CN1766104A - Method for atom force microscope inducing single molecule DNA positoning mutation - Google Patents

Abstract

The method to induce monocular DNA directed mutation by atomic force microscope in biotechnology field comprises steps shown follow: (1) preparing mica substrate modified by aminosilane; (2) labelling the end of DNA sample; (3) straightening and preparing the labelled sample; (4) inducing mutation; (5) collecting and separating the induced DNA segment; (6) amplifying monocell; (7) detecting amplification by agarose gel electrophoresis; (8) sequenching sample DNA, and screening the mutated sample. The advantages of this invention include: precise location, high resolution, high efficiency, and simple operation.

Description

Method for atom force microscope inducing single molecule DNA positoning mutation

Technical field

What the present invention relates to is the method for a kind of method of biological technical field, particularly a kind of atom force microscope inducing single molecule DNA positoning mutation.

Background technology

(Atomic Force Microscopy AFM) also claims scanning force microscopy to atomic force microscope, is that the Quate of breadboard Binnig in IBM Zurich and Stanford University teaches in invention in 1986.The principle of work of AFM is similar to an old-fashioned stylus formula phonograph, and it scans local surface with nano level resolving power with a small probe, and interacting with the mechanics between microprobe and the sample surfaces characterizes the pattern and the mechanical information on surface.If suitably control the power that probe applies the surface, just can carry out accurately controlled real-time detection, modification and transformation to the local surface of sample.AFM is wide to the suitability of sample, can carry out imaging and manipulation to various samples, comprises imaging and manipulation to biological sample such as DNA.

In manipulation research to DNA, M.Rief etc. are at " Nature Structural Biology " 1999,6 (4): " Sequence-dependent mechanics of single DNAmolecules " (Nature Journal structure biology fascicle of delivering on the 346-349, " unique DNA sequence rely on mechanical property character ") propose in the literary composition: when dna molecular being done to stretch when handling with AFM, if the power that afm tip applies is greater than 65pN, then the secondary structure of dna molecular can be become excessive tensile S type structure by common Type B structure, after external force is cancelled, can not reply and be the Type B structure.Human AFM such as H.Hansma do radial cuts to the dna molecular that is fixed on the substrate surface, and the mechanical force that the discovery afm tip applies can cause the damage of DNA, even the DNA chain break.These mechanical force that studies show that the microcell to dna molecular applies may cause the variation of partial dna molecule itself or pairing behavior.

Transgenation on the dna molecular is meant owing to the displacement of DNA base pair, increases or lack the variation of the gene structure that causes.Present artificial gene mutating technology comprises random mutation and rite-directed mutagenesis.Thereby compare the random mutation technology, site-directed mutagenesis technique can accurately be controlled the mutational site, introduces catastrophe point by designing specific primer, carries out polymerase chain amplified reaction (PCR reaction) then the gene after obtaining sudden change.This method is being widely used aspect the researchs such as functional genomics, gene therapy, the screening of medicine target, cell signaling path analysis, protein interaction, but the multiple spot rite-directed mutagenesis is a difficult point in the section of DNA sequence.H.Hogrefe etc. are published in " Biotechniques " (" biotechnology ") magazine, 2002,33 (5): in the article of 1158-1165 " Creating randomized amino acid libraries with the QuikChange MultiSite-Directed Mutagenesis Kit ", adopt QuickChang ^TMThe test kit point mutation process carries out multiple spot mutagenesis to DNA, mention with rite-directed mutagenesis count out increase the sudden change successful efficient descend greatly.Special needs to be pointed out is, no matter in random mutation or rite-directed mutagenesis field, also still be based upon on the polymolecular system basis with statistical significance at present, all can not on single molecules level, carry out mutagenesis, and all do not have report by the transgenation of mechanical force inductive to single DNA molecules.Because the accurate positioning function of AFM is carried out mechanical force location induced mutation to single or multiple sites and is had practical significance, and is feasible on principle on single molecules level.

Summary of the invention

The objective of the invention is to overcome deficiency of the prior art, a kind of method for atom force microscope inducing single molecule DNA positoning mutation is provided, make it have high resolving power, accurately the location is easy and simple to handle when economizing on, the advantage that is easy to carry out.

The present invention is achieved by the following technical solutions, and the present invention realizes by the manipulation of afm tip to the single DNA sample, attached with unit molecule pick up, single-molecule PCR amplification and conventional sequence measurement, finally obtain the sample after the positional mutation.The inventive method may further comprise the steps:

(1) mica substrate of preparation aminosilane modification;

(2) end mark of DNA sample;

(3) the stretching preparation of DNA sample behind the mark;

(4) AFM carries out induced mutation to DNA;

(5) AFM is to inducing the separation of picking up of back dna fragmentation;

(6) unit molecule of the dna fragmentation after separation amplification;

(7) agarose gel electrophoresis detects the amplification situation;

(8) determined dna sequence of amplification sample filters out the sudden change sample.

In the described step (1), be that 3-amino-propyl group-triethoxyl silane (APTES) of 1% is modified substrate with volumetric concentration.

Described step (2), be meant: the DNA with known array does template, make primer with single-ended by biotin labeled few nucleic acid, carry out polymerase chain reaction (PCR) amplification and obtain the dna molecular of the single-ended mark of vitamin H, and then and avidin avidin effect (molar ratio of avidin and DNA is 2: 1), just obtain the dna molecular of the single-ended mark of avidin, because the avidin volume is bigger, can obviously distinguish with dna molecular, therefore can discern by AFM, thus the mark end of affirmation dna molecular.

Described step (3), stretching suitable all DNA samples of DNA sample.There are three kinds of methods can the DNA sample is stretching on the surface that APTES modifies: on (1) DNA sample drop mica after APTES modifies that mark is good, to adopt centrifuging that the DNA sample drop is thrown away, rely on centrifugal force that dna molecular is stretching on the APTES surface; (2) mark is good DNA sample drop is used clean cover glass one side contacts sheet mica then on the mica after the APTES modification, fall along a direction and cover on mica, and is by the gravitation of liquid stream that dna molecular is stretching on the APTES surface; (3) mark is good DNA sample drop adopts clean cover glass one side to scrape from mica along certain angle on the mica after the APTES modification, and is by the gravitation of liquid stream that dna molecular is stretching on the APTES surface.

Described step (4) is the committed step in the entire method, and concrete operations are:

1) by AFM to stretching DNA sample large area scanning, find the dna molecular of mark;

2) make recognition site by mark, DNA is gone up want the target sequence of mutagenesis to position;

3) dwindle sweep limit to being fit to size;

4) open the pattern of raising, ordering parameter is provided with, go up apart from the definite some position that will suddenly change of the length of gauge point by measuring DNA, be accurate in the 5nm, at this some place dna molecular is done one-line scanning, reduce the needle point height, add the mechanical force that the hour hands point that exposes thoroughly applies dna molecular, but be less than power used when DNA cut off, dna molecular is carried out mutagenesis.

5) induce end after, reduce the effect of the power that applies, return imaging pattern.

Described step (5) is meant: after afm tip is to the dna molecular induced mutation, will induces the dna fragmentation in zone to separate by afm tip and pick up.Will cut off at isolating fragment two ends by needle point earlier, use the method for " rubbing " then, dna molecular is folded into a particle, pick up by afm tip then.

Described step (6), the amplification of isolated fragment adopt the single-molecule PCR amplification, and the PCR reaction system is referring to various commercial polysaccharase specification sheetss.The unit molecule amplification program is different with conventional PCR program, and amplification condition is: at first 95 ℃ of preheatings are 2 minutes; 50 circulations then, divided for three steps:

1) uses for reference booster PCR and hot startup procedure, improve 10 ℃ of annealing temperatures, improve specificity, annealing time is increased to 3 minutes, makes primer that enough time and template pairing, 10 circulations be arranged, each circulation comprises: 94 ℃ of sex change 30 seconds, and 65 ℃ of annealing 3 minutes, 72 ℃ were extended 45 seconds;

2) use for reference the touchdown PCR program, further amplify template signal, 10 circulations, each circulation comprises: 94 ℃ of sex change 30 seconds, 65 ℃ drop to 58 ℃ of annealing 1 minute, and 72 ℃ were extended 45 seconds;

3) conventional PCR program increases output, 30 circulations, and each circulation comprises: 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 1 minute, 72 ℃ were extended 45 seconds;

Last 72 ℃ were extended 7 minutes.

Described step (7), agarose gel electrophoresis may further comprise the steps:

1) sepharose (containing the staining agent ethidium bromide) of preparation 1.5%;

2) draw electrophoresis chamber point sample on the PCR product of different samples, with the time point molecular weight marker as reference;

3) voltage of 4～5V/cm in addition, electrophoresis;

4) gel imaging system ultraviolet detection analytical results.

Described step (8), the determined dna sequence of amplification sample is meant: do conventional order-checking (order-checking of Sanger method) to detect the positive sample of amplification through agarose gel electrophoresis.With former sequence alignment sequencing result, detect sudden change.

In the method for atom force microscope inducing single molecule DNA positoning mutation of the present invention, atomic force microscope induced mutation referent comprises DNA and RNA.

In the present invention, employing applies the method for mechanical force in microcell, utilize physical factor that single DNA molecules is positioned sudden change, this is a kind of method inductive dna mutation technology of brand-new physics, compare with the method for the physical factor inducing DNA random mutation of routine, then can be on single molecules level by AFM inductive DNA variation, with the resolving power less than 5nm accurately navigate on the dna molecular chain more arbitrarily.On principle, this method can position on section of DNA brings out multipoint mutation.It is remarkable to have effect, operates controlledly, and high resolving power is determined the position, and is easy and simple to handle when economizing on, the advantage that is easy to carry out.Fragment after the sudden change is picked up the back produce molecule after the mass mutation, can carry out follow-up molecular biology operation easily by single-molecule PCR amplification.This technology has potential and huge using value with being applied to fields such as functional genomics, gene therapy, the screening of medicine target, cell signaling path analysis, protein interaction as having replenishing of site-directed mutagenesis technique now.

Description of drawings

Fig. 1 the inventive method schema

Fig. 2 by AFM to single DNA segmentally induce, cutting, sepn process figure

Fig. 3 is by the figure as a result of the isolating single copy template PCR of AFM reaction

Embodiment

Provide embodiment in conjunction with content of the present invention:

The AFM of one section sequence on the embodiment pBR322 plasmid DNA locatees mechanical induced mutation

As shown in Figure 1, AFM may further comprise the steps location machinery induced mutation and the detection of pBR322 DNA:

1. preparing the mica substrate that aminosilane (APTES) is modified, is 3-amino-propyl group-triethoxyl silane (APTES) modification substrate of 1% with volumetric concentration.Concrete steps are:

1) the APTES dilute with water is that volumetric concentration is 1%, and draws 20 μ l and drip sealing on the film in cleaning;

2) new dissociated mica (20mm * 20mm) blow away chip, the anti-lid on the APTES drop with rubber suction bulb;

3) room temperature is modified 5min, with redistilled water drip washing 4 times, places on the filter paper, dries up with clean nitrogen;

4) mica of modified places baking oven 120 ℃ of bakings 2 hours, then through ultraviolet irradiation 15min;

5) it is standby to place moisture eliminator to preserve.

2. being template with the pBR322 plasmid DNA, is that upstream primer increases with biotin labeled oligonucleotide, is 4 with the length that obtains single-ended mark, the DNA sample of 220bp.Primer is:

P1：5’-biotin-ACGCTCGTCGTTTGGTATGGC-3′

P2：5′-CCGGCTGGCTGGTTTATTGC-3′

In DNA and avidin--the mol ratio of-avidin is 1: 2 a ratio, and the DNA after the amplification is mixed with avidin, in 37 ℃ of incubation 30min, makes the dna marker that can be discerned by afm tip.

3. the DNA sample behind the mark is stretching in the mica surface of APTES modification.Stretching method is: on the mica of the DNA sample drop that mark is good after APTES modifies, adopt clean cover glass one side to scrape from mica along certain angle, and by the gravitation of liquid stream that dna molecular is stretching on the APTES surface.

4.AFM mechanical induction to target sequence.Concrete steps are as follows:

1) target sequence of determining the mutagenesis of wanting is to be the fragment of 173bp to 511bp apart from the mark end,

2) find the dna molecular of mark by the afm tip large area scanning, measure the length of dna molecular, estimate the base number that the length of every nanometer contains, calculate the position (between mark end 70nm-210nm) of the pairing DNA of 173bp-511bp, dwindle sweep limit then to the target sequence zone, about 300nm * 300nm; Definite position 284bp that wants the point of mutagenesis is promptly apart from gauge point 120nm place;

3) at this some place dna molecular is done one-line scanning, open the pattern of raising, ordering parameter is provided with, reduce the needle point height, add the mechanical force that the hour hands point that exposes thoroughly applies dna molecular, control this power greater than the required power of imaging (0.5nN), but less than cutting institute exert oneself (10nN), the power between the 0.5nN to 10nN of promptly being used in is to dna molecular enforcement mechanical induction mutation effect;

4) return imaging pattern, mutagenesis finishes.

5.AFM the separation of picking up to the mutagenesis zone.For guaranteeing that the mutagenesis zone is included in the isolating fragment, the fragment of picking up is greater than the zone of institute's mutagenesis, and the fragment that will pick up in this example is 0nm-250nm.Concrete operations are as follows:

1) the 3rd operating method in 3 set by step done one-line scanning at the 250nm place, adopts the power cut-out DNA of about 10nN;

2) use the power (about 9.5nN) slightly littler, dna molecular is rubbed into particle than cutting;

3) DNA is picked up separation.

Cutting is seen Fig. 2 with separating resulting, (a) is the image before the mutagenesis, can see the stretching single DNA molecules of linear, and there is a white round dot its upper end, and this is the top marker of dna molecular; (b) image for cutting after the mutagenesis shows that cut-out is fine, and there is no other fractures in the middle of the cut part; (c) pick up image after the separation, show that the target fragment after the cutting is picked up away by needle point, all the other fragments still stay put.

Repeating step 3 and step 4 are carried out same induced mutation process and cutting pick process to the stretching good single DNA molecules of different zones, obtain 5 target sample altogether.

6. utilize round pcr respectively 5 target sample of picking up to be increased, amplification is the ExTaq polysaccharase of Takara company with polysaccharase, and primer sequence is:

P1：5′-CTCTTACTGTCATGCCATCCG-3′；

P2：5′-CCGTGTCGCCCTTATTCC-3′

Amplification system is:

Ex Taq enzyme (5U/ μ L)	0.25μL
		10 * PCR damping fluid	2.5μL
DNTP substrate (10mM)	2.5μL
		Primer 1 (10 μ M)	0.5μL
Primer 2 (10 μ M)	0.5μL
		Template	5μL
H 2O	Adding water, to supply cumulative volume be 25 μ L

Amplification condition is: 95 ℃ of preheatings 2 minutes; 50 circulations, divided for three steps: 10 circulations of the first step, each circulation comprises: 94 ℃ of sex change 30 seconds, 65 ℃ of annealing 3 minutes, 72 ℃ were extended 45 seconds; Second step 10 circulations, each circulation comprises: 94 ℃ of sex change 30 seconds, 65 ℃ drop to 58 ℃ of annealing 1 minute, and 72 ℃ were extended 45 seconds; The 3rd step 30 circulations, 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 1 minute, 72 ℃ were extended 45 seconds, and last 72 ℃ were extended 7 minutes.

7. the DNA sample after the amplification being carried out agarose gel electrophoresis detects.

Amplification as shown in Figure 3.Be followed successively by M from left to right: molecular weight marker (DL2000 of Takara company is respectively 2000bp, 1000bp, and 750bp, 500bp, 250bp, 100bp); 1,2,3,4,5: separate the single-molecule PCR amplification system that picks up sample; 6,7: blank negative control; 8: positive control.As can be seen from the figure, sample 1,2,3,5 has positive findings, and the same with positive control, molecular weight of product is at 338bp.These results show that afm tip is induced and do not cause producing fracture in the middle of these 4 the single separated DNA fragments that because if fracture, PCR amplifies and can not carry out.Sample 4 does not have band, may be because the unit molecule that picks up is lost before entering amplification, might be the unit molecule amplification failure of this sample yet, because unit molecule amplification difficulty is higher, can not guarantee 100% amplification efficiency.Blank does not have the band explanation not pollute.

8. to the detection of AFM mechanical force induced mutation.Dna fragmentation after AFM mutagenesis picks up after PCR amplifies in separation, can be detected the result of induced mutation by conventional sequence measurement.And compare with the original template sequence, to detect the effect of mutagenesis.Sequencing (display sequence is certainly apart from mark end 259bp to 308bp) result such as following table:

The original template sequence	CCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATA
		Sample 1	CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATA
Sample 2	CCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATA
		Sample 3	CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATA
Sample 5	CCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATA

As above showing black matrix shows, sample 1,3,5 a transition mutations (becoming T by C) occurred in the position of distance mark end 284bp, this site is positioned at the 112nd base place behind mutagenesis district (173bp-511bp) the section start 173bp, be not the end sequence that appears at amplification, can get rid of because the sequence measurement interference causes.Sample 2 is all C in the sequence in this site mutually with the original template sequence.Efficiency of inducing mutation is greater than 50%, and as seen implementing AFM is localized and efficiently to the induced mutation of dna molecular on single molecules level.

Claims (10)

1, a kind of method for atom force microscope inducing single molecule DNA positoning mutation is characterized in that, on single molecules level, the mechanical force location scanning inducing DNA sudden change by atomic-force microscope needle-tip may further comprise the steps:

(1) mica substrate of preparation aminosilane modification;

(2) end mark of DNA sample;

(3) the stretching preparation of DNA sample behind the mark;

(4) atomic force microscope is carried out induced mutation to DNA;

(5) atomic force microscope is to inducing the separation of picking up of back dna fragmentation;

(6) unit molecule of the dna fragmentation after separation amplification;

(7) agarose gel electrophoresis detects the amplification situation;

(8) determined dna sequence of amplification sample filters out the sudden change sample.

2, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1 is characterized in that, in the described step (1), is that 3-amino-propyl group of 1%-triethoxyl silane is modified substrate with volumetric concentration.

3, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1, it is characterized in that, described step (2), be meant: the DNA with known array does template, make primer with single-ended by biotin labeled few nucleic acid, carry out polymerase chain reaction (PCR) amplification and obtain the dna molecular of the single-ended mark of vitamin H, thereby and then and the effect of avidin avidin confirm the mark end of dna molecular.

4, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1, it is characterized in that, described step (3), be meant: on the mica of the DNA sample drop that mark is good after 3-amino-propyl group-triethoxyl silane is modified, use the pure water folk prescription to flushing then, by the gravitation of liquid stream that dna molecular is stretching on 3-amino-propyl group-triethoxyl silane surface; Perhaps adopt centrifuging that the DNA sample drop is thrown away, rely on centrifugal force that dna molecular is stretching on 3-amino-propyl group-triethoxyl silane surface; Perhaps adopt clean cover glass one side to scrape from mica along certain angle, by the gravitation of liquid stream that dna molecular is stretching on 3-amino-propyl group-triethoxyl silane surface.

5, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1 is characterized in that, described step (4), and concrete operations are:

1) by atomic force microscope to stretching DNA sample large area scanning, find the dna molecular of mark;

2) make recognition site by mark, DNA is gone up want the target sequence of mutagenesis to position;

3) dwindle sweep limit to being fit to size;

4) open the pattern of raising, ordering parameter is provided with, go up apart from the definite some position that will suddenly change of the length of gauge point by measuring DNA, be accurate in the 5nm, at this some place dna molecular is done one-line scanning, reduce the needle point height, add the mechanical force that the hour hands point that exposes thoroughly applies dna molecular, but be less than power used when DNA cut off, dna molecular is carried out mutagenesis;

5) induce end after, reduce the effect of the power that applies, return imaging pattern.

6, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1, it is characterized in that, described step (5), be meant: after atomic-force microscope needle-tip is to the dna molecular induced mutation, to induce the dna fragmentation in zone to separate by atomic-force microscope needle-tip and pick up, will cut off at isolating fragment two ends by needle point earlier, use the method for " rubbing " then, dna molecular is folded into a particle, picks up by atomic-force microscope needle-tip then.

According to claim 1 or 5 or 6 described method for atom force microscope inducing single molecule DNA positoning mutation, it is characterized in that 7, atomic force microscope induced mutation referent comprises the nucleic acid of DNA and RNA.

8, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1 is characterized in that, described step (6), and the single-molecule PCR amplification program is adopted in the amplification of isolated fragment.

9, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 8 is characterized in that, described single-molecule PCR amplification program, and amplification condition is as follows: 95 ℃ of preheatings 2 minutes; 50 circulations, divided for three steps: 10 circulations of the first step, each circulation comprises: 94 ℃ of sex change 30 seconds, 65 ℃ of annealing 3 minutes, 72 ℃ were extended 45 seconds; Second step 10 circulations, each circulation comprises: 94 ℃ of sex change 30 seconds, 65 ℃ drop to 58 ℃ of annealing 1 minute, and 72 ℃ were extended 45 seconds; The 3rd step 30 circulations, 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 1 minute, 72 ℃ were extended 45 seconds, and last 72 ℃ were extended 7 minutes.

10, method for atom force microscope inducing single molecule DNA positoning mutation according to claim 1 is characterized in that, described step (7), and agarose gel electrophoresis may further comprise the steps:

1) sepharose of preparation 1.5% contains the staining agent ethidium bromide;

2) draw electrophoresis chamber point sample on the PCR product of different samples, with the time point molecular weight marker as reference;

3) voltage of 4～5V/cm in addition, electrophoresis;

4) gel imaging system ultraviolet detection analytical results.

Images