CN1974593A - Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith - Google Patents
Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith Download PDFInfo
- Publication number
- CN1974593A CN1974593A CNA2006100225000A CN200610022500A CN1974593A CN 1974593 A CN1974593 A CN 1974593A CN A2006100225000 A CNA2006100225000 A CN A2006100225000A CN 200610022500 A CN200610022500 A CN 200610022500A CN 1974593 A CN1974593 A CN 1974593A
- Authority
- CN
- China
- Prior art keywords
- primer
- oppositely
- alpha
- genome
- prolamine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind of primers designed based on the SNP sites in alpha-prolamine DNA sequence and with one mispairing site introduced to the four bases in 3' end, and each of the primers may be combined to amplify identification segment only. By means of detecting these markers, it is possible to predict the alpha-prolamine gene family composition of wheat, speed the breeding and evaluate and utilize germplasm resource. The present invention has convenient use, quick and obvious effect and excellent application foreground.
Description
Technical field
The invention provides the molecule marking method of analyzing alpha-alcohol soluble protein gene, belong to molecular genetic breeding field, be exclusively used in the seed selection of wheat fine quality and the evaluation utilization of germ plasm resource.
Background technology
The wheat preservation protein amount is big and have an important economic value.Prolamine is one of its main component, accounts for the 40-50% of storage protein greatly.Difference according to mobility in A-PAGE (acid polyacrylamide gel electrophoresis), prolamine can be divided into α (the fastest), β, γ and 4 zones of ω (the slowest), only there are three types of α (α and β district), γ and ω in studies show that of molecular level, and wherein alpha-alcohol soluble protein content is the highest.Present research has found in the goatweed species of diploid, tetraploid and hexaploid wheat and nearly edge this albumen is arranged all.
The encoding gene of wheat alpha-prolamine therewith is positioned on the chromosomal galianconism of the 6th homology group (Gli-A2, Gli-B2 and Gli-D2), have and studies show that the alpha-alcohol soluble protein gene copy number is greater than 100 in the hexaploid common wheat, wherein about 50% is pseudogene, therefore only there are some to be transcribed, to translate, are familiar with and utilize this class important gene that suitable difficulty is arranged.The relation of alpha-alcohol soluble protein and flower characters at present dispute is very big, and different researchers draws negative correlation, positive correlation even the conclusion that it doesn't matter respectively by quality test.Why so different conclusion is arranged, and may be because preparation method's itself limitation when complicacy that its is formed and quality test to a great extent.Because alpha-alcohol soluble protein content in seed storage protein is higher, so ratio is very high in the total protein that the mankind take in.But its particular peptide section is toxic to some, shows as celiac disease.Be used at present identifying that the method for wheat alpha-prolamine therewith is the A-PAGE method and the gene clone of seed storage protein, the shortcoming one of preceding kind of method is accurate inadequately, the 2nd, wait until after seed is gathered in the crops and just can detect and screen that efficient is not high; A kind of method workload in back is big, and can not truly reflect expression.
Because common wheat has A, B and three homeologous genomes of D, and the distribution of the expression period of the alpha-alcohol soluble protein of each genome control, expression amount, toxicity peptide section and all inequality to the features such as influence of quality.Also difference to some extent of the above-mentioned feature of all kinds gene in the genome simultaneously therefore develop at alpha-alcohol soluble protein in Wheat Breeding for Quality, and simple and effective molecule marker has very important using value.
Summary of the invention
The purpose of this invention is to provide a kind of specific marker that can identify common wheat B and D genome alpha-alcohol soluble protein gene.By detecting these marks, can predict that the alpha-alcohol soluble protein gene family of wheat constitutes, accelerate the progress of quality breeding; Can estimate and utilize germ plasm resource.
In order to reach purpose of the present invention, the technical solution used in the present invention is as follows:
Mononucleotide polymorphism site (SNP) is the very high a kind of heritable variation type of genomic dna medium frequency, and it is meant in the genome and has variations such as conversion, transversion, insertion, disappearance on a certain specific nucleotide position among the DNA.Auele Specific Primer of the present invention according to the design of the SNP site in the alpha-alcohol soluble protein dna sequence dna, is introduced a mispairing site just at last again in 4 bases of primer 3 ' end, purpose is to make primer have more specificity.
The present invention uses conventional PCR system.The primer that uses has 2 classes, and wherein a class is an Auele Specific Primer.
The explanation of table 1 Auele Specific Primer
| The primer numbering | Just/anti-primer | Primer sequence (5 '-3 ') | The pairing universal primer | Clip size | Karyomit(e) | Annealing temperature |
| P1F P4F P18F P23F Pgli-1 P45R P50F P58R P62R P68R | Positive and negative anyway anti-anti- | TTGCCCTCCTTGCTATTGGA TAGCAACCACCG/ACCACATT CAACAACCATATCCACAGCGA CGCAACTACCATATCCGAAGA TGGAGGGATGTAGACATTGAAGG GTTGGAAGGAGACCTGGCTAA TCCTACCAGCAGCCTAAGG CACATTGCAGGTAGCGTCAC ATGTAGACATTGCACA/GTTGGT TAGGAGACCTGGCTCGTCA | R2 R2 R1 R2 F1 F2 R2 F2 F2 F1 | The about 710bp of the about 870bp of the about 860bp of the about 200bp of the about 710bp of the about 880bp of the about 645bp of the about 730bp of the about 865bp of about 880bp | 6D 6D 6B 6D 6D 6D 6D 6D 6B 6B | 55℃ 55℃ 55℃ 55℃ 58℃ 60℃ 55℃ 55℃ 55℃ 55℃ |
("/" expression degeneracy)
An other class is a universal primer, is designated as F1 (ATGAAGACCTTTCTCATCCTTG) respectively, F2 (GG/CTCAATACAAATCCAC/TCATG), R1 (TCAGTT A/G GTACC G/AAAGATGCC) and R2 (TTCTCTTCTCAGTTA/GGTACCA/G).Special primer and the combination of suitable universal primer can realize specific amplification.
Be under the amplification condition of template with China spring nullisomic-limbs material DNA, each combination of primers all only can expand and the discriminating fragment.
PCR reacts composition: DNA 100-150ng
dNTPs 100μM
Primer P
14pmol
Primer P
24pmol
Taq plus polysaccharase 0.75U
10 * PCR damping fluid, 2.5 μ L
Mg
2+ 1.5mM
DdH
2O adds to final volume 25 μ L
The PCR response procedures: (1) 94 ℃ 4 minutes
(2) 94 ℃ 45 seconds
(3) 58～60 ℃ 1 minute
(4) 72 ℃ 40 seconds
Repeat (2) → (4) 40 times
(5) 72 ℃ 10 minutes
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.
Because the gene of coding alpha-alcohol soluble protein is positioned on wheat the 6th homology group galianconism, so the present invention uses 4 parts of nullisomics-limbs material of China spring the 6th homology group, is respectively N6AT6B, N6AT6D, N6BT6D and N6DT6B.N6AT6B represents that a pair of No. 6 karyomit(e) of A chromosome group is replaced by No. 6 karyomit(e) of B chromosome group, is nullisomic therefore, and is limbs that the rest may be inferred by analogy for it for a pair of 6A karyomit(e) for a pair of 6B karyomit(e).If a pair of like this special primer is not in that total DNA has the expection amplified production in the reaction system of template with N6DT6B, with N6AT6B, the total DNA of N6AT6D and N6BT6D has the purpose fragment in the reaction system of template, and we just think that it is positioned at the distinctive alpha-alcohol soluble protein gene of D genome.
The 6th homology group nullisomic-limbs material can be used in contrast when detecting breeding material, the false positive phenomenon that causes owing to reagent and instrument reason can be prevented like this by method of the present invention.Because the iteron and the difference of polyamine section length more than two of different alpha-alcohol soluble protein genes are big, for reducing the disadvantageous effect that difference in length is brought, we are with the conserved regions of universal primer design at the gene coding region two ends.
Enthusiasm effect of the present invention is as follows:
Have in the hexaploid common wheat above alpha-alcohol soluble protein 100 copy, about 50% is pseudogene, only has some to be transcribed, to translate, and therefore is familiar with and utilizes this class important gene that suitable difficulty is arranged.And the albumen of these genes encodings is relevant with quality, even relevant with people's disease.Addressing these problems the most simple and effective way is to cultivate suitable kind, but does not have detection method rapidly and efficiently at present in breeding work.The present invention is easy to use, and effect is fast obvious, and good prospects for application is arranged.
Description of drawings
Fig. 1: N6DT6B lacks type, and primer is to the electrophoresis detection result of P45R+F2;
Fig. 2: N6DT6B lacks type, and primer is to the electrophoresis detection result of P58R+F2;
Fig. 3: N6BT6D lacks type, and primer is to the electrophoresis detection result of P62R+F2;
Fig. 4: N6BT6D lacks type, and primer is to the electrophoresis detection result of P68R+F1;
M＝marker，1＝N6AT6B，2＝N6AT6D，3＝N6BT6D，4＝N6DT6B；
1000bp, 750bp, 500bp and 250bp represent the segmental size of marker respectively.
Embodiment
Embodiment 1:
Utilize primer that P1F+R2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system is as follows: DNA 100-150ng
dNTPs 100μM
Primer P
14pmol
Primer P
24pmol
Taq plus polysaccharase 0.75U
10 * PCR damping fluid, 2.5 μ L
Mg
2+ 1.5mM
DdH
2O adds to final volume 25 μ L
The PCR response procedures: (1) 94 ℃ 4 minutes
(2) 94 ℃ 45 seconds
(3) 55 ℃ 1 minute
(4) 72 ℃ 40 seconds
Repeat (2) → (4) 40 times
(5) 72 ℃ 10 minutes
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production
On 1.5% sepharose, separate 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 880bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P1F+R2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 2:
Utilize primer that P4F+R2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 865bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P4F+R2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 3:
Utilize primer that P18F+R1 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 730bp) | Have | Have | Do not have | Have |
Therefore the gene that can infer the P18F+R1 amplification is positioned at the B genome, and the SNP site of this primer foundation is that the B genome is peculiar.
Embodiment 4:
Utilize primer that P23F+R2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 645bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P23F+R2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 5:
Utilize primer that Pgli-1+F1 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system is formed with embodiment 1.
The PCR response procedures: (1) 94 ℃ 4 minutes
(2) 94 ℃ 45 seconds
(3) 58 ℃ 1 minute
(4) 72 ℃ 40 seconds
Repeat (2) → (4) 40 times
(5) 72 ℃ 10 minutes
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 880bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the Pgli-1+F1 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 6:
Utilize primer that P45R+F2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system is formed with embodiment 1.
The PCR response procedures: (1) 94 ℃ 4 minutes
(2) 94 ℃ 45 seconds
(3) 60 ℃ 1 minute
(4) 72 ℃ 40 seconds
Repeat (2) → (4) 40 times
(5) 72 ℃ 10 minutes
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 710bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P45R+F2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 7:
Utilize primer that P50F+R2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 200bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P50F+R2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 8:
Utilize primer that P58R+F2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 860bp) | Have | Have | Have | Do not have |
Therefore the gene that can infer the P58R+F2 amplification is positioned at the D genome, and the SNP site of this primer foundation is that the D genome is peculiar.
Embodiment 9:
Utilize primer that P62R+F2 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6； |
| Purpose fragment (about 870bp) | Have | Have | Do not have | Have |
Therefore the gene that can infer the P62R+F2 amplification is positioned at the B genome, and the SNP site of this primer foundation is that the B genome is peculiar.
Embodiment 10:
Utilize primer that P68R+F1 is identified China spring the 6th homology group nullisomic-limbs material.
Reaction system composition and PCR response procedures are with embodiment 1.
PCR is reflected at PTC-220 type PCR instrument, and (MJ Research carries out in U.S.A.).Amplified production separates on 1.5% sepharose, 100V constant voltage electrophoresis 45 minutes.The result is as follows:
| Material | N6AT6B | N6AT6D | N6BT6D | N6DT6B |
| Purpose fragment (about 710bp) | Have | Have | Do not have | Have |
Therefore the gene that can infer the P68R+F1 amplification is positioned at the B genome, and the SNP site of this primer foundation is that the B genome is peculiar.
Claims (2)
1, a kind of artificial design synthetic nucleic acid molecule, it is characterized in that, according to the design of the SNP site in the alpha-alcohol soluble protein dna sequence dna, in 4 bases of primer 3 ' end, introduce a mispairing site again, described primer has the oligomer of the particular sequence of following based composition:
(1) forward: 5 ' TTGCCCTCCTTGCTATTGGA3 '
Oppositely: 5 ' TTCTCTTCTCAGTTA/GGTACCA/G3 '
Or (2) forward: 5 ' TAGCAACCACCG/ACCACATT3 '
Oppositely: 5 ' TTCTCTTCTCAGTTA/GGTACCA/G3 '
Or (3) forward: 5 ' CAACAACCATATCCACAGCGA3 '
Oppositely: 5 ' TCAGTT A/G GTACC G/AAAGATGCC3 '
Or (4) forward: 5 ' CGCAACTACCATATCCGAAGA3 '
Oppositely: 5 ' TTCTCTTCTCAGTTA/GGTACCA/G3 '
Or (5) forward: 5 ' ATGAAGACCTTTCTCATCCTTG3 '
Oppositely: 5 ' TGGAGGGATGTAGACATTGAAGG3 '
Or (6) forward: 5 ' GG/CTCAATACAAATCCAC/TCATG3 '
Oppositely: 5 ' GTTGGAAGGAGACCTGGCTAA3 '
Or (7) forward: 5 ' TCCTACCAGCAGCCTAAGG3 '
Oppositely: 5 ' TTCTCTTCTCAGTTA/GGTACCA/G3 '
Or (8) forward: 5 ' GG/CTCAATACAAATCCAC/TCATG3 '
Oppositely: 5 ' CACATTGCAGGTAGCGTCAC3 '
Or (9) forward: 5 ' GG/CTCAATACAAATCCAC/TCATG3 '
Oppositely: 5 ' ATGTAGACATTGCACA/GTTGGT3 '
Or (10) forward: 5 ' ATGAAGACCTTTCTCATCCTTG3 '
Oppositely: 5 ' TAGGAGACCTGGCTCGTCA3 '
2, a kind of method of genome specificity amplifying primer labeling wheat alpha-prolamine therewith, comprise the checking of extracting genome DNA, design of primers, gene amplification, specific fragment, it is characterized in that, be primer with the described nucleic acid molecule of claim 1, the exploitation specific molecular marker.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100225000A CN1974593B (en) | 2006-12-14 | 2006-12-14 | Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100225000A CN1974593B (en) | 2006-12-14 | 2006-12-14 | Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1974593A true CN1974593A (en) | 2007-06-06 |
| CN1974593B CN1974593B (en) | 2011-05-04 |
Family
ID=38124979
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100225000A Expired - Fee Related CN1974593B (en) | 2006-12-14 | 2006-12-14 | Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1974593B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114591946A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related site qGLI-6DS |
| CN114592085A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related genetic locus |
| CN114592084A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related site qGLI-7DS |
-
2006
- 2006-12-14 CN CN2006100225000A patent/CN1974593B/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114591946A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related site qGLI-6DS |
| CN114592085A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related genetic locus |
| CN114592084A (en) * | 2022-03-11 | 2022-06-07 | 河南省农业科学院 | Molecular marker of wheat gliadin content related site qGLI-7DS |
| CN114591946B (en) * | 2022-03-11 | 2024-01-30 | 河南省农业科学院 | Molecular marker of related site qGLI-6DS of wheat gliadin content |
| CN114592084B (en) * | 2022-03-11 | 2024-01-30 | 河南省农业科学院 | Molecular marker of related site qGLI-7DS of wheat gliadin content |
| CN114592085B (en) * | 2022-03-11 | 2024-01-30 | 河南省农业科学院 | Molecular marker of genetic locus related to gliadin content |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1974593B (en) | 2011-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101067156A (en) | Multiple PCR method based on selective probe and application thereof | |
| CN108004312B (en) | Detect primer sets, kit and the method for cardiovascular disease related gene polymorphism | |
| CN1650028A (en) | Melting temperature dependent DNA amplification | |
| Pesik et al. | Development of SNAP markers based on nucleotide variability of WRKY genes in coconut and their validation using multiplex PCR | |
| CN1834261A (en) | Gene typing chips, prepn. process and uses thereof | |
| CN108034729A (en) | A kind of and the relevant EST-STR label Ls v-F36a of Growth Trait in White Shrimp Litopenaeus vannamei and its amplimer and application | |
| CN1450171A (en) | Detection type gene chip for detecting various infectious desease and use thereof | |
| CN1974593A (en) | Genome specificity amplifying primer and the method of labeling wheat alpha-prolamine therewith | |
| CN101045939A (en) | HBV DNA gene subtype detecting method and kit | |
| CN1880480A (en) | PCR method for detection of allele specific primer and use in detection of KLOTHO gene polymorphism | |
| CN1302111C (en) | Bluish dogbean micro satellite DNA label | |
| CN101051026A (en) | Double real time fluorescence PCR detecting method for vancomycin enterococcus | |
| CN1680596A (en) | Fluorescent quantitative PCR determination kit for Neisser | |
| CN104862382A (en) | Method and kit for detecting alcohol metabolism gene | |
| CN1932037A (en) | Method of screening transgenic wheat | |
| CN1186456C (en) | General purpose template nucleic acid detection method and kit | |
| CN1289691C (en) | Quick detection method of pathogenic microbe diagnosis type gene chip | |
| CN1257987C (en) | Molecule labelling method for specific PCR detection of genes related to chicken growth and egg-laying deseription by employing allelomorph and use thereof | |
| CN1200115C (en) | Oligonucleotide chip and its application of detecting muatatonal site of hepatitis B virus | |
| CN1140632C (en) | Methods for DNA amplification and kits therefor | |
| CN1896278A (en) | Quantitative fluorescent PCR inspection for hepatitis-B virus drug-tolerant gene mutation | |
| CN1769492A (en) | General molecular mark development method and designed general Gramineae mark | |
| CN1262673C (en) | Method for preparing nucleic acid probe library | |
| CN1548545A (en) | Public primer for multiple target sequence PCR detection and its multiple target nucleic acid sequence PCR proliferation method | |
| CN1944665A (en) | Primer sequence and detecting reagent kit for detecting delayed Edward's bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110504 Termination date: 20131214 |