 5100 cctcattgtg acgtgagttc agattcttct cgagaccttc gagcgctgct aatttcgcct 5160 gacgctcctt cttttgtgct tccatgacac gccgcttcac cgtgcgttcc acttcttcct 5220 cagacatgcc cttggctgcc tcgacctgct cggtaaaacg ggccccagca cgtgctacga 5280 gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 5340 gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 5400 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 5460 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 5520 catacatggt cgacctgcag gaacctgcat taatgaatcg gccaacgcgc ggggagaggc 5580 ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt 5640 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 5700 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 5760 aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat 5820 cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc 5880 cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc 5940 gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt 6000 tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac 6060 cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg 6120 ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca 6180 gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc 6240 gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa 6300 accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa 6360 ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac 6420 tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 6480 aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 6540 taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata 6600 gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc 6660 agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac 6720 cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag 6780 tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac 6840 gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc 6900 agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg 6960 gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc 7020 atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct 7080 gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc 7140 tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc 7200 atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc 7260 agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc 7320 gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca 7380 cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt 7440 tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt 7500 ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca 7560 ttaacctata aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt cggtgatgac 7620 ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat 7680 gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg 7740 cttaactatg cggcatcaga gcagattgta ctgagagtgc accaagcttc caattttagg 7800 ccccccactg accgaggtct gtcgataatc cacttttcca ttgattttcc aggtttcgtt 7860 aactcatgcc actgagcaaa acttcggtct ttcctaacaa aagctctcct cacaaagcat 7920 ggcgcggcaa cggacgtgtc ctcatactcc actgccacac aaggtcgata aactaagctc 7980 ctcacaaata gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag acgatcacca 8040 ctggagcggc gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga ctcgccgagc 8100 aaacccgaat cagccttcag acggtcgtgc ctaacaacac gccgttctac cccgccttct 8160 tcgcgcccct tcgcgtccaa gcatccttca agtttatctc tctagttcaa cttcaagaag 8220 aacaacacca ccaacaccat ggccaagttg accagtgccg ttccggtgct caccgcgcgc 8280 gacgtcgccg gagcggtcga gttctggacc gaccggctcg ggttctcccg ggacttcgtg 8340 gaggacgact tcgccggtgt ggtccgggac gacgtgaccc tgttcatcag cgcggtccag 8400 gaccaggtgg tgccggacaa caccctggcc tgggtgtggg tgcgcggcct ggacgagctg 8460 tacgccgagt ggtcggaggt cgtgtccacg aacttccggg acgcctccgg gccggccatg 8520 accgagatcg gcgagcagcc gtgggggcgg gagttcgccc tgcgcgaccc ggccggcaac 8580 tgcgtgcact tcgtggccga ggagcaggac tgacacgtgc tacgagattt cgattccacc 8640 gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc 8700 ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct 8760 tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 8820 ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgaattccc 8880 ggggtac 8887 <210> 34 <211> 5997 <212> DNA <213> Artificial Sequence <220> <223> pYB66 vector (5997 bp) <220> <221> misc_feature <222> (1)..(1064) <223> EF-1alpha_promoter <220> <221> misc_feature <222> (1082)..(1118) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (1119)..(1138) <223> gRNA3_CS1_target_sequence <220> <221> misc_feature <222> (1139)..(1218) <223> gRNA_scaffold <220> <221> misc_feature <222> (1219)..(1286) <223> HDV_ribozyme <220> <221> misc_feature <222> (1306)..(1945) <223> OrfC_terminator <220> <221> misc_feature <222> (4480)..(4928) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (4929)..(5723) <223> Neomycin_phosphotransferase_gene <220> <221> misc_feature <222> (5724)..(5997) <223> SV40_terminator <400> 34 ctcttatctg cctcgcgccg ttgaccgccg cttgactctt ggcgcttgcc gctcgcatcc 60 tgcctcgctc gcgcaggcgg gcgggcgagt gggtgggtcc gcagccttcc gcgctcgccc 120 gctagctcgc tcgcgccgtg ctgcagccag cagggcagca ccgcacggca ggcaggtccc 180 ggcgcggatc gatcgatcca tcgatccatc gatccatcga tcgtgcggtc aaaaagaaag 240 gaagaagaaa ggaaaaagaa aggcgtgcgc acccgagtgc gcgctgagcg cccgctcgcg 300 gtcccgcgga gcctccgcgt tagtccccgc cccgcgccgc gcagtccccc gggaggcatc 360 gcgcacctct cgccgccccc tcgcgcctcg ccgattcccc gcctcccctt ttccgcttct 420 tcgccgcctc cgctcgcggc cgcgtcgccc gcgccccgct ccctatctgc tccccagggg 480 ggcactccgc accttttgcg cccgctgccg ccgccgcggc cgccccgccg ccctggtttc 540 ccccgcgagc gcggccgcgt cgccgcgcaa agactcgccg cgtgccgccc cgagcaacgg 600 gtggcggcgg cgcggcggcg ggcggggcgc ggcggcgcgt aggcggggct aggcgccggc 660 taggcgaaac gccgcccccg ggcgccgccg ccgcccgctc cagagcagtc gccgcgccag 720 accgccaacg cagagaccga gaccgaggta cgtcgcgccc gagcacgccg cgacgcgcgg 780 cagggacgag gagcacgacg ccgcgccgcg ccgcgcgggg ggggggaggg agaggcagga 840 cgcgggagcg agcgtgcatg tttccgcgcg agacgacgcc gcgcgcgctg gagaggagat 900 aaggcgcttg gatcgcgaga gggccagcca ggctggaggc gaaaatgggt ggagaggata 960 gtatcttgcg tgcttggacg aggagactga cgaggaggac ggatacgtcg atgatgatgt 1020 gcacagagaa gaagcagttc gaaagcgact actagcaagc aagggatcca gatcttccgc 1080 actgatgagt ccgtgaggac gaaacgagta agctcgtctg cggacgtcgt ggacgcgcgt 1140 tttagagcta gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg 1200 caccgagtcg gtgcttttgg ccggcatggt cccagcctcc tcgctggcgc cggctgggca 1260 acatgcttcg gcatggcgaa tgggaccata tgagttatga gatccgaaag tgaaccttgt 1320 cctaacccga cagcgaatgg cgggaggggg cgggctaaaa gatcgtatta catagtattt 1380 ttcccctact ctttgtgttt gtcttttttt tttttttgaa cgcattcaag ccacttgtct 1440 gggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg gtcagacggc 1500 ccaaaaaagg gaaaaaattc attcatggca cagataagaa aaagaaaaag tttgtcgacc 1560 accgtcatca gaaagcaaga gaagagaaac actcgcgctc acattctcgc tcgcgtaaga 1620 atcttagcca cgcatacgaa gtaatttgtc catctggcga atctttacat gagcgttttc 1680 aagctggagc gtgagatcat acctttcttg atcgtaatgt tccaaccttg cataggcctc 1740 gttgcgatcc gctagcaatg cgtcgtactc ccgttgcaac tgcgccatcg cctcattgtg 1800 acgtgagttc agattcttct cgagaccttc gagcgctgct aatttcgcct gacgctcctt 1860 cttttgtgct tccatgacac gccgcttcac cgtgcgttcc acttcttcct cagacatgcc 1920 cttggctgcc tcgacctgct cggtaaaacg ggccccagca cgtgctacga gatttcgatt 1980 ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac gccggctgga 2040 tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac ttgtttattg 2100 cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt 2160 tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat catacatggt 2220 cgacctgcag gaacctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta 2280 ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc 2340 gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca ggggataacg 2400 caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt 2460 tgctggcgtt tttccatagg ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa 2520 gtcagaggtg gcgaaacccg acaggactat aaagatacca ggcgtttccc cctggaagct 2580 ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc 2640 cttcgggaag cgtggcgctt tctcatagct cacgctgtag gtatctcagt tcggtgtagg 2700 tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct 2760 tatccggtaa ctatcgtctt gagtccaacc cggtaagaca cgacttatcg ccactggcag 2820 cagccactgg taacaggatt agcagagcga ggtatgtagg cggtgctaca gagttcttga 2880 agtggtggcc taactacggc tacactagaa gaacagtatt tggtatctgc gctctgctga 2940 agccagttac cttcggaaaa agagttggta gctcttgatc cggcaaacaa accaccgctg 3000 gtagcggtgg tttttttgtt tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag 3060 aagatccttt gatcttttct acggggtctg acgctcagtg gaacgaaaac tcacgttaag 3120 ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta aattaaaaat 3180 gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt taccaatgct 3240 taatcagtga ggcacctatc tcagcgatct gtctatttcg ttcatccata gttgcctgac 3300 tccccgtcgt gtagataact acgatacggg agggcttacc atctggcccc agtgctgcaa 3360 tgataccgcg agacccacgc tcaccggctc cagatttatc agcaataaac cagccagccg 3420 gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc ctccatccag tctattaatt 3480 gttgccggga agctagagta agtagttcgc cagttaatag tttgcgcaac gttgttgcca 3540 ttgctacagg catcgtggtg tcacgctcgt cgtttggtat ggcttcattc agctccggtt 3600 cccaacgatc aaggcgagtt acatgatccc ccatgttgtg caaaaaagcg gttagctcct 3660 tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt gttatcactc atggttatgg 3720 cagcactgca taattctctt actgtcatgc catccgtaag atgcttttct gtgactggtg 3780 agtactcaac caagtcattc tgagaatagt gtatgcggcg accgagttgc tcttgcccgg 3840 cgtcaatacg ggataatacc gcgccacata gcagaacttt aaaagtgctc atcattggaa 3900 aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct gttgagatcc agttcgatgt 3960 aacccactcg tgcacccaac tgatcttcag catcttttac tttcaccagc gtttctgggt 4020 gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt 4080 gaatactcat actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca 4140 tgagcggata catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat 4200 ttccccgaaa agtgccacct gacgtctaag aaaccattat tatcatgaca ttaacctata 4260 aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt cggtgatgac ggtgaaaacc 4320 tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 4380 gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg cttaactatg 4440 cggcatcaga gcagattgta ctgagagtgc accaagcttc caattttagg ccccccactg 4500 accgaggtct gtcgataatc cacttttcca ttgattttcc aggtttcgtt aactcatgcc 4560 actgagcaaa acttcggtct ttcctaacaa aagctctcct cacaaagcat ggcgcggcaa 4620 cggacgtgtc ctcatactcc actgccacac aaggtcgata aactaagctc ctcacaaata 4680 gaggagaatt ccactgacaa ctgaaaacaa tgtatgagag acgatcacca ctggagcggc 4740 gcggcggttg ggcgcggagg tcggcagcaa aaacaagcga ctcgccgagc aaacccgaat 4800 cagccttcag acggtcgtgc ctaacaacac gccgttctac cccgccttct tcgcgcccct 4860 tcgcgtccaa gcatccttca agtttatctc tctagttcaa cttcaagaag aacaacacca 4920 ccaacaccat gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga 4980 ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc 5040 ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga 5100 atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg 5160 cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc 5220 cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg 5280 atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga 5340 aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc 5400 tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgcgca 5460 tgcccgacgg cgatgatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg 5520 tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct 5580 atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc gaatgggctg 5640 accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc 5700 gccttcttga cgagttcttc tgacacgtgc tacgagattt cgattccacc gccgccttct 5760 atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc ctccagcgcg 5820 gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct tataatggtt 5880 acaaataaag caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta 5940 gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgaattccc ggggtac 5997 <210> 35 <211> 10700 <212> DNA <213> Artificial Sequence <220> <223> pYB73 vector (10700 bp) <220> <221> misc_feature <222> (2)..(450) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (457)..(4596) <223> Cas9 <220> <221> misc_feature <222> (4616)..(5255) <223> OrfC_terminator <220> <221> misc_feature <222> (5546)..(6608) <223> EF_1alpha_promoter <220> <221> misc_feature <222> (6621)..(6657) <223> Hammerhead_ribozyme <220> <221> misc_feature <222> (6658)..(6677) <223> gRNA3_CS1_target_sequence <220> <221> misc_feature <222> (6678)..(6757) <223> gRNA_scaffold <220> <221> misc_feature <222> (6758)..(6825) <223> HDV_ribozyme <220> <221> misc_feature <222> (6845)..(7363) <223> OrfC_terminator <220> <221> misc_feature <222> (8369)..(9229) <223> Ampicillin_resistance_gene <220> <221> misc_feature <222> (9619)..(10067) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (10068)..(10442) <223> Sh_ble_gene <220> <221> misc_feature <222> (10443)..(10700) <223> SV40_terminator <400> 35 cccaatttta ggccccccac tgaccgaggt ctgtcgataa tccacttttc cattgatttt 60 ccaggtttcg ttaactcatg ccactgagca aaacttcggt ctttcctaac aaaagctctc 120 ctcacaaagc atggcgcggc aacggacgtg tcctcatact ccactgccac acaaggtcga 180 taaactaagc tcctcacaaa tagaggagaa ttccactgac aactgaaaac aatgtatgag 240 agacgatcac cactggagcg gcgcggcggt tgggcgcgga ggtcggcagc aaaaacaagc 300 gactcgccga gcaaacccga atcagccttc agacggtcgt gcctaacaac acgccgttct 360 accccgcctt cttcgcgccc cttcgcgtcc aagcatcctt caagtttatc tctctagttc 420 aacttcaaga agaacaacac caccaacacc ggatccatgg ataagaagta ctcgatcggc 480 ctcgacattg gcaccaacag cgtcggctgg gccgtcatta ctgatgagta caaggtcccg 540 tcgaagaagt ttaaggtcct cggcaacact gaccgccact ccatcaagaa gaacctcatc 600 ggtgccctcc tttttgactc cggcgagacc gctgaggcca ctcgcctcaa gcgcactgcc 660 cgccgccgtt acacccgccg caagaaccgc atctgctacc tccaggagat tttctcgaac 720 gaaatggcca aggtcgatga ctcctttttc caccgtctcg aagaatcgtt cctcgtcgag 780 gaggacaaga agcacgagcg ccaccccatc ttcggtaaca ttgtcgatga ggttgcctac 840 cacgagaagt acccgaccat ctaccacctc cgcaagaagc tcgtcgactc caccgacaag 900 gccgatctcc gccttatcta cctcgccctc gcccacatga tcaagttccg cggccacttt 960 cttatcgagg gtgatctcaa ccctgataac tctgacgtcg acaagctttt catccagctc 1020 gtccagactt acaaccagct cttcgaggag aaccccatca acgcttccgg cgtcgacgcg 1080 aaggccattc tcagcgcccg cctcagcaag tcccgccgcc tcgaaaacct cattgcccag 1140 cttcccggcg agaagaagaa cggcctcttc ggcaacctca ttgccctcag ccttggcctc 1200 acccctaact tcaagtcgaa ctttgacctc gccgaggacg ccaagctcca gctttccaag 1260 gacacttacg acgacgatct cgacaacctc ctcgctcaga ttggcgacca gtacgctgac 1320 ctcttcctcg ccgccaagaa ccttagcgat gccatcctcc tctccgacat ccttcgtgtt 1380 aacacggaaa tcacgaaggc tccgctctcc gcctccatga tcaagcgtta cgacgagcac 1440 catcaggacc tcaccctcct caaggccctc gtccgccagc agctccccga gaagtacaag 1500 gagatcttct tcgaccagag caagaacggc tacgccggct acatgacgg cggcgcgtcg 1560 caggaggagt tttacaagtt tatcaagccc attcttgaga agatggacgg caccgaggag 1620 ctcctcgtca agctcaaccg tgaggacctt ctccgcaagc agcgcacgtt cgacaacggc 1680 tctattcccc atcagatcca cctcggtgag cttcacgcga ttcttcgccg ccaggaagac 1740 ttttacccgt tcctcaagga caaccgcgag aagattgaga agatcctcac ctttcgcatt 1800 ccctactacg tcggccccct cgcccgcggc aactcgcgct ttgcttggat gacccgcaag 1860 tccgaggaga ccatcacccc gtggaacttc gaagaggtcg tcgacaaggg cgcctccgcg 1920 cagtctttca tcgagcgcat gactaacttt gacaagaacc tcccgaacga gaaggtcctc 1980 cccaagcaca gcctccttta cgaatacttt acggtgtaca acgagctcac gaaggtcaag 2040 tacgtcactg agggcatgcg caagccggcg ttcctttcgg gcgagcagaa gaaggctatc 2100 gtcgacctcc ttttcaagac caaccgcaag gttaccgtca agcagctcaa ggaggactac 2160 ttcaagaaga tcgagtgctt tgactcggtc gagatttcgg gcgtggagga ccgtttcaac 2220 gcctccctcg gcacttacca cgaccttctc aagatcatca aggacaagga ctttctcgac 2280 aacgaggaga acgaggacat tctcgaggac atcgtcctca cgctcaccct ctttgaggac 2340 cgtgagatga tcgaggagcg cctcaagacc tacgcccatc tctttgacga caaggtcatg 2400 aagcagctca agcgccgccg ctacaccggc tggggccgcc tttcccgcaa gctcatcaac 2460 ggcatccgcg acaagcagtc tggcaagacc atccttgact ttcttaagtc tgatggtttc 2520 gccaaccgca acttcatgca gctcatccac gaggacagcc tcactttcaa ggaggacatt 2580 cagaaggccc aggtctccgg ccagggtgac tctctccacg aacacatcgc caaccttgct 2640 ggcagcccgg ctattaagaa gggcatcctc cagaccgtca aggtcgtcga cgagctcgtc 2700 aaggttatgg gccgccacaa gcccgagaac atcgtcattg agatggctcg cgaaaaccag 2760 accacccaga agggtcagaa gaactcccgc gagcgcatga agcgtatcga ggagggcatc 2820 aaggagctcg gcagccagat cctcaaggag cacccggtcg agaacaccca gctccagaac 2880 gaaaagctct acctctacta cctccagaac ggccgtgaca tgtacgttga ccaggagctc 2940 gacattaacc gcctctccga ttacgacgtc gaccatattg tcccccagag ctttctcaag 3000 gacgacagca tcgacaacaa ggtcctcacc cgctcggaca agaaccgcgg caagtccgac 3060 aacgtccctt ccgaggaggt cgtgaagaag atgaagaact actggcgcca gcttctcaac 3120 gctaagctta ttactcagcg caagttcgat aacctcacca aggccgaacg cggcggcctc 3180 tccgagctcg acaaggccgg ttttatcaag cgccagctcg ttgagactcg ccagatcacc 3240 aagcacgtgg cgcagatcct cgactcgcgc atgaacacga agtacgacga gaacgacaag 3300 ctcatccgcg aggtcaaggt catcaccctt aagtcgaagc tcgtgtccga ctttcgcaag 3360 gacttccagt tctacaaggt ccgtgaaatt aacaactacc accacgctca cgacgcttac 3420 ctcaacgcgg tcgtgggtac cgcgctcatc aagaagtacc cgaagctcga gtcggagttt 3480 gtctacggcg actacaaggt ctacgacgtg cgcaagatga tcgccaagtc cgagcaggag 3540 atcggcaagg ccacggccaa gtactttttc tactccaaca ttatgaactt ctttaagact 3600 gagatcaccc ttgccaacgg cgagatccgc aagcgccccc ttatcgagac caacggcgag 3660 accggcgaaa ttgtgtggga taagggtcgc gactttgcca ccgtccgcaa ggtcctcagc 3720 atgccccagg tcaacattgt taagaagacc gaggtccaga cgggcggctt tagcaaggag 3780 tctatcctcc ccaagcgtaa cagcgacaag ctcatcgccc gcaagaagga ctgggaccct 3840 aagaagtacg gcggcttcga ttcgcctacg gtcgcctaca gcgtcctcgt cgtcgccaag 3900 gtcgagaagg gcaagtccaa gaagctcaag tccgtcaagg agctcctcgg catcacgatc 3960 atggagcgct ccagctttga gaagaacccc attgacttcc tcgaggctaa gggttacaag 4020 gaggtcaaga aggaccttat catcaagctc cccaagtact ccctctttga gctcgaaaac 4080 ggccgcaagc gtatgctcgc tagcgctggc gaactccaga agggcaacga gctcgccctc 4140 cccagcaagt acgtcaactt tctctacctc gcctcccact acgagaagct caagggtagc 4200 ccggaggata acgagcagaa gcagcttttt gtggagcagc acaagcacta ccttgacgag 4260 atcattgaac agatctccga gttctccaag cgtgttattc ttgctgacgc caacctcgat 4320 aaggtgctct ccgcgtacaa caagcaccgc gacaagccta tccgcgagca ggccgagaac 4380 atcatccacc tctttaccct caccaacctc ggcgccccgg ccgcctttaa gtactttgat 4440 acgactatcg accgcaagcg ctacacttcg actaaggagg tcctcgacgc taccctcatt 4500 caccagtcca ttaccggcct ctacgagacc cgcattgacc tttcgcagct cggtggcgac 4560 tcgcgtgcgg accctaagaa gaagcgcaag gtctaacata tgagttatga gatccgaaag 4620 tgaaccttgt cctaacccga cagcgaatgg cgggaggggg cgggctaaaa gatcgtatta 4680 catagtattt ttcccctact ctttgtgttt gtcttttttt tttttttgaa cgcattcaag 4740 ccacttgtct gggtttactt gtttgtttgc ttgcttgctt gcttgcttgc ctgcttcttg 4800 gtcagacggc ccaaaaaagg gaaaaaattc attcatggca cagataagaa aaagaaaaag 4860 tttgtcgacc accgtcatca gaaagcaaga gaagagaaac actcgcgctc acattctcgc 4920 tcgcgtaaga atcttagcca cgcatacgaa gtaatttgtc catctggcga atctttacat 4980 gagcgttttc aagctggagc gtgagatcat acctttcttg atcgtaatgt tccaaccttg 5040 cataggcctc gttgcgatcc gctagcaatg cgtcgtactc ccgttgcaac tgcgccatcg 5100 cctcattgtg acgtgagttc agattcttct cgagaccttc gagcgctgct aatttcgcct 5160 gacgctcctt cttttgtgct tccatgacac gccgcttcac cgtgcgttcc acttcttcct 5220 cagacatgcc cttggctgcc tcgacctgct cggtaaaacg ggccccagca cgtgctacga 5280 gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 5340 gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 5400 ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 5460 aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 5520 catacatggt cgacctgcag ggtacctctt atctgcctcg cgccgttgac cgccgcttga 5580 ctcttggcgc ttgccgctcg catcctgcct cgctcgcgca ggcgggcggg cgagtgggtg 5640 ggtccgcagc cttccgcgct cgcccgctag ctcgctcgcg ccgtgctgca gccagcaggg 5700 cagcaccgca cggcaggcag gtcccggcgc ggatcgatcg atccatcgat ccatcgatcc 5760 atcgatcgtg cggtcaaaaa gaaaggaaga agaaaggaaa aagaaaggcg tgcgcacccg 5820 agtgcgcgct gagcgcccgc tcgcggtccc gcggagcctc cgcgttagtc cccgccccgc 5880 gccgcgcagt cccccgggag gcatcgcgca cctctcgccg ccccctcgcg cctcgccgat 5940 tccccgcctc cccttttccg cttcttcgcc gcctccgctc gcggccgcgt cgcccgcgcc 6000 ccgctcccta tctgctcccc aggggggcac tccgcacctt ttgcgcccgc tgccgccgcc 6060 gcggccgccc cgccgccctg gtttcccccg cgagcgcggc cgcgtcgccg cgcaaagact 6120 cgccgcgtgc cgccccgagc aacgggtggc ggcggcgcgg cggcgggcgg ggcgcggcgg 6180 cgcgtaggcg gggctaggcg ccggctaggc gaaacgccgc ccccgggcgc cgccgccgcc 6240 cgctccagag cagtcgccgc gccagaccgc caacgcagag accgagaccg aggtacgtcg 6300 cgcccgagca cgccgcgacg cgcggcaggg acgaggagca cgacgccgcg ccgcgccgcg 6360 cgggggggggg gagggagagg caggacgcgg gagcgagcgt gcatgtttcc gcgcgagacg 6420 acgccgcgcg cgctggagag gagataaggc gcttggatcg cgagagggcc agccaggctg 6480 gaggcgaaaa tgggtggaga ggatagtatc ttgcgtgctt ggacgaggag actgacgagg 6540 aggacggata cgtcgatgat gatgtgcaca gagaagaagc agttcgaaag cgactactag 6600 caagcaagag atcttccgca ctgatgagtc cgtgaggacg aaacgagtaa gctcgtctgc 6660 ggacgtcgtg gacgcgcgtt ttagagctag aaatagcaag ttaaaataag gctagtccgt 6720 tatcaacttg aaaaagtggc accgagtcgg tgcttttggc cggcatggtc ccagcctcct 6780 cgctggcgcc ggctgggcaa catgcttcgg catggcgaat gggaccatat gagttatgag 6840 atccgaaagt gaaccttgtc ctaacccgac agcgaatggc gggagggggc gggctaaaag 6900 atcgtattac atagtatttt tcccctactc tttgtgtttg tctttttttt ttttttgaac 6960 gcattcaagc cacttgtctg ggtttacttg tttgtttgct tgcttgcttg cttgcttgcc 7020 tgcttcttgg tcagacggcc caaaaaaggg aaaaaattca ttcatggcac agataagaaa 7080 aagaaaaagt ttgtcgacca ccgtcatcag aaagcaagag aagagaaaca ctcgcgctca 7140 cattctcgct cgcgtaagaa tcttagccac gcatacgaag taatttgtcc atctggcgaa 7200 tctttacatg agcgttttca agctggagcg tgagatcata cctttcttga tcgtaatgtt 7260 ccaaccttgc ataggcctcg ttgcgatccg ctagcaatgc gtcgtactcc cgttgcaact 7320 gcgccatcgc ctcattgtga cgtgagttca gattcttctc gagctgcagg aacctgcatt 7380 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 7440 cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 7500 aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 7560 aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 7620 tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 7680 caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 7740 cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 7800 ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 7860 gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 7920 agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 7980 gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 8040 acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 8100 gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 8160 gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 8220 cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 8280 caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 8340 gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 8400 cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 8460 cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 8520 caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 8580 gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 8640 gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 8700 cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 8760 catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 8820 gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta 8880 ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 8940 gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 9000 cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 9060 tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 9120 gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 9180 atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 9240 ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 9300 gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg 9360 acgtctaaga aaccattatt atcatgacat taacctataa aaataggcgt atcacgaggc 9420 cctttcgtct cgcgcgtttc ggtgatgacg gtgaaaacct ctgacacat cagctcccgg 9480 agacggtcac agcttgtctg taagcggatg ccgggagcag acaagcccgt cagggcgcgt 9540 cagcgggtgt tggcgggtgt cggggctggc ttaactatgc ggcatcagag cagattgtac 9600 tgagagtgca ccaagcttcc aattttaggc cccccactga ccgaggtctg tcgataatcc 9660 acttttccat tgattttcca ggtttcgtta actcatgcca ctgagcaaaa cttcggtctt 9720 tcctaacaaa agctctcctc acaaagcatg gcgcggcaac ggacgtgtcc tcatactcca 9780 ctgccacaca aggtcgataa actaagctcc tcacaaatag aggagaattc cactgacaac 9840 tgaaaacaat gtatgagaga cgatcaccac tggagcggcg cggcggttgg gcgcggaggt 9900 cggcagcaaa aacaagcgac tcgccgagca aacccgaatc agccttcaga cggtcgtgcc 9960 taacaacacg ccgttctacc ccgccttctt cgcgcccctt cgcgtccaag catccttcaa 10020 gtttatctct ctagttcaac ttcaagaaga acaacaccac caacaccatg gccaagttga 10080 ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag ttctggaccg 10140 accggctcgg gttctcccgg gacttcgtgg aggacgactt cgccggtgtg gtccgggacg 10200 acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac accctggcct 10260 gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc gtgtccacga 10320 acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg tgggggcggg 10380 agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag gagcaggact 10440 gacacgtgct acgagatttc gattccaccg ccgccttcta tgaaaggttg ggcttcggaa 10500 tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct 10560 tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc aatagcatca 10620 caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca 10680 tcaatgtatc ttatcggtac 10700 <210> 36 <211> 6300 <212> DNA <213> Artificial Sequence <220> <223> pCL310 vector (6300 bp) <220> <221> misc_feature <222> (1)..(1064) <223> EF_1alpha_promoter <220> <221> misc_feature <222> (1070)..(1981) <223> CarG_gene <220> <221> misc_feature <222> (2001)..(2640) <223> OrfC_terminator <220> <221> misc_feature <222> (5175)..(5623) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (5627)..(6019) <223> Bsd_gene <220> <221> misc_feature <222> (6020)..(6300) <223> SV40_terminator <400> 36 ctcttatctg cctcgcgccg ttgaccgccg cttgactctt ggcgcttgcc gctcgcatcc 60 tgcctcgctc gcgcaggcgg gcgggcgagt gggtgggtcc gcagccttcc gcgctcgccc 120 gctagctcgc tcgcgccgtg ctgcagccag cagggcagca ccgcacggca ggcaggtccc 180 ggcgcggatc gatcgatcca tcgatccatc gatccatcga tcgtgcggtc aaaaagaaag 240 gaagaagaaa ggaaaaagaa aggcgtgcgc acccgagtgc gcgctgagcg cccgctcgcg 300 gtcccgcgga gcctccgcgt tagtccccgc cccgcgccgc gcagtccccc gggaggcatc 360 gcgcacctct cgccgccccc tcgcgcctcg ccgattcccc gcctcccctt ttccgcttct 420 tcgccgcctc cgctcgcggc cgcgtcgccc gcgccccgct ccctatctgc tccccagggg 480 ggcactccgc accttttgcg cccgctgccg ccgccgcggc cgccccgccg ccctggtttc 540 ccccgcgagc gcggccgcgt cgccgcgcaa agactcgccg cgtgccgccc cgagcaacgg 600 gtggcggcgg cgcggcggcg ggcggggcgc ggcggcgcgt aggcggggct aggcgccggc 660 taggcgaaac gccgcccccg ggcgccgccg ccgcccgctc cagagcagtc gccgcgccag 720 accgccaacg cagagaccga gaccgaggta cgtcgcgccc gagcacgccg cgacgcgcgg 780 cagggacgag gagcacgacg ccgcgccgcg ccgcgcgggg ggggggaggg agaggcagga 840 cgcgggagcg agcgtgcatg tttccgcgcg agacgacgcc gcgcgcgctg gagaggagat 900 aaggcgcttg gatcgcgaga gggccagcca ggctggaggc gaaaatgggt ggagaggata 960 gtatcttgcg tgcttggacg aggagactga cgaggaggac ggatacgtcg atgatgatgt 1020 gcacagagaa gaagcagttc gaaagcgact actagcaagc aagggatcca tgctcaactc 1080 gcacaaccgc actgaggagc gctccactga ggacatcatc cttgagccct acacctacct 1140 catttcccag cccggcaagg acatccgcgc taagcttatt tccgctttcg acctctggct 1200 ccatgtcccc aaggacgtcc tctgcgtcat caacaagatt attggcatgc ttcacaacgc 1260 ctccctcatg atcgacgatg tccaggatga ctccgacctt cgccgtggcg tccccgtcgc 1320 ccaccatatc tacggcgtcc cccagacgat caacaccgct aactacgtca tttttctcgc 1380 tctccaggag gtcatgaagc tcaacatccc ctccatgatg caggtctgca ctgaggagct 1440 catcaacctt caccgcggcc agggtatcga gctctactgg cgcgattcgc ttacttgccc 1500 cactgaggag gagtacattg acatggtcaa caacaagacg tccggccttc tccgtcttgc 1560 cgtccgtctc atgcaggccg cctcggagtc cgacatcgac tacacccctc tcgtcaacat 1620 catcggtatt cactttcagg tccgcgacga ttacatgaac ctccagtcca ctagctacac 1680 gaacaacaag ggtttctgcg aggacctcac ggagggcaag ttttcgttcc ccatcatcca 1740 cgccattcgc aaggacccca gcaaccgcca gctccttaac attatctccc agaagcctac 1800 gtccattgag gttaagaagt acgcccttga ggttattcgc aaggccggca gctttgagta 1860 cgttcgcgag ttcctgcgcc agaaggaggc cgagtccctt aaggagatca agcgccttgg 1920 aggcaaccct ctcctcgaga agtacattga gaccatccgc gtcgaggcca cgaacgacta 1980 acatatgagt tatgagatcc gaaagtgaac cttgtcctaa cccgacagcg aatggcggga 2040 gggggcgggc taaaagatcg tattacatag tatttttccc ctactctttg tgtttgtctt 2100 tttttttttt ttgaacgcat tcaagccact tgtctgggtt tacttgtttg tttgcttgct 2160 tgcttgcttg cttgcctgct tcttggtcag acggcccaaa aaagggaaaa aattcattca 2220 tggcacagat aagaaaaaga aaaagtttgt cgaccaccgt catcagaaag caagagaaga 2280 gaaacactcg cgctcacatt ctcgctcgcg taagaatctt agccacgcat acgaagtaat 2340 ttgtccatct ggcgaatctt tacatgagcg ttttcaagct ggagcgtgag atcatacctt 2400 tcttgatcgt aatgttccaa ccttgcatag gcctcgttgc gatccgctag caatgcgtcg 2460 tactcccgtt gcaactgcgc catcgcctca ttgtgacgtg agttcagatt cttctcgaga 2520 ccttcgagcg ctgctaattt cgcctgacgc tccttctttt gtgcttccat gacacgccgc 2580 ttcaccgtgc gttccacttc ttcctcagac atgcccttgg ctgcctcgac ctgctcggta 2640 aaacgggccc cagcacgtgc tacgagattt cgattccacc gccgccttct atgaaaggtt 2700 gggcttcgga atcgttttcc gggacgccgg ctggatgatc ctccagcgcg gggatctcat 2760 gctggagttc ttcgcccacc ccaacttgtt tattgcagct tataatggtt acaaataaag 2820 caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta gttgtggttt 2880 gtccaaactc atcaatgtat cttatcatac atggtcgacc tgcaggaacc tgcattaatg 2940 aatcggccaa cgcgcgggga gaggcggttt gcgtattggg cgctcttccg cttcctcgct 3000 cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 3060 ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 3120 ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg 3180 cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 3240 actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac 3300 cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 3360 tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 3420 gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 3480 caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 3540 agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 3600 tagaagaaca gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 3660 tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa 3720 gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg 3780 gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa 3840 aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 3900 atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc 3960 gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat 4020 acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc 4080 ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc 4140 tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag 4200 ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg 4260 ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg 4320 atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag 4380 taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt 4440 catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga 4500 atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc 4560 acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc 4620 aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc 4680 ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc 4740 cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca 4800 atattattga agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat 4860 ttagaaaaat aaacaaatag gggttccgcg cacattccc cgaaaagtgc cacctgacgt 4920 ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt 4980 tcgtctcgcg cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac 5040 ggtcacagct tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc 5100 gggtgttggc gggtgtcggg gctggcttaa ctatgcggca tcagagcaga ttgtactgag 5160 agtgcaccaa gcttccaatt ttaggccccc cactgaccga ggtctgtcga taatccactt 5220 ttccattgat tttccaggtt tcgttaactc atgccactga gcaaaacttc ggtctttcct 5280 aacaaaagct ctcctcacaa agcatggcgc ggcaacggac gtgtcctcat actccactgc 5340 cacacaaggt cgataaacta agctcctcac aaatagagga gaattccact gacaactgaa 5400 aacaatgtat gagagacgat caccactgga gcggcgcggc ggttgggcgc ggaggtcggc 5460 agcaaaaaca agcgactcgc cgagcaaacc cgaatcagcc ttcagacggt cgtgcctaac 5520 aacacgccgt tctaccccgc cttcttcgcg ccccttcgcg tccaagcatc cttcaagttt 5580 atctctctag ttcaacttca agaagaacaa caccaccaac accatgatgc ctttgtctca 5640 agaagaatcc accctcattg aaagagcaac ggctacaatc aacagcatcc ccatctctga 5700 agactacagc gtcgccagcg cagctctctc tagcgacggc cgcatcttca ctggtgtcaa 5760 tgtatatcat tttactgggg gaccttgtgc agaactcgtg gtgctgggca ctgctgctgc 5820 tgcggcagct ggcaacctga cttgtatcgt cgcgatcgga aatgagaaca ggggcatctt 5880 gagcccctgt ggacggtgcc gacaggtgct tctcgatctg catcctggga tcaaagccat 5940 agtgaaggac agtgatggac agccgacggc agttgggatt cgtgaattgc tgccctctgg 6000 ttatgtgtgg gagggctaac acgtgctccg tgctacgaga tttcgattcc accgccgcct 6060 tctatgaaag gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc 6120 gcggggatct catgctggag ttcttcgccc accccaactt gtttattgca gcttataatg 6180 gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 6240 ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctgaatt cccggggtac 6300 <210> 37 <211> 6611 <212> DNA <213> Artificial Sequence <220> <223> pCL122 vector (6611 bp) <220> <221> misc_feature <222> (1)..(1064) <223> EF_1alpha_promoter <220> <221> misc_feature <222> (1070)..(1162) <223> Sec1_secretion_signal <220> <221> misc_feature <222> (1163)..(1900) <223> eGFP_gene <220> <221> misc_feature <222> (1920)..(2559) <223> OrfC_terminator <220> <221> misc_feature <222> (5094)..(5542) <223> Alpha_tubulin_promoter <220> <221> misc_feature <222> (5543)..(6337) <223> NPT_gene <220> <221> misc_feature <222> (6338)..(6611) <223> SV40_terminator <400> 37 ctcttatctg cctcgcgccg ttgaccgccg cttgactctt ggcgcttgcc gctcgcatcc 60 tgcctcgctc gcgcaggcgg gcgggcgagt gggtgggtcc gcagccttcc gcgctcgccc 120 gctagctcgc tcgcgccgtg ctgcagccag cagggcagca ccgcacggca ggcaggtccc 180 ggcgcggatc gatcgatcca tcgatccatc gatccatcga tcgtgcggtc aaaaagaaag 240 gaagaagaaa ggaaaaagaa aggcgtgcgc acccgagtgc gcgctgagcg cccgctcgcg 300 gtcccgcgga gcctccgcgt tagtccccgc cccgcgccgc gcagtccccc gggaggcatc 360 gcgcacctct cgccgccccc tcgcgcctcg ccgattcccc gcctcccctt ttccgcttct 420 tcgccgcctc cgctcgcggc cgcgtcgccc gcgccccgct ccctatctgc tccccagggg 480 ggcactccgc accttttgcg cccgctgccg ccgccgcggc cgccccgccg ccctggtttc 540 ccccgcgagc gcggccgcgt cgccgcgcaa agactcgccg cgtgccgccc cgagcaacgg 600 gtggcggcgg cgcggcggcg ggcggggcgc ggcggcgcgt aggcggggct aggcgccggc 660 taggcgaaac gccgcccccg ggcgccgccg ccgcccgctc cagagcagtc gccgcgccag 720 accgccaacg cagagaccga gaccgaggta cgtcgcgccc gagcacgccg cgacgcgcgg 780 cagggacgag gagcacgacg ccgcgccgcg ccgcgcgggg ggggggaggg agaggcagga 840 cgcgggagcg agcgtgcatg tttccgcgcg agacgacgcc gcgcgcgctg gagaggagat 900 aaggcgcttg gatcgcgaga gggccagcca ggctggaggc gaaaatgggt ggagaggata 960 gtatcttgcg tgcttggacg aggagactga cgaggaggac ggatacgtcg atgatgatgt 1020 gcacagagaa gaagcagttc gaaagcgact actagcaagc aagggatcca tgaagttcgc 1080 gacctcggtc gcaattttgc ttgtggccaa catagccacc gccctcgcgc agagcgatgg 1140 ctgcaccccc accgaccaga cgatggtgag caagggcgag gagctgttca ccggggtggt 1200 gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga 1260 gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa 1320 gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag 1380 ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta 1440 cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt 1500 gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga 1560 ggacggcaac atcctgggac acaagctgga gtacaactac aacagccaca acgtctatat 1620 catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga 1680 ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc 1740 cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa 1800 cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg 1860 catggacgag ctgtacaagc accaccatca ccaccactaa catatgagtt atgagatccg 1920 aaagtgaacc ttgtcctaac ccgacagcga atggcgggag ggggcgggct aaaagatcgt 1980 attacatagt atttttcccc tactctttgt gtttgtcttt tttttttttt tgaacgcatt 2040 caagccactt gtctgggttt acttgtttgt ttgcttgctt gcttgcttgc ttgcctgctt 2100 cttggtcaga cggcccaaaa aagggaaaaa attcattcat ggcacagata agaaaaagaa 2160 aaagtttgtc gaccaccgtc atcagaaagc aagagaagag aaacactcgc gctcacattc 2220 tcgctcgcgt aagaatctta gccacgcata cgaagtaatt tgtccatctg gcgaatcttt 2280 acatgagcgt tttcaagctg gagcgtgaga tcataccttt cttgatcgta atgttccaac 2340 cttgcatagg cctcgttgcg atccgctagc aatgcgtcgt actcccgttg caactgcgcc 2400 atcgcctcat tgtgacgtga gttcagattc ttctcgagac cttcgagcgc tgctaatttc 2460 gcctgacgct ccttcttttg tgcttccatg acacgccgct tcaccgtgcg ttccacttct 2520 tcctcagaca tgcccttggc tgcctcgacc tgctcggtaa aacgggcccc agcacgtgct 2580 acgagatttc gattccaccg ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg 2640 ggacgccggc tggatgatcc tccagcgcgg ggatctcatg ctggagttct tcgcccaccc 2700 caacttgttt attgcagctt ataatggtta caaataaagc aatagcatca caaatttcac 2760 aaataaagca tttttttcac tgcattctag ttgtggtttg tccaaactca tcaatgtatc 2820 ttatcataca tggtcgacct gcaggaacct gcattaatga atcggccaac gcgcggggag 2880 aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 2940 cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 3000 atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 3060 taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 3120 aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 3180 tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 3240 gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 3300 cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 3360 cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 3420 atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 3480 tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat 3540 ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 3600 acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 3660 aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 3720 aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 3780 tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 3840 cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 3900 catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 3960 ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 4020 aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 4080 ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 4140 caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 4200 attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 4260 agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 4320 actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 4380 ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 4440 ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 4500 gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 4560 atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 4620 cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 4680 gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 4740 gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 4800 ggttccgcgc acattcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat 4860 gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga 4920 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 4980 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 5040 ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccaag cttccaattt 5100 taggcccccc actgaccgag gtctgtcgat aatccacttt tccattgatt ttccaggttt 5160 cgttaactca tgccactgag caaaacttcg gtctttccta acaaaagctc tcctcacaaa 5220 gcatggcgcg gcaacggacg tgtcctcata ctccactgcc acacaaggtc gataaactaa 5280 gctcctcaca aatagaggag aattccactg acaactgaaa acaatgtatg agagacgatc 5340 accactggag cggcgcggcg gttgggcgcg gaggtcggca gcaaaaacaa gcgactcgcc 5400 gagcaaaccc gaatcagcct tcagacggtc gtgcctaaca acacgccgtt ctaccccgcc 5460 ttcttcgcgc cccttcgcgt ccaagcatcc ttcaagttta tctctctagt tcaacttcaa 5520 gaagaacaac accaccaaca ccatgattga acaagatgga ttgcaccgcag gttctccggc 5580 cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga 5640 tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct 5700 gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac 5760 gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct 5820 attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt 5880 atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt 5940 cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt 6000 cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag 6060 gctcaaggcg cgcatgcccg acggcgatga tctcgtcgtg acccatggcg atgcctgctt 6120 gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg 6180 tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg 6240 cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg 6300 catcgccttc tatcgccttc ttgacgagtt cttctgacac gtgctacgag atttcgattc 6360 caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat 6420 gatcctccag cgcggggatc tcatgctgga gttcttcgcc caccccaact tgtttattgc 6480 agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt 6540 ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctgaat 6600 tcccggggta c 6611 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> pYB66 Bambgl F primer <400> 38 caagggatcc agatcttccg cactgatgag tc 32 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pYB66 Nde R primer <400> 39 aactcatatg gtcccattcg cca 23 <210> 40 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pYB66 EF1seq F primer <400> 40 gagaggatag tatcttgcgt gcttg 25 <210> 41 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> pCL122 OrfC R primer <400> 41 gcaaggttgg aacattacga tcaag 25 <210> 42 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> pYB73 gRNA Pst Kpn IF F primer <400> 42 catacatggt cgacctgcag ggtacctctt atctgcctcg c 41 <210> 43 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> pYB73 gRNA Xho Pst IF R primer <400> 43 attaatgcag gttcctgcag ctcgagaaga atctgaactc acgtc 45 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> pYB73 seq F primer <400> 44 caccccaact tgtttattgc ag 22 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> pYB73 seq R primer <400> 45 gagcgaggaa gcggaagag 19 <210> 46 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> pYB13 pYB1 seq F primer <400> 46 gagaggatag tatcttgcgt gcttgg 26 <210> 47 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> TT pYB73 HDV R primer <400> 47 gaagcatgtt gcccagcc 18

Claims (25)

A non-natural or engineered composition comprising a source of a CRISPR-Cas system comprising a guide-polynucleotide and a Cas protein, wherein the guide-polynucleotide is essentially a guide-sequence that is the reverse complement of a target-polynucleotide in a host cell. wherein the guide-polynucleotide is capable of directing binding of the Cas protein at a target-polynucleotide in the host cell to form a CRISPR-Cas complex, wherein the guide-sequence is essentially in the genome of the host cell 5'-(N)yPAM-3' is the reverse complement of the (N)y portion of the polynucleotide sequence target, y is an integer from 8 to 30, PAM is a protospacer adjacent motif, and wherein the host cell is Labyrinthulomycete, with PAM of 5'-XGG-3', 5'-XGGXG-3', 5'-XXAGAAW-3', 5'-XXXXGATT-3', 5'-XXAGAA-3', 5 a sequence selected from the group consisting of '-XAAAAC-3', and X is A, C, G or T or an analog thereof; W is A or T, the Cas protein is encoded by a polynucleotide contained in a vector, and the guide-polynucleotide is encoded by or on another polynucleotide contained in another vector and the vector encoding the Cas protein is driven by a medium-strength promoter, and the vector encoding the guide-polynucleotide is driven by a high-strength promoter.
composition. delete delete The method of claim 1,
A composition wherein the guide-polynucleotide is encoded by a polynucleotide that is transcribed to provide the actual guide-polynucleotide. delete 5. The method of claim 4,
A composition wherein a vector encoding a Cas protein is driven by a low-strength promoter. 5. The method of claim 4,
A composition wherein one or more or all vectors comprise a selectable marker. 8. The method of claim 7,
A composition wherein one or more exogenous polynucleotides are operatively linked to an intra-polynucleotide. 9. The method of claim 8,
A composition wherein the Cas protein comprises one or more nuclear localization sequences. 10. The method of claim 9,
A composition wherein the Cas protein has the activity to direct cleavage of both polynucleotide strands at the position of the target-sequence. The method of claim 1,
A composition wherein the Cas protein encoding polynucleotide is codon-optimized for the host cell. 9. The method of claim 8,
A composition wherein the high-strength promoter is one of the following promoters:
Labyrinthulomyset EF-1 promoter, arginase promoter, pyruvate kinase promoter, heat shock protein promoter and glyceraldehyde 3-phosphate dehydrogenase promoter. 13. The method according to any one of claims 1, 4 and 7 to 12,
A composition wherein the medium-strength promoter is one of the following promoters:
Alpha tubulin promoter, isocitrate lyase promoter, aconitate hydratase 2 promoter, malate dehydrogenase promoter and vacuolar ATP synthase subunit D promoter. A method of modulating the expression of a polynucleotide in a cell, comprising contacting a host cell with a composition according to claim 1 , wherein the guide-polynucleotide directs binding of a Cas protein at a target-polynucleotide in said host cell to CRISPR How to form the -Cas complex. 15. The method of claim 14,
A method wherein the host cell comprises a polynucleotide encoding a compound of interest. 15. The method of claim 14,
A method wherein the host cell is a recombinant host cell. 13. A host cell comprising a composition according to any one of claims 1, 4 and 7 to 12. A method of producing a host cell, comprising contacting the host cell with a composition according to claim 1 , wherein the guide-polynucleotide directs binding of a Cas protein at a target-polynucleotide in said host cell to form a CRISPR-Cas complex how to do it. 19. The method of claim 18,
A method of contacting a host cell first with a source of Cas protein and subsequently with a source of guide-polynucleotides. 20. The method of claim 19,
A method, wherein the host cell comprises a polynucleotide encoding a compound of interest. 18. The method of claim 17,
A host cell comprising a polynucleotide encoding a compound of interest. 13. A method for producing a compound of interest, comprising culturing a host cell comprising a composition according to any one of claims 1, 4 and 7-12 under conditions conducive to the production of said compound of interest. How to. 21. The method according to any one of claims 14 to 16 and 18 to 20,
A method wherein the Cas protein is a Cas9 protein. delete delete

Images