CN1740337A - DNA marker for estimating seeds purity and method for applying DNA sequence to estimate seeds purity - Google Patents

Abstract

This invention relates to single DNA marking to rice WA cytoplasm male sterility line. Use this DNA base marker to evaluate seed purity. It is also a method of insuring purity of rice cytoplasm male sterility line.

Description

The method that is used to assess the dna marker of seed purity and uses dna sequence dna assessment seed purity

The present invention is the dividing an application that be March 28 calendar year 2001, denomination of invention the applying date for the Chinese patent application 01112469.5 of " method that is used to assess the dna marker of seed purity and uses dna sequence dna assessment seed purity ".

Technical field

The present invention relates to a kind of method of utilizing dna sequence dna as the assessment seed purity, relate in particular to dna sequence dna with homology and the Mitochondrial DNA of paddy rice, its tenuigenin for the wild abortion (WA) that contains cytoplasmic male sterile rice is distinctive, and uses these sequences and remove to distinguish male sterile line (CMS) of paddy rice and their male-fertile maintenance line of the same clan in polymerase chain reaction (PCR) detects.The present invention relates to utilize DNA base mark to guarantee a kind of method of the purity of cytoplasmic male sterile rice.

Background technology

Hybrid vigour is than among its parents any a kind of phenomenon of high production potential to be arranged the offspring of a hybridization of two line of inbreeding.Hybrid can produce the output than the best high 10-30% of strain, and it also is a welcome selection for increasing output.

Paddy rice is main cereal crop in the world, and it is the major portion of diet in many areas in Asia.According to estimates, many countries in the Asia resemble India, till 2025, the output of paddy rice must double to satisfy growing population needs [Hossain, 1996.InKhush (ed) rice genetics (Rice Genetics) III, Proc.Third Intl.RiceGenet.Symp., Los Banos Manila, Philippines, the international paddy rice of 16-20 Oct.1995. research institute, Manila, Philippines].As what China proved,, almost 50% of the paddy rice cultivated area all covered by hybrid in China.The extensive plantation of hybrid paddy rice is an ideal feasible selection for increasing output.By contrast, in the country resemble India, the cultivated area of hybrid rice is less than 1% of the total cultivated area of paddy rice.This has proved the great potential that increases the hybrid rice cultivated area, and people estimate that the market of hybrid rice seeds will increase in the country of many rice cultivations, and this comprises India.

For the production application of hybrid rice the most widely system be triple crossing system (table 1).The triple crossing system comprises: 1, male sterile female fertile line that is referred to as cytoplasmic male sterile line (CMS) gives its male sterile of sudden change because it carries one in genomic tenuigenin composition; 2, maintenance line; And 3, recover system.Maintenance line and recovery system are male-fertile and female educating.That CMS and maintenance line and genomic nuclear composition are actually is identical same nucleus such as (usually be referred) conducts, but genomic cytoplasmic composition is mutually different.The male sterile of CMS system is matrocliny, and most possibly is owing to suddenly change on Mitochondrial DNA.CMS system (female educating) can be by being bred with the pollen fertilization that derives from maintenance line.Because genomic tenuigenin can not shift by pollen, the offspring of hybridization will only hereditaryly have the tenuigenin that derives from CMS system like this, and will be male sterile therefore.Even the genomic nucleus composition of offspring has half to derive from maintenance line, owing to do not have what difference at the genomic composition of these two systems, the genomic nucleus composition of offspring also is identical with the nucleus composition of CMS system.

CMS system and another inbred parent is that the hybrid seed that produces in the hybridization is referred to as and recovers system, and resembling top is male-fertile and female educating specified.In this hybridization, CMS system works as female parent, is as male parent and recover system.Recovery ties up to and has a Rf gene/or a plurality of Rf gene (recovery that can educate) in its cell nucleus gene group, and it will recover the male fertility of source of cytoplasm in the plant of CMS system heredity.Therefore, the seed of the hybrid that produces in hybridization as shown in Figure 1 can be educated.CMS and recovery system will select rightly, and hybridization presents sufficient hybrid vigour (hybrid vigour) to obtain the output in fact higher than the kind of inbreeding like this.

The overwhelming majority's (90% or more) who has at present the hybrid rice of commercial value plantation in the world is from derive their tenuigenin [Yuan of a single resource, 1995, the hybrid rice production technology, paddy rice research board of management (Directorate of Rice Research), the Hyderabad, India], this tenuigenin is known as wild abortion (WA) tenuigenin, is found in the wild-rice of China.Subsequently, utilize the round-robin parent, this tenuigenin is hybridized with several different nucleus genetic backgrounds by repeated backcross as male donor.In this method, several different CMS are cultivated.Each all cultivates a large amount of hybrids with the hybridization of different recovery system in order in them, they all have identical WA tenuigenin.

It is important keeping the purity of hybrid, because any impurity all can reduce the output of expectation.According to estimates, per 1% impurity can make the output reduction reach 100kg/ hectare [Mao etc. in hybrid seed, 1996In Virmani, S.S., E.A.Siddiq, and K.Muralidharan (eds), hybrid rice Progress in technique (Advances in Hybrid Rice Technology) Proc.Third Intl.Symp.on Hybrid Rice, paddy rice research board of management (Directorate of Rice Research), Hyderabad, India].The purity of India's seed law regulation hybrid rice expectation should be 98% (Verma, 1996.Seed Tech.News 24:1-4).Being prescribed in the purity of Chinese hybrid rice is 96% (Wengui Yan, 2000., US Patent#6066779) at least.In order to ensure the level that hybrid seed purity requires, should there be high purity (almost 99%) level in the parent system that is used for cenospecies production.

A modal impurity that appears at the cenospecies production period is that CMS is the maintenance line impurity in the seed.Because they all are to be equal to the cell karyonide, except male sterile only can be judged in flowering period, going to distinguish these based on modal standard is to be extremely difficult.The level that the dna marker of distinguishing CMS and maintenance line may be studied exploitation and be used in seedling gets on and carries out appearing at as impurity the actual detected of maintenance line seed in the original seed of CMS system.Based on the dna marker on the basis, polymerase chain reaction hereto purpose be what extremely to be suitable for.Because they are than more effectively handling a large amount of samples based on the hybridization on the method basis of restriction fragment length polymorphism.

The polymerase chain reaction is based on uses on the basis that the short oligonucleotide sequence increases as the enzyme [urge] of the dna sequence dna of primer, and such dna sequence dna appears between two primers that are combined in target DNA site appropriate intervals.When oligonucleotide primer was designed on the basis of known target DNA sequence, PCR work was multiple.Based on (8-10 base long) of weak point, She Ji oligonucleotide primer [Williams etc., 1990 at random; Nucleic acids research (Nucleic acidsresearch) 18:6531-6535] the program of PCR be studied exploitation.These primers are based on known target DNA sequence, and the test kit that includes these a large amount of primers that produce at random commercialized supply all now.The dna marker that is studied exploitation in this way is called as randomly amplified polymorphic (RAPD) dna marker exactly.Because a large amount of primers is available, even Xiang Guan strain extremely, the polymorphism of its heredity (gene) also can detect in this way.Yet the repeatability of RAPD mark is bad, and this is because the oligonucleotide primer length of RAPD is short, also may be owing to the shortage that requires degree to target-specific.This has seriously limited the RAPD mark as a kind of practical application of distinguishing the diagnostic flag of different genotype.

Be used to distinguish the RAPD mark of paddy rice CMS (WA tenuigenin) and maintenance line, report (Jena and Pandey 1999 were once arranged; Hybrid Rice Newsletter, 2:13-14).Yet, because the low repeatability of these marks makes and can not use them in practice and with ordinary method CMS and maintenance line are distinguished.Therefore, research and development based on the repeated PCR on these method bases are necessary, and it can be applied to distinguishing CMS and maintenance line, if oligonucleotide primer is based on the basis of the regional known array of the paddy DNA with polymorphism between CMS and the maintenance line, may obtain ideal repetition level so.Because these primers are longer and to the target DNA sequence specific than being used in RAPD primer analytically on length, will be highly repeatably so detect based on the PCR on such primer basis.

Summary of the invention

In this application, be that the sequence in a special zone of Rice mtDNA is determined and identification is described for the CMS paddy rice that contains wild abortion type tenuigenin (WA).On this sequence basis, can be used in PCR detects, to distinguish CMS system (WA) and be studied exploitation with special oligomerization thuja acid primer that it is equal to the nucleus maintenance line.It is (all contain WA tenuigenin) and their homologous maintenance lines that these primers have been used to distinguish several different paddy rice CMS.Compile in the code test at one, this detection is used to predict the genotype of paddy rice CMS (WA) maintenance line mixture, and it has 100% accuracy.Therefore the breeder can use this detection and goes successfully to detect the impurity that keeps matter in the original seed of CMS system, has guaranteed this parent system and by its deutero-hybrid purity.

The source of another impurity is to be caused by the paddy pollen hybridization that is not the appointment maintenance line in the original seed of CMS system.Breeding [Virmani for paddy rice CMS system, 1993. agronomy progress (Advances in Agronmy) 57:377-462], the minimum isolation distance of regulation is 300 meters, interior except maintenance line (preferential pollen donor or male parent) in this distance, do not have the paddy rice of other strain to be cultivated, this is based on pollen of the paddy rice that is growing of deriving from beyond this distance and can not pollinates to female parent's the basis that is viewed as.Once in a while, this minimum isolation distance or do not strictly observed or because local condition (for example distinguished and admirable and weather) may allow the distances of pollen beyond being transferred to 300 meters from the rice crop of growing.Therefore, the degree of the inferior strain pollen donor of monitoring appearance during CMS breeds source far away hybridization is important.In this patent, described resembling little satellite and sequence tagged site (STSs) are used to estimate the degree of the source far away hybridization that occurs like this during the original seed of CMS system is bred the application method of sequence-specific PCR mark.

Although this application is to be used to estimate that paddy rice CMS is the degree of the source far away hybridization of appearance, but the similarity method that is used for estimating hybridization degree in source far away has been applied to other crop CMS system, and it is non-limiting to comprise corn, pearl millet, Chinese sorghum, wheat, heronsbill, mustard seed, Caulis et Folium Brassicae capitatae, the strongly fragrant dish of flowers and trees, tomato, pepper, gumbo etc.Here CMS system is used to the production of hybrid and suitable little satellite or STS mark also is feasible.

Being evaluated at of hybrid seed purity is to finish by growth test (GOT) test traditionally, this is based on characteristic (the distinguish hybrid) basis of the form of representative plant sample of growth and maturity and flower, rice plant to spend the time of some months could be ripe and also these seeds have to be stored under the suitable condition, so they will wait until that these test-results could be sold after feasible.In addition, as what occur, if in that first occupied season of growth also is will cause sizable delay under the situation in preferred season of hybrid cultivation by GOT after the cenospecies production in India.In such cases, seed is had to be stored and is reached 1 year to the season of growth arrival subsequently before can sell at them.Therefore wait for the result of GOT for seeds company's a large amount of fund in the cycle that prolongs simultaneously by form lock up with the hybrid original seed.Another defective of GOT is that it is responsive to the expression owing to the environmental influence morphological specificity.And, also there is this possibility, promptly disadvantageous weather condition (resembling strong wind or heavy rain) may damage or destroy the crop, and make the collection data become difficulty like this.

Considering from speed and accuracy aspect, is target with a superior test replacement GOT, is described based on a PCR who detects to be used to assess hybrid seed purity.These experiments comprise the little satellite of difference paddy rice hybrid parent system or the application of STS (sequence tagged site) polymorphism.These polymorphisms are codominant, and allelotrope is detected as the dna fragmentation of different sizes in PCR and agarose gel electrophoresis.Hybrid can be identified, because the allelotrope that is provided by two parents is provided for it, promptly separated DNA is in PCR after the application as a template from hybrid plant, and the fragments of two different sizes of pcr amplification are obtained.In these allelotrope one is provided by male sterile, female (CMS) parent who educates, and another is provided by male-fertile, the female parent who educates (recovering system).This test is used from 6 days rice seedling separated DNA and is carried out, and detects and can be done within 48 hours.This is implemented in based on the PCR's of seed purity test that seed is industrial will to cause sizable saving.The other modification to this detection of Miao Shuing need not experimentize on independent seedling in this experiment, and can experimentize at the colony's seedling that is obtained from the hybrid seed original seed.

The present invention relates to be used to assess the new dna marker of seed purity and use the method for guaranteeing the male sterile line purity of rice cytoplasmic based on the DNA of mark.This method is based on to be familiar with on other basis really to a special dna sequence dna of paddy rice WA cytoplasmic male sterile line, also is the research and development about the identical special dna marker of originating.These dna markers can be used to detect the impurity of the male-fertile maintenance line of CMS system.This application may be very favorable for hybrid rice industry, because above-mentioned mixture type usually causes cenospecies that the purity of a decline is arranged and the disadvantageous sale of product in commodity transaction.The present invention also provides in parent system, hybrid rice and other crop the method that resembles the so sequence-specific PCR marker detection of codominance of little satellite and STSs of using.

Many places in the world, paddy rice are main cereal crops.China is putting into practice the plantation of hybrid rice on a large scale, it is reported, hybrid rice plantation back output has increased 10-30%.People are desirably in the near future, and the hybrid rice technology also will be put into practice on a large scale in many other countries of growth paddy rice.At present, most of hybrid rice, by one three system's production, it comprises: 1 a, cytoplasmic male sterile line (CMS), because a sudden change (most likely plastosome) on rice genome tenuigenin composition, thus its be female educate but male sterile; 2, male fertile, female maintenance line of educating, it and CMS are that genome nucleus composition is identical, but have one can not induce male sterile different plasmone type; 3, male fertile, female recovery system of educating.CMS system works in hybridization as female parent, is the male parent and recover system.At the hybrid seed production period, CMS and recovery tie up in the very near distance is cultivated, and like this, deriving from the pollen that recovers system will be by pollination to taking that CMS is.Because CMS system is male sterile, it can not be by self-pollination knot kind, and all to be doomed at any seed that CMS fastens formation be owing to derive from the result of the pollen fertilization that recovers system.Recovering frenulum has the nucleus of one or more encoding genes, and it will recover the male-fertile of hybrid, even it has a CMS tenuigenin.Therefore hybrid is that selfing can be harvested.

CMS system is owing to itself be male sterile, and it can not be bred by selfing.In fact, CMS system breeds by being done as a male parent as a female parent and maintenance line with CMS system.The offspring's who occurs from this hybridization genotype will be identical with the genotype of CMS system, because in fact maintenance line and CMS system are identical on genomic nucleus composition.The offspring will have the male sterile characteristic of CMS system, because genotypic tenuigenin composition is provided by female parent, be CMS system under this test situation.Also note that maintenance line does not have any recovery of the cytoplasmic male sterility phenotype of CMS system.

The identity property of the cell nucleus gene type of CMS and maintenance line means that these two strains almost are undistinguishables by morphologic standard.This has just produced a practical problems, is that maintenance line impurity in the seed original seed is extremely difficult because go to detect at CMS.Can harvest because maintenance line is selfing, these impurity can not need to recover system's insemination the production Tanaka of hybrid rice just can produce seed, and this has caused the seed of maintenance line to pollute the seed of hybrid.Such pollution is the most normal observed at the production period of hybrid rice seeds, and causes the minimizing of desired output to reach the weak throughput of hybrid down on the farm.If the purity of hybrid does not reach the predetermined restricted of formulating at seed proof place (seed certificationagencies) (in India is 98%, in China 96%), all seeds all are rejected, and this is a considerable damage to seed producers (company).

The CMS that uses in the commodity production of hybrid rice system is most to be based on the basis that WA tenuigenin uses.In this patent, we have described for the recognition and verification that contains the distinctive dna sequence dna of WA tenuigenin rice strain, and this is and Rice mtDNA height homologous, based on this dna sequence dna the special sequence of oligonucleotide primer has been studied exploitation, it can be used to PCR and distinguish reliably in detecting and contains WA tenuigenin cytoplasmic male sterile rice and its consanguinity maintenance line.Being stranded these these primers can be utilized the impurity that removes to detect maintenance line in CMS system by hybrid seed raiser/seeds company, and by guaranteeing the purity of CMS system, main hybrid seed source of pollution are removed, and seed industry and farmer have been produced tangible interests.

Brief description of the drawings:

Fig. 1 is three systems that hybrid rice produces;

This figure is in three systems, and how a hybrid is produced next synoptic diagram.Cytoplasmic male sterility (CMS) be (pollen sterility) as female parent with hybridization as male parent's maintenance line (pollen can be educated) in work.Except pollen sterility in CMS system, CMS and maintenance line be equal to nuclear.Therefore, maintenance line is very important for breeding of CMS system.In case CMS is obtained, it just and one recover system's hybridization, this recoverys is the characteristic that has on the agronomy that a large amount of we want, and can recover offspring's fertility.Therefore the hybrid that produces by such hybridization can educate.

Fig. 2 is for being the pcr amplification of a special dna sequence dna to paddy rice CMS;

PCR is with regard to carrying out with micro-satellite primers RM9 (SEQ ID No.6 and SEQ IDNo.7) of describing as embodiment 3.The PCR product separates on 2% sepharose, with EB (ethidium bromide) dyeing, under ultraviolet lamp as seen.First swimming lane contain dna molecular amount mark [λ DNA with Hind III enzyme cut digestion (NEW England Biolabs, USA)]; Second swimming lane is the pcr amplification product (IR 62829B) that contains maintenance line; The 3rd swimming lane is hybrid (DRR H1), and the 4th swimming lane is a CMS system (IR 62829A), and a unnecessary DNA band only occurs in hybrid and CMS system, and the arrow of a black of usefulness that does not occur in maintenance line has been indicated in the right corner of glue.

Fig. 3 is that a paddy rice CMS is the nucleotide sequence (SEQ ID NO.1) of special DNA;

With micro-satellite primers RM9 a special DNA band of CMS is determined, and its equally being purified as described in Example 4.(ABI 3700 with an automatic dna sequencing instrument order-checking for this DNA band; ABI, Foster city, USA).This sequence is made up of 325 base pairs, the homology inquiry shows that it has homology highly with Rice mtDNA, and DBJ registration number #D21251 is except the base from the 1-36 position has a bit (difference), the PCR primer is based on that this sequence information is designed, and has only obtained amplification in CMS system.Forward primer is based on Rice mtDNA (from position 1-36) is not presented on the region base of homology, and reverse primer is based on the mtdna sequence basis.

Fig. 4 is the homology (SEQ.ID.NO.2) of CMS specific DNA sequence and Rice mtDNA;

The information of the dna sequence dna that obtains by checking order compares with Rice mtDNA as embodiment 4 describes, and DBJ registration number #D21251 uses the Boxshade server, Http:// www.ch.embnet.org/software/Box-form.html. go up available.

Fig. 5 detects for a PCR who distinguishes paddy rice CMS and maintenance line;

SEQ ID NO.4 and SEQ ID NO.5 amplification PCR products are separated on 1% sepharose, with EB (ethidium bromide) dyeing, under ultraviolet lamp as seen.First swimming lane is the dna marker of 1kb (doing base); Second swimming lane contains IR58025A (CMS); The 3rd swimming lane, DRR H2 (hybrid); The 4th swimming lane, IR 58025B (maintenance line); The 5th swimming lane, IR 62829A (CMS); The 6th swimming lane, DRR H1 (hybrid); The 7th swimming lane, IR 62829B (maintenance line).The CMS-maintenance line of three other groups is analyzed; And in all cases, observe amplification only in CMS system, and do not observe hybrid in maintenance line.

Fig. 6 is for to carry out the detection of restrictive fragment length polymerphism (RFLP) with the special dna sequence dna of CMS between paddy rice CMS and maintenance line as probe;

Spend the night at sepharose with the digestion of EcoR V Restriction Enzyme from IR 58025A (CMS) and the isolating genomic dna of IR 58025B (maintenance line) and to separate.Hybridize as the Southern that carries out described at embodiment 7 as probe with the dna sequence dna that CMS is special.On this probe hybridization a 2.3kb in the zone that IR 58025A (CMS) is, and at IR 58025B (maintenance line), the area hybridization of itself and a 0.6kb.

Fig. 7 is that a multiplex PCR that carries out for the CMS system of distinguishing paddy rice and maintenance line detects;

First swimming lane is dna molecular amount mark [λ DNA with Hind III digestion (NEW EnglandBiolabs, USA)]; Second swimming lane is IR 58025 A (CMS); The 3rd swimming lane is IR 58025B (maintenance line), and sample is by SEQ ID NO.4 and the independent amplification PCR products of SEQ ID NO.5 in second and third swimming lane; The 4th swimming lane is IR 58025A (CMS); The 5th swimming lane, IR 58025B (maintenance line), sample is by multiple SEQ ID NO.4, SEQ ID NO.5, SEQ.ID NO.8 and SEQ.ID No.9 amplification PCR products in fourth, fifth swimming lane.The monomorphism fragment is the PCR product of SEQ ID NO.8 and SEQ ID NO.9, and polymorphic bands is the PCR product of SEQ ID NO.4 and SEQ ID NO.5.

Fig. 8 detects for the PCR that measures paddy rice hybrid purity;

First swimming lane is a 1kb dna molecular amount mark, the pcr amplification that the little satellite locus of RM164 is carried out with primer; Second swimming lane is IR 40750 (recovering system); The 3rd swimming lane is DRR H1 (hybrid); The 4th swimming lane is IR 62829A (CMS).Notice that the fragment of a single polymorphic pcr amplification is observed in second, four swimming lanes.Hybrid has shown by what parents provided to have distinctive allelic two dna fragmentations.On behalf of a PCR who determines to derive from seed purity in the DRR H1 hybrid original seed and carry out, the 5-12 swimming lane detect.The appearance of two bands has shown the real hybrid of the 5th, 6,8,9,10,11 and 13 tracks representative, and the appearance of single band shows that by the plant of 7,12 band representatives are impurity (off-types).

In brief, the invention provides the DNA sequence (SEQ ID NO.1 and SEQ ID NO.3) that very big homology is arranged with Rice mtDNA, the sequence of mentioning here is distinctive for the wild abortion cytoplasm (WA) that contains rice cytoplasmic male sterile. The invention provides based on this sequence in PCR detects, be used for distinguishing paddy rice male sterile line (CMS) and with the male fertile maintainer basis of its homology on the oligonucleotide primer of oligonucleotide primer (SEQ ID NO.4 and SEQ ID NO.5).

In other imbody, the invention provides based on dna sequence dna method for the application oligonucleotide primer (SEQ ID NO.4 and SEQ ID NO.5) on the basis of the male maintainer of distinguishing cytoplasmic male sterile rice (CMS) and its homology in PCR detects.

In one embodiment, the invention provides the method that in PCR detects, contains the oligonucleotide primer of SEQ ID NO.4 and SEQ ID NO.5 based on dna sequence dna for the application on the basis of the male maintainer of distinguishing cytoplasmic male sterile rice (CMS) and its homology. Here said male sterile line contains WA (wild abortion) cytoplasm.

In one embodiment, the invention provides the method that in PCR detects, contains the oligonucleotide primer of SEQ ID NO.4 and SEQ ID NO.5 based on dna sequence dna for the application on the basis of the male maintainer of distinguishing paddy rice WA cytoplasmic male sterile line (CMS) and its homology. If here template DNA derives from CMS and is then the DNA cloning product is available, if template DNA derives from the male fertile maintainer of homology then the DNA cloning product is unavailable.

In another embodiment, the invention provides based on this dna sequence dna in PCR detects, be used for paddy rice WA cytoplasmic male sterile line (CMS) and with the male fertile maintainer basis of its homology on the method for the oligonucleotide primer that contains SEQ ID NO.4 and SEQ ID NO.5, the detection of pcr amplified fragment here is to dye by agarose gel electrophoresis and EBC subsequently (ethidium bromide).

In another embodiment, the invention provides based on this dna sequence dna in PCR detects, be used for distinguishing paddy rice WA cytoplasmic male sterile line (CMS) and with the male fertile maintainer basis of its homology on the method for the oligonucleotide primer that contains SEQ ID NO.4 and SEQ ID NO.5, the detection of pcr amplified fragment here is to finish by the radiolabeled nucleotides that detection is incorporated in the pcr amplification product.

In another embodiment, the invention provides based on this dna sequence dna in PCR detects, be used for distinguishing paddy rice WA cytoplasmic male sterile line (CMS) and with the male fertile maintainer basis of its homology on the method for the oligonucleotide primer that contains SEQ ID NO.4 and SEQ ID NO.5, here nonradioactive labeling's nucleotides is incorporated into pcr amplification product, and its detection is undertaken by colorimetric method, chemoluminescence method or Fluorescence Method.

In another embodiment, the invention provides based on dna sequence dna in the method for PCR-ELISA (enzyme connects immune absorption and detects) design reaction for the educated maintainer of the WA cytoplasmic male sterile line of distinguishing paddy rice and its homology. Described PCR-ELISA design reaction may comprise: (a) application of a capture probe that is labeled or a PCR primer that is labeled, and they can work to the suitable coated surface of solids that is made up of polystyrene, styrene, glass etc.; (b) nonradioactive labeling's [label is digoxin DIG (digoxigen), fluorescein etc.] nucleotides and detecting with the antibody of anti--DIG or anti-fluorescein subsequently in PCR, these antibody are linked enzyme for ELISA by covalency, and these enzymes comprise peppery room peroxidase, alkaline phosphatase, beta galactosidase, glucose oxidase etc. Comprise detection method that alternative method and probe to mark pcr amplification product fragment are adsorbed onto the surface of solids etc. for the modification of PCR-ELISA design reaction.

In one embodiment, the invention provides based on this dna sequence dna and in PCR detects, be used for distinguishing containing and the method for SEQ ID NO.4 and SED ID NO.5 primer on the male fertile maintainer basis of paddy rice WA cytoplasmic male sterile line and their homologies. The detection method here is based on FRET (the Fluorescence Resonance Energy Transfer) application foundation (FRET), and FRET is based on the detection system basis that comprises Taqman, Beacon molecule etc., and this is familiar with for the people who is proficient in this field.

In another embodiment, the invention provides based on this dna sequence dna basis, with the method that the multiplex PCR of first pair of oligonucleotide primer that contains SEQ ID NO.4 and SEQ ID NO.5 detects, it cooperates with second pair of oligonucleotide primer. As long as template DNA is from WA cytoplasmic male sterile line rather than obtained in the male maintainer, just can obtain the DNA cloning product with first pair of primer here. And, no matter template DNA derives from a CMS system or a male sterility maintainer line, can both obtain another DNA cloning product with the second cover primer, the second pair of oligonucleotide primer can be derived from any Sequence of the rice genome beyond the target region of first pair of primer, even what another need to be considered is to be comprised in the mixture of same PCR when two pairs of primers, the amplification of the success of each target DNA sequence should occur. The several oligonucleotide primers that belong to this second cover to the first set oligonucleotide primer to can be by the multiplex amplification reaction that carries out of success in PCR detects.

In another embodiment, the invention provides in the Southern hybridization check with the WA cytoplasmic male sterile line of the special dna sequence dna differentiation paddy rice of CMS and the method for its male maintainer of the same clan.

In another embodiment, the invention provides in PCR detects with resembling during little satellite and the so codominant sequence-specific dna marker of sequence tagged site (STSs) be evaluated at the breeding of cytoplasmic male sterility of paddy rice, have the seed source far away of impurity to hybridize degree in the heredity with the pollen donor (strain that is paddy rice is not specified maintenance line) of inferior strain and appearance as a result of.In another embodiment, the invention provides the method for DNA isolation from single seedling.Carry out pcr analysis, by genotype being assessed at sepharose and polyacrylamide gel electrophoresis, detect dyeing, if silver dyes and carries out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR by EB (ethidium bromide).

In one embodiment, the invention provides in PCR detects with resembling during little satellite and the so codominant sequence-specific dna marker of sequence tagged site (STSs) be evaluated at the breeding of cytoplasmic male sterility of paddy rice, have the seed source far away of impurity to hybridize degree methods in the heredity with the pollen donor (strain that is paddy rice is not specified maintenance line) of inferior strain and appearance as a result of.The DNA here is separated from the seedling of a colony (representative number of individuals may be 100 in this colony), and these seedlings germinate by the CMS original seed and obtain.Carry out the analysis of PCR, and by estimating that in the colony of evaluated position allelic frequency judges the degree of impurity.Estimation method of gene frequency in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

In one embodiment, the invention provides in PCR detects with resemble production that little satellite and the so codominant sequence-specific dna marker of sequence tagged site (STSs) be evaluated at any crop or hybrid be follow the breeding of the cytoplasmic male sterility of the plant of three economically valuables that are during, have the seed source far away of impurity to hybridize degree methods in the heredity with pollen donor (strain that is paddy rice is not specified maintenance line) inferior and appearance as a result of.DNA separates from single seedling.Carry out pcr analysis, by genotype being assessed, detect by EB (ethidium bromide) if dye, silver dyes and carry out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR at sepharose and polyacrylamide gel electrophoresis.

In one embodiment, the invention provides in PCR detects with resemble production that little satellite and the so codominant sequence-specific dna marker of sequence tagged site (STSs) be evaluated at any crop or hybrid be follow the breeding of the cytoplasmic male sterility of the plant of three economically valuables that are during, have the seed source far away of impurity to hybridize degree methods in the heredity with pollen donor (strain that is paddy rice is not specified maintenance line) inferior and appearance as a result of.DNA is separated from the seedling of a colony (representative number of individuals may be 100 in this colony).Carry out the analysis of PCR, and by estimating the degree of allelic frequency judgement impurity in evaluated position colony.Estimation method of gene frequency in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

In another embodiment, the invention provides in PCR detects with resembling little satellite and sequence tagged site (STS _s) parent of so codominant sequence-specific dna marker assessment paddy rice hybrid is the method for purity.Adopted one two system that produces hybrid rice here.These parents system comprises a female parent, and it has by temperature, photoperiod and causes conditionally male sterility sterile and that can induce the lethal chemical reagent of male gamete to handle.DNA be from single seedling, carry out isolating.Carry out pcr analysis, by genotype being assessed, detect by EB (ethidium bromide) if dye, silver dyes and carry out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR at sepharose and polyacrylamide gel electrophoresis.

In another embodiment, the invention provides in PCR detects with resembling little satellite and sequence tagged site (STS _s) parent of so codominant sequence-specific dna marker assessment paddy rice hybrid is the method for purity.Adopted one two system that produces hybrid rice here.These parents system comprises a female parent, and it has by temperature, photoperiod and causes conditionally male sterility sterile and that can induce the lethal chemical reagent of male gamete to handle.Here claimed is that these seedlings are that seeds germinated is obtained by the parent with DNA isolating method (representative number of individuals may be 100 in this colony) from the seedling of a colony.Carry out pcr analysis, and by estimating that allelic frequency in the colony of evaluated position judges the degree of impurity.The method of the gene frequency of estimation in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

In another embodiment, the invention provides in PCR detects with resembling little satellite and sequence tagged site (STS _s) any parent with hybrid of Economic Importance of the so codominant sequence-specific dna marker assessment method that is purity.One two system that has adopted hybridization to produce here.These parents system comprises a female parent, and it has by temperature, photoperiod and causes conditionally male sterility sterile and that can induce the lethal chemical reagent of male gamete to handle.DNA be from single seedling, carry out isolating.Carry out pcr analysis, by genotype being assessed, detect by EB (ethidium bromide) if dye, silver dyes and carry out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR at sepharose and polyacrylamide gel electrophoresis.

In another embodiment, the invention provides in PCR detects with resembling little satellite and sequence tagged site (STS _s) any parent with hybrid of Economic Importance of the so codominant sequence-specific dna marker assessment method that is purity.One two system that has adopted hybridization to produce here.These parents system comprises a female parent, and it has by temperature, photoperiod and causes conditionally male sterility sterile and that can induce the lethal chemical reagent of male gamete to handle.Here claimed is that DNA is a method (representative number of individuals may be 100 in this colony) separated from the seedling of a colony, and these seedlings are that seeds germinated is obtained by the parent.Carry out pcr analysis, and by estimating that in the colony of evaluated position allelic frequency judges the degree of impurity.Estimation method of gene frequency in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

In another embodiment, the invention provides as the seed of paddy rice or seedling and one three and be or two systems that are when being applied to the production of hybrid, in PCR detects with resembling little satellite and sequence tagged site (STS _s) method of so codominant sequence-specific dna marker assessment hybrid purity.DNA be from single seedling, carry out isolating.Carry out pcr analysis, by genotype being assessed, detect by EB (ethidium bromide) if dye, silver dyes and carry out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR at sepharose and polyacrylamide gel electrophoresis.

In another embodiment, the invention provides as the seed of paddy rice or seedling and one three and be or two systems that are when being applied to the production of hybrid, in PCR detects with resembling little satellite and sequence tagged site (STS _s) method of so codominant sequence-specific dna marker assessment hybrid purity.DNA is separated from the seedling of a colony (representative number of individuals may be 100 in this colony), and these seedlings are obtained by hybrid original seed seeds germinated.Carry out pcr analysis, and by estimating that in the colony of evaluated position allelic frequency judges the degree of impurity.Estimation method of gene frequency in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

In another embodiment, the invention provides when any crop or the seed of economic worth plant arranged or seedling and one three are or two systems that are when being applied to the production of hybrid, in PCR detects with resembling little satellite and sequence tagged site (STS _s) method of so codominant sequence-specific dna marker assessment hybrid purity.DNA be from single seedling, carry out isolating.Carry out pcr analysis, by genotype being assessed, detect by EB (ethidium bromide) if dye, silver dyes and carry out or radioactive label or inactive fluorescence labels are incorporated into detection method applicatory in the product of amplification of PCR at sepharose and polyacrylamide gel electrophoresis.

In another embodiment, the invention provides when any crop or the seed of economic worth plant arranged or seedling and one three are or two systems that are when being applied to the production of hybrid, in PCR detects with resembling little satellite and sequence tagged site (STS _s) method of so codominant sequence-specific dna marker assessment hybrid purity.DNA is separated from the seedling of a colony (representative individuality may be 400 in this colony), and these seedlings are obtained by hybrid original seed seeds germinated.Carry out pcr analysis, and by estimating that in the colony of evaluated position allelic frequency judges the degree of impurity.Estimation method of gene frequency in colony comprises the separation that makes the pcr amplified fragment that has fluorescence labels by gel electrophoresis, and with the assessment of the specific corresponding peak height of allelotrope.

Be to describe the present invention in detail, initial, PCR detect be separately from a cover rice strain that constitutes CMS (WA tenuigenin) the separated DNA template carry out.Keep kind and corresponding hybrid with the little satellite position (McCouch etc. of oligonucleotide primer amplification RM9 paddy rice, 1996.Rice GeneticsIII, Proc.Third Intl.Rice Genet.Symp.Los Banos Manila, the international paddy rice of Philippines 16-20Oct.1995. research institute, Manila, Philippines) the .PCR amplified fragments separates by agarose gel electrophoresis, and detects by ethidium bromide (EB) dyeing.Desired as PCR is detected, the RM9 site is detected, and is used to come from all three template DNAs that are, the pcr amplified fragment of an about 250bp is observed (Fig. 2).In addition, when only template DNA obtained from CMS system or hybrid, the pcr amplified fragment of an about 350bp could be observed (Fig. 2) in this reaction.Yet it is extremely sensitive that this segmental pcr amplification is found reaction conditions, even when template DNA obtains from CMS system or hybrid, does not also usually observe it.This shows that the primer of guiding the little satellite position of RM9 into can not be used to distinguish CMS system and maintenance line reliably.We think that it is because at the RM9 primer with contain in the target sequence of the cytoplasmic strain of CMS and can not match in good condition that the shortage of this repeatability occurs.

Subsequently, the CMS that shows in Fig. 2 is that the fragment (size is 325bp) of special pcr amplification is purified, and carries out determining of nucleotide sequence by forward and the reverse oligonucleotide primer that application derives from the RM9 position on automatic dna sequencer.The PCR nucleotide sequence that is determined as shown in Figure 3.

Pass through (the Bethesda of NCBI with the BLAST computation program, Maryland, USA) inquiry [Altschul etc., 1997. nucleic acids research (Nucleic Acid Res.) 25:3389-3402] of homologous DNA sequence is carried out in site in GenBank DNA database.Described dna sequence dna is with specific record [the registration number #D21251 in the database; Japan DNA database (DBJ), at this as a reference] be the height homologous.This record derives from the mitochondrial sequence of paddy rice (Oryza sativa) of genome area, the subunit 3 of its coding ribosomal protein S3, L16, S12 and nadh dehydrogenase.Here said dna sequence dna with Rice mtDNA homologous degree as described in Figure 4.Very clear, except the section of DNA sequence [corresponding with nucleotide sequence ACGGCCCTCATCACCTTCTTTCACTTTTTGTTTTTG (SEQ ID No.3)] that lacks in the described Rice mtDNA of registration number #D21251, the zone is a high homology.

Being used in a pair of oligonucleotide primer of distinguishing paddy rice CMS (WA) and maintenance line in the PCR detection is that the basis is designed (table 2 shows at the end of describing) with this sequence.One of them primer (forward primer) is based on to the special sequence of CMS system (Fig. 3), and another primer (reverse primer) is based on the Mitochondrial DNA of paddy rice of the genomic upstream region of ribosomal protein S3 gene, they are between Nucleotide #s1362 and 1384, as indicated in DBJ registration number #D21251, oligonucleotide primer [forward primer 5 '-ACTTTTTGTTTTTGTGTAGG-3 ' (SEQ ID No.4); Reverse primer 5 '-TGCCATATGTCGCTTAGACTTTAC-3 ' (SEQ ID No.5)] be used in the template DNA that derives from paddy rice CMS system and maintenance line and carry out the PCR detection, these template DNAs are listed in (shown in the end of describing) in the table 1.

When template DNA is from (IR 58025 A of CMS system, IR 62829 A, PMS 8A, PMS 10A, 78897 A) isolating, utilize primer SEQ ID No.4 and SEQ ID No.5 as primer, can obtain the product (Fig. 5) of the 325bp of a pcr amplification, and when template DNA source is maintenance line (IR 58025 B, IR 62829 B, PMS 8B, PMS 10B, 78897 B) but can not obtain.In the further evidence of this test, coding experiment is carried out in the genomic dna that extracts from 35 kinds of different rice plants, has 15 kinds to be the IR 58025A of CMS system in them, and 20 kinds is the IR 58025B of maintenance line.Those are CMS systems not understanding this 35 kind of plant, and those are under the situation of maintenance line, carry out PCR and detect.This detects each genotype that accurately is used to predict 35 kinds of different plants, has shown that PCR detects as the applicability of distinguishing paddy rice CMS and maintenance line method.

Here the special pcr amplified fragment of said CMS is to use α ³²P-dATP is radiolabeled.Digest with different restriction enzymes with the separated genomic dna of maintenance line (IR 58025B and IR 62829B) from consanguinity paired CMS (IR 58025A and IR 62829A), separate by agarose gel electrophoresis, with radiolabeled probe hybridization (as Sambrook etc., 1989, ColdSpring Harbor, NY, USA).Fig. 6 show paddy rice CMS (WA) be and maintenance line between the polymorphic shape of a restriction fragment length, it is by being detected with probe and EcoR V Restriction Enzyme.Unite with above-mentioned probe-enzyme of mentioning the purifying of the Mitochondrial DNA that derives from paddy rice CMS and maintenance line and rflp analysis have been disclosed the confirmation that can detect a similar polymorphism of in Mitochondrial DNA polymorphism with that.

Multiplex PCR detects by development in order to distinguish CMS and the maintenance line of paddy rice.In this detects, be used in the first cover oligonucleotide primer in the PCR detection above-mentioned and belong to the second cover oligonucleotide primer and carry out MULTIPLE COMPOSITE.This second cover oligonucleotide primer or with from ongoing international rice genome plan (the publicly available elephant at GenBank registration number #AP001859, here be incorporated herein by reference) the karyomit(e) I of the paddy rice that obtains of a part on one section sequence for the basis, or registration number is a #D21251 available Rice mtDNA sequence for the basis in DBJ.The second cover primer is designed like this, therefore belong to arbitrary primer in second cover in the mixture that all can be added to the PCR that contains the primer that belongs to the first cover oligonucleotide primer and detect, and can not influence special dna fragmentation by the first cover oligonucleotide primer amplification CMS.In this multiplex PCR detected, no matter template DNA derived from a CMS system or derives from a maintenance line (Fig. 7), special dna fragmentation of the second cover oligonucleotide primer amplification.When obtaining the fragment of a pcr amplification from CMS and maintenance line, the second cover primer is as the contrast of the external factor that influences PCR result (resembling the inhibitor of PCR, the poor quality of template DNA etc.).The second cover oligonucleotide primer, they have been shown (shown in the end of description) in the position on the rice genome and by the size with the dna fragmentation of these primer amplifications in table 2.

Little satellite (also claiming simple sequence to repeat or SSRs) is simple, and one in front and one in back multiple two is to the primitive of four-nucleotide sequence, and it is positioned at the flank of the sequence of a uniqueness.Little satellite enriches, and in the genome of be dispersed in paddy rice very regularly (McCouch etc. 1997) and other crop (Powell etc., 1996, Trends Plant Sci.1:215-222).Because little satellite is codominant, can detects high-caliber allelic diversity, and can effectively detect, so it is very valuable as genetic marker by PCR.The covering level of genome width is that (Temnykh etc. are 2000.Theor.App.Genet.100:697-712) for the assessment hybrid purity with genotypicly determine it is fully useful for one of every 6cM in the at present general paddy rice that is provided by little satellite.With little satellite similar be STS, a STS is the dna sequence dna of one section weak point, it can detect by PCR, and can be used as a terrestrial reference in genome collection of illustrative plates is made in specific site.Some STSs that make collection of illustrative plates in paddy rice are polymorphic (Ghareyazie etc., 1995.Theor.Appl.Genet.91:218-227; Robenoil etc., 1996.Inkhush, G.S. (ed) Rice Genetics III, Proc.Third Intl, Rice Genet, Symp, Los Banos Manila, Philippines, the international paddy rice of 16-20 Oct.1995. research institute, Manila, Philippines).

The isolation distance of breeding the regulation minimum of paddy rice CMS system is 300 meters [Virmani, 1993. progress (the Hybrid Rice Advances in Agronomy) 57:377-462 of hybrid rice aspect agronomy], just in this isolation distance except the paddy rice of maintenance line, do not have paddy rice system to be cultivated.This is based on the pollen of plant that derives from the paddy rice that is growing beyond this distance and can not pollinates on the basis of the observation of CMS system.Under the situation of chance, the isolation distance that this is minimum or since not by strictness observe or since local condition (resembling distinguished and admirable and weather) might allow pollen envelop beyond transferring to 300 meters just on growing plants.

CMS system can assess by little satellite and STS mark with the degree of the hybridization pollination that derives from the pollen inferior that is grown near the rice strain (except the maintenance line) in land for growing field crops, and these two kinds of methods have polymorphism between these rice strains and CMS system.The template DNA that the mark of these polymorphisms can be used to come from any in being of the donor system (a representative situation is a 1-3 system) of potential throughput and CMS passes through PCR, agarose gel electrophoresis and ethidium bromide staining evaluation.Preferred mark is one and can detects and derive from the hybridization pollination that these poor qualities are any.The plant that derives from hybridization pollination is will be with such marker detection [promptly under the situation of two dna fragmentations existence that vary in size under the situation that heterozygosity exists, in these two fragments one is provided by female (CMS) parent, and another is (the pollen donor inferior) that is provided by male parent].With this situation forms contrast be, if pollination resemble that we wish occur, and pollen derives from maintenance line, homozygote (existing with one dna fragmentation) will be observed in the offspring so, this be because CMS and maintenance line be mutually be equal to nuclear, mean that except the nucleus DNA mark they substantially are identical.As described in Example 9 the same of the program of DNA separation, PCR and agarose gel electrophoresis.

The amending method of this detection also has been described in embodiment 9, DNA wherein be the seedling that is subordinated to the CMS original seed (from 100 or more seed bank obtain) colony in isolating in the blade that obtains.One of primer who is used for detecting polymorphism mark is terminal with resembling fluorescein, rhodamine and other such dyeing mark 5 ', they can with the gene that resembles ABI 377 dna sequencing instrument retouch the equipment of sweeping or people that this field is familiar with known to other similar instrument, subsequently PCR or electrophoresis are detected.By this detection, the degree of hybridization pollination can detect (each peak have an allelotrope characteristic) by the height of measuring each peak, as detecting by instrument.If only there is a peak to be detected (corresponding to an allelotrope), the sample of CMS seed can be considered to 100% pure so.By a plurality of allelotrope (peak), checked for impurities in sample, occurring.The ratiometer of peak height of impurity (being offered the allelotrope of colony by seed donor inferior) and expectation peak height (having CMS is the allelotrope of characteristic) is understood the frequency of the seed in the CMS original seed of the hybridization pollination once appeared at usefulness inferior strain pollen donor subsequently.

Although the application is used to assess the degree that appears at the source far away hybridization during the breeding of paddy rice CMS system, similar methods can be used to assess the degree that appears at the source far away hybridization during the breeding of other crop CMS system, and these crops are non-limiting to comprise corn, pearl millet, jowar, wheat, heronsbill, mustard seed, Caulis et Folium Brassicae capitatae, Cauliflower, tomato, pepper, gumbo etc.Here, CMS system is used for the production of hybrid, and suitable little satellite or STS mark are available.

The assessment of seed purity is an important quality control composition of hybrid rice program.In that this finishes by growth test (GOT) traditionally, it (GOT) is based on the basis of assessment of characteristic form or flower on the plant that grows into maturation (Ref).For seed industry, substantial contribution because the cycle that prolongs with the hybrid seed form of storing by lock up, waiting for the result of GOT simultaneously.To replace GOT be target to detect DNA on the basis, and with little satellite and sequence tagged site (STS) polymorphism, rice cytoplasmic male sterile (CMS), recovery and hybridization are screened to be used for differentiation.These codominance polymorphisms are identified after PCR, agarose gel electrophoresis, bromine second are formed sediment dyeing.The principle of this method is that hybrid will be heterozygosis (promptly two parents' allelotrope will occur in hybrid), when being used in the little satellite that has polymorphism between parent system or STS mark assessment genotype (detecting a different allelotrope on two parents), with the paddy rice seedling in 3 day age carry out that DNA separates, a simple program detecting heterozygosity and purity is by stdn (as described below), and has been used to the detection (embodiment 10) of impurity in the hybrid seed group.Although the mark of multiple polymorphism can be used to (or individually or multiple ground) assessment seed purity, consider the reason in the cost, advise that the microsatellite marker of a single suitable selection is enough to assess hybrid seed purity.

A modification of this detection also is to be described in embodiment 10, wherein DNA is that separated being used for detects one of polymorphism mark thing and terminally carry out mark with resembling the such fluorescence labels of fluorescein, rhodamine and other dyestuff 5 ' in the blade of 400 seedlings (obtaining from 400 seed banks) colony of being subordinated to the hybrid seed original seed, and these fluorescence labels marks can be detected at subsequently PCR and electrophoresis with the instrument of the genescan equipment that resembles ABI 377 dna sequencing instrument or the Other Instruments of being familiar with known to the people in this field.Detect by this, purity can be by each height detection in two peaks measuring expectation, and these two peaks (allelotrope that each peak representative is provided by a parent) having can be by the hybrid characteristic of instrument detecting.In PCR detects, use from a single hybrid plant isolating genomic dna to do a template, peak height is supposed to equate, has produced 1: 1 ratio (or 50: 50).In PCR detects, use that isolating genomic dna is as a template from the colony of 400 young plants, departing from of 1: 1 the ratio (50: 50) of any two peak heights all will be the index of impurity levels in the hybrid seed original seed.The peak height ratio be 1.02: 0.98 (51: 49) will with the sample correspondence of the hybrid seed original seed of one 98% purity, the peak height ratio be 1.1: 0.9 (55: 45) will with the sample correspondence of the hybrid seed original seed of one 90% purity.

The method that is used to assess hybrid seed purity should carefully be screened after thinking better of.The kind that is grown in contiguous land for growing field crops has latent productive capacity pollen donor as one or here during CMS system breeds (only maintenance line should be a pollen donor) or work at hybrid production period (only recovering system here should be a pollen acceptor).If pollination is carried out (promptly neither the strain that maintenance line neither recover to be found under the situation of appearance) by inferior strain pollen donor, and that inferior strain donor is marked at CMS system corresponding to selected little satellite or STS and has polymorphism in being, even heterozygosity also can be observed under the non-existent situation of the hybrid that we want so, therefore, screening be used to assess hybrid purity mark should in CMS system and to have between the pollen donor of latent productive capacity be monomorphism, and should and not recover between the system polymorphism be arranged in CMS system.The detection of heterozygosity of our expectation will be the index that hybrid seed is produced so.These are special be marked at or little satellite or STS be marked on CMS, recover system and have the polymorphism of being carried out in the donor system of inferior strain of latent productive capacity to be identified in measuring.Saying that for the people who knew this field in the past the detection of these polymorphism marks is not difficult, is (Temnykh etc., 2000) that are suitable for to paddy rice because a large amount of microsatellite markers is arranged at present.

Dna marker detects and to be better than GOT from speed and accuracy angle, and it be applied in that seed is industrial will to cause sizable saving.Although this method by stdn, be used to assess the sort of type as described in Figure 1 to pass through three be the purity that culture system is produced paddy rice hybrid, it also can be used for assessing by two is the purity of the paddy rice hybrid that obtains of culture system.At this two is in the culture system, and the male sterile line of a condition type is induced under the male sterile condition by being grown in, and is used as the female parent that hybrid produces.Can not induce under the male sterile condition when being grown in, this is can be by oneself's pollination breeding.Therefore, can avoid the needs of male sterile of pair cell matter and maintenance line.Two be culture system generally speaking at the experimental stage (except in a state-owned little scale), yet, even for two systems of hybrid seed production, the method for assessment hybrid seed purity also will with three be culture system described be identical like that.In this case, little satellite of distinguishing female, male parent (rather than CMS and recovery system) and STS polymorphism will be identified and used as aforesaid.

Although this method is the standardized means that is used to assess the purity of paddy rice hybrid, it also can be used to assess the purity of hybrid in any other crop, these crops are non-limiting to comprise corn, pearl millet, jowar, wheat, heronsbill, mustard seed, Caulis et Folium Brassicae capitatae, Hua Yucai, tomato, pepper, gumbo etc., also is available for their suitable little satellites and STS mark.People expect that this detection method (or the modification of being made thus is tangible for the people who knows this field) finds widely to use in the cenospecies quality control procedure.The peasant who carries out seed-test with this process also will make a profit, because they are obtaining a suitable real product.

Embodiment

Embodiment 1

Carry out separating of genomic dna from paddy rice CMS with maintenance line

(1989) RockefellerProgram on Rice Biotechnology such as the separation usefulness of oryza sativa genomic dna or quilt (a) Kochert, Cornell Univ., New York, program that USA describes or (b) program of (1993) Theor.Appl.Genet.86:694-698 such as Chunwongse have a little and change:

(a) concise and to the point, as follows with the separable programming of Kochert etc.: the blade that 5-10g derives from growing plants in the greenhouse in 20 day age is milled in the mortar of a liquid nitrogen and pestle and forms a uniform powder, does not allow powder thaw.Sample is transferred to (poly-propyl alcohol test tube) in the 50ml test tube of anti-chloroform then, contain the 25ml that is warming to 60 ℃ in advance in the test tube and extract damping fluid [420g urea, 70ml 5M NaCl, 50ml 1M Tris-HCl pH8.0,80ml 0.25M EDTA, 200ml10%SDS 50ml phenol reagent, redistilled water (the double distilled water) constant volume of using the bacterium of going out is to 1L].Stir with glass stick and not form any block, add 20% the Sodium dodecylbenzene sulfonate of 0.750ml, mix.This mixture is 60 ℃ of incubations 10 minutes, with turned upside down mixing regularly often.Cool to room temperature adds the 15ml chloroform: primary isoamyl alcohol (24: 1), mixing obtain an emulsion.Test tube is moved on to upper water in the fresh 50ml test tube with volumetric pipette mutually by centrifugal and be divided into water and chloroform mutually, and the Virahol of 2/3 volume is added to final aqueous phase, puts upside down mixing and begins to assemble up to DNA.DNA is precipitated to be separated out and transfers to one and contain in the fresh test tube of 70% alcoholic acid.DNA by centrifugal granulate the precipitation and after outwelling ethanol, in vacuum drier, blotted.DNA is dissolved in (Tris-HCl 10mM pH8.0, EDTA 1mM pH8.0) among the TE.

(b) using Chunwongse etc. (1993), to carry out the isolating program of DNA as follows: seed on the moistening filter paper of culture dish in the dark 28 ℃ germinate down.The seedling in three day age is smashed to pieces in the test tube that contains 200 μ l extraction damping fluid of a 1.5ml individually with a pestle, and this damping fluid is made up of in sterile distilled water 5%W/V chelex-100 (Bio-Rad laboratory, the U.S.).Tissue homogenate incubation 10 minutes in 95 ℃, under the rotating speed of 12000rpm centrifugal 1 minute.10-15 μ l supernatant liquor is used to each PCR reaction.

Embodiment 2

Separate mitochondria DNA from paddy rice CMS and maintenance line

Mitochondrial DNA is according to Saleh etc., and the program of (1989) Theor.Appl.Genet.77:617-619 is separated from CMS and maintenance line.The sterile seed in surface germinating growth 14 days in the greenhouse.These plants are saved 3 days then in the dark, turn white so that plant is faded.After this step, all experiments are all carried out under 4 ℃ of conditions.Collect to come from the 20g blade of plant in 14 day age and be cut into small pieces.Blade in the mortar of a 100ml buffer A and pestle by homogenate.Buffer A (10mM TES pH7.2,0.5M mannitol, 0.2%BSA, 0.05% halfcystine.The cheese cloth of tissue homogenate by 4 layers filters, and under the 5000rpm rotating speed centrifugal 10 minutes, collects supernatant liquor.Granular precipitation is resuspended in the buffer A of 30ml gently, under 5000rpm centrifugal 10 minutes again.Mixing supernatant under the 12000rpm rotating speed centrifugal 10 minutes, is collected granular precipitation.With supernatant liquor under 12000rpm centrifugal 10 minutes again, mix granular precipitation twice.This is deposited in the buffer A resuspension and under 5000rpm centrifugal 10 minutes, collects supernatant liquor.1M MgCl ₂Be added to the Dnase I (in 0.15M NaCl and 50% glycerine) of the new preparation of 10mg/ml that to make final concentration be the MgCl of 10mM ₂With the fresh leaf tissue of 10 μ g DNase/g on time, 4 ℃ of incubation 1h.A saccharose gradient is to be added to buffer B (10mM TES pH7.2,20mM EDTA, 0.6M sucrose) and 2ml mitochondrial suspension to form in each test tube.Under 16000rpm centrifugal 10 minutes, granular 4ml damping fluid C (the 50mM Tris-HCl pH8.0 that is deposited in, 10mM EDTApH8.0,2% sarcosyl, 100 μ g/ml Proteinase Ks) in by resuspension, and in 37 ℃ shaking bath (Jolabo, Germany) incubation 2 hours, stir gently simultaneously.Lysate is supplied with the 0.2M ammonium acetate, and carries out purifying with 3 round-robin phenol-chloroform extractings.With 95% washing with alcohol deposit seeds, use 70% washing with alcohol again.Drying precipitated in a vacuum particle, DNA is dissolved among the TE, handles with RNA enzyme (Rnase A), preserves down for-20 ℃.

Embodiment 3

To paddy rice CMS is determining of special dna sequence dna

Used primer: for the oligonucleotide primer (McCouch etc. of the little satellite position of paddy rice RM9,1996.Rice Genetics III, Proc.Third Intl.Rice Genet.Symp.LosBanos Manila, the international paddy rice of Philippines 16-20 Oct.1995. research institute, Manila, Philippines).

Forward: 5 '-CAAAAACAGAGCAGATGAC-3 ' (SEQ ID No.6)

Oppositely: 5 '-CTCAAGATGGACGCCAAGA-3 ' (SEQ ID No.7)

Primer is by Oswel DNA Service, Southamton, U.K synthetic.Polymerase chain reaction (PCR) condition such as McCouch etc., [(1996) .Rice Genetics III, Proc.ThirdIntl.Rice Genet.Symp.Los Banos Manila, the international paddy rice of Philippines 16-20 Oct.1995. research institute, Manila, Philippines] the description of slightly revising.In brief, PCR is containing the 50-100ng template DNA, each primer 5pmol, 200 μ M (whenever) deoxyribonucleotides, 50mM KCl, 10mM Tris-HCl, pH8.3,1.5mM MgCl ₂, carry out in the 25 μ l reaction systems of the Taq polysaccharase of 0.01% gelatin and 1 unit.The PCR condition is: 95 ℃, 7 minutes (being first sex change) then is 94 ℃ of following sex change 1 minute, anneals 1 minute down for 55 ℃, and 72 ℃ are extended circulations of 2 minutes such three repeating steps compositions down, carry out 35 altogether and circulate like this, prolong 5 minutes down at 72 ℃ at last.Sample is stored down at 4 ℃, is equipped with next step use.The detection of PCR product is by separation on 1% or 2% sepharose, electrophoresis, ethidium bromide staining, so that visible dna fragmentation carries out under ultraviolet lamp.

PCR carries out with a maintenance line, CMS system and consanguinity hybrid.Except that hope by the RM9 primer amplification dna fragmentation, only in CMS system and hybrid, observed an extra band, but in maintenance line, do not observed (Fig. 2).

Embodiment 4

To paddy rice CMS is determining of special nucleotide sequence

Use the RM9 primer, PCR is containing the 50-100ng template DNA, each primer 5pmol, 200 μ M (whenever) deoxyribonucleotides, 50mM KCl, 10mM Tris-HCl, pH8.3,1.5mM MgCl ₂, carry out in the 25 μ l reaction systems of the Taq polysaccharase of 0.01% gelatin and 1 unit.The PCR condition is: 95 ℃, 7 minutes (being first sex change) then is 94 ℃ of following sex change 1 minute, anneals 1 minute down for 55 ℃.72 ℃ are extended circulation of 2 minutes such three repeating steps compositions down, and totally 35 circulations like this prolong 5 minutes down at 72 ℃ at last.Store down at 4 ℃, be equipped with next step use.Amplification PCR products been separated on the sepharose, can be observed under ultraviolet lamp by ethidium bromide staining and its.Dna sequence dna to the special about 350bp of CMS system (Fig. 2) downcuts with Qiaquick gel extraction kit (Qiaquick Gel Extraction Kit) (Qiagen from gel, Germany) carry out purifying according to operational guidance, the usefulness automated DNA sequenator ABI 3700 (ABI of DNA behind the purifying, Foster City, USA) ordering, the sequence that obtains as shown in Figure 3, inquiry shows that there is homology in (Fig. 4) these sequence great majority and zone of rice mitochondria body DNA (DBJ, registration number #D21251) to dna homology in GenBank.Yet this sequence has sub-fraction not present any homology with Rice mtDNA.

Embodiment 5

The design PCR design of primers that is used for the special oligonucleotide primer of PCR detection differentiation paddy rice CMS and maintenance line is based on the sequence information basis that is used in embodiment 4 described programs acquisitions.Primer is that this sequence is exclusive (the base position of 1-36 among Fig. 3) for CMS system based on the part of that sequence, and another primer is based on the Rice mtDNA sequence, and this primer is:

Forward: 5 '-ACTTTTTGTTTTTGTGTAGG-3 ' (SEQ ID No.4)

Oppositely: 5 '-TGCCATATGTCGCTTAGACTTTAC-3 ' (SEQ ID No.5)

Embodiment 6

Be used to distinguish the PCR detection of paddy rice CMS and maintenance line

Right with the primer of describing among the embodiment 6, PCR carries out in the 25 μ l reaction systems as template DNA with CMS and maintenance line.Reaction consists of 50-100ng template DNA, 1X PCR damping fluid (50mM KCl, 10mM Tris-HCl, pH8.3,1.5mM MgCl ₂, 0.01% gelatin), 200 μ M (whenever) deoxyribonucleotides (dNTP), the Taq polysaccharase of 1 unit, each primer 5pmol.The PCR condition is: carry out 7 minutes first sex change under 95 ℃, then be 30 seconds, 44 ℃ 1 minute, 72 ℃ circulations of 2 minutes such three repeating steps compositions of extension down of annealing down of 94 ℃ of following sex change, carry out 35 circulations so altogether, prolong 7 minutes down at 72 ℃ at last.Sample is equipped with next step use 4 ℃ of storages.The PCR product is separated on 1% sepharose, DNA band ethidium bromide staining, and under ultraviolet lamp as seen.Right with this primer, the amplification of the dna fragmentation of a 350bp is arranged, but (Fig. 5) do not observe pcr amplification in maintenance line in CMS system.

Embodiment 7

Dna fragmentation with the special pcr amplification of CMS detects the DNA-DNA hybridization that the restriction fragment length polymorphism (RFLP) of distinguishing CMS and maintenance line detects as probe

As embodiment 1 (a) is described, is EcoR I, Hina III, Dra I, EcoR V, Hinc II, Sau96 I, Taq α I (New England BiolabsInc. from IR 58025A (CMS) and the isolating genomic dna of IR 58025B (maintenance line) of paddy rice with various Restriction Enzymes, MA, USA) digestion.The digestion that derives from CMS and maintenance line completely the DNA of 3-4mg at 0.7% agarose (Sigma, USA) electrophoretic separation, sex change, neutralization and vacuum transfer arrive Hybond N (Amersham Life Science on the gel, Buckinghamshire) on the film, this is according to by (1989) Cold Spring Harbor such as Sambrook, the program that NY, USA. provide is carried out.With a ultraviolet (UV) Stratalinker (Stratagene, La Jolla, CA, USA), DNA is linked on the film by hybridization.Trace is in the EDTA solution of 0.5M sodium phosphate (pH7.2), 7% sodium lauryl sulphate (SDS), 1% bovine serum albumin, 1mM, in 65 ℃ of prehybridizations 3 hours.With a random primer labelling test kit (JONAKI-BRTT, Mumbai, India),, use α according to the described method of manufacturers ³²P-dATP label probe (pcr amplification product of SEQ ID No.4 and SEQ IDNo.5) kept 18 hours down in 65 ℃, constantly swayed simultaneously.Trace is under 65 ℃, with 2 * SSC (1 * SSC=0.15M NaCl, 0.015M Trisodium Citrate pH7.0), 0.1%SDS, 5mM sodium phosphate (pH7.0) flushing 3 * 20 minutes, is used 0.5 * SSC, 0.1%SDS and 3mM sodium phosphate buffer (pH7.0) flushing 3 * 20 minutes again.Under-70 ℃, launch autography in the film of X-ray by exposing trace.As a diagram, the RFLP that is obtained with restriction enzyme EcoR V is described in table 6.

Embodiment 8

The multiplex PCR of distinguishing paddy rice CMS and maintenance line detects

We have researched and developed a kind of multiplex PCR and have detected, wherein the first cover oligonucleotide primer (shown in the end of describing at table 2) any primer of can and belonging to the second cover oligonucleotide primer (table 3) to the MULTIPLE COMPOSITE of in a single PCR, carrying out success to distinguish CMS and maintenance line.

With the dna profiling that derives from CMS system as a target, can the increase fragment of a 325bp of the first cover primer, but the product that can not obtain to increase as a target with the genomic dna that derives from maintenance line.No matter target DNA derives from CMS system or derives from maintenance line, and the arbitrary primer that belongs to the second cover oligonucleotide primer will be to amplifying a single fragment.This procedure statement is as follows: (GenBank) available rice genome sequence is downloaded in the public sphere, and primer is based on and is designed on the basis of these sequences.Primer is to based on No. 1 chromosomal sequence (registration number #AP001859 of paddy rice; 1372 and 2598 position at database sequence).The sequence of oligonucleotide primer is as follows:

Forward: 5 '-AACACAAGGGACAGCACATTGAGC-3 ' (SEQ ID No.8)

Oppositely: 5 '-GAAAGAGGAGCTAGAGGTGGGTGC-3 ' (SEQ ID No.9)

This primer has produced the pcr amplification product of a 1.1kb.Other two primers are to being basic design with Rice mtDNA in the database (registration number #D21251) sequence, it is SEQ ID No.10 and SEQ ID No.11 between 4981 and 5641 positions of sequence, and between 6660 and 7303 positions of sequence is SEW ID No.12 and SEQ ID No.13.

(1) forward: 5 '-GGGCAATTCCATCGTGCTATGAGC-3 ' (SEQ ID No.10)

Oppositely: 5 '-GCGTTGGGTTTTCCAACGAAAAAC-3 ' (SEQ ID No.11)

This primer is to having produced the pcr amplification product of a 660bp.

(2) forward: 5 '-CAGGCGAAGGTCATAATTCGCAGG-3 ' (SEQ ID No.12)

Oppositely: 5 '-CGAAGAAGGCAGTCTTGCTTCCTC-3 ' (SEQ ID No.13)

This primer is to having produced the pcr amplification product of a 600bp.

Each of these three primer centerings is mixed with illustrated oligonucleotide primer in the table 2 (SEQ ID No.4 and SEQ ID No.5) individually, in a PCR, carry out multiplex amplification, used condition is as follows: the template DNA of 50-100ng, 1 * PCR damping fluid (50mM KCl, 10mMTris-HCl, pH8.3,1.5mM MgCl ₂, 0.01% gelatin), 200 μ M dNTP (each), the Taq polysaccharase of a unit comes from each 5pmol of primer (SEQ ID No.4 and SEQ ID No.5) of table 2, from each right primer 1pmol of the arbitrary primer of table 3.The condition of PCR reaction is as follows: 95 ℃, initial sex change 7 minutes; Then 94 ℃ following 30 seconds, 44 ℃ following 1 minute, 72 ℃ such circulations in following 2 minutes are carried out 35 times altogether; 72 ℃ of last extensions 7 minutes, sample is stored in 4 ℃, is equipped with next step usefulness.The PCR product separates on 1% sepharose, the DNA band with ethidium bromide staining and under ultraviolet lamp as seen.The same as described in Figure 7, only when template DNA derives from CMS and is, increasing with primer SEQ ID No.4 and SEQ ID No.5 just to obtain the fragment of a 325bp.No matter template derives from CMS or maintenance line, is used in each special dna fragmentation that all can increase of the primer centering in the table 3 (SEQID No.8 and SEQ ID No.9, SEQ ID No.10 and SEQ ID No.11, SEQ ID No.12 and SFQ ID No.13).Therefore, in multiplex PCR detects,, there are two dna fragmentations to be observed when template is when deriving from CMS and being; When template is when deriving from maintenance line, only there is the dna fragmentation of a list obtained.(the 2nd swimming lane, the 3rd swimming lane) showed to use the special single primer of CMS carried out the example of PCR to (SEQ IDNo.4 and SEQ ID No.5) and SEQ ID No.4 and SEQ IDNo.5 and SEQ ID No.8 and SEQ ID No.9 (the 4th, 5 swimming lane) carried out the example of multiplex PCR with primer in table 7.

Embodiment 9

Be used for owing to and the PCR that detects of the CMS system impurity that occurs of inferior strain pollen donor hybridization pollination detect

As embodiment 1 (b) was described, the seedling by the CMS original seed germinates the 3 day age of 100 strains obtain carried out the separation of genomic dna from these seedling.By any one oligonucleotide primer with the microsatellite marker that can a large amount of being used for of target detects the polymorphism between CMS system and the pollen donor inferior, PCR is operated (with the primer difference in each source, cycling condition has some changes) as described in the embodiment 7.After the PCR, product separates on sepharose, detects by ethidium bromide staining.If DNA comes from CMS system, an one band just can be observed, if but the hybridization pollination that comes from inferior strain pollen donor occurs, and so except the special band of CMS, also have an extra band (inferior strain pollen donor) to be observed.

Be used for owing to and the PCR that detects of the CMS system impurity that occurs of inferior strain pollen donor hybridization pollination detect also and can carry out from the 100 strain seedling storehouse separated DNA that obtain of germinateing by the CMS original seed.Excise second vane tip 2cm of each strain in the paddy rice seedling of CMS that 100 strains grow into 15 days, cut the long blade of next 1cm below the zone at this then.The blade that collection is downcut from all plant, according to the program of (1989) such as Kochert as isolation of genomic DNA as described in the embodiment 1.Use the fluorochrome label primer to one 5 ' end in (forward or backwards) by standard program.Carry out the PCR reaction with fluorescently-labeled primer, usually as described in the embodiment 7.Cycling condition changes according to used primer.Emphasis will should be mentioned that used template DNA should only be 2-3ng, and should use AmpliTaq Gold enzyme (ABI, Foster City, USA).Behind the PCR, (ABI, Foster City USA) mix to get the PCR product of 1 μ l and the mark of last sample (loading) dyestuff [methane amide and dextrorotation orchid (Bluedextron) are 5: 1 ratio] and 1.5 μ l.Heat denatured, add 1.5 μ l in automated DNA sequenator 377 (ABI, Foster City, USA).Carrying out electrophoresis on gel is well separated up to band.(ABI, Foster City USA) analyze the peak height that is produced by band with the genescan analyser.

Embodiment 10

The PCR that detects paddy rice hybrid purity detects

Be IR 58025A from deriving from CMS, to recover be to press the described isolation of genomic DNA of embodiment 1 (b) IR40750 and these two parents' the hybrid (DRR H1).With microsatellite marker RM164[forward: 5 '-TCTTGCCCGTCACAGCAGATATCC-3 ' (SEQ ID No.14), oppositely: 5 '-GCAGCCCTAATGCTACAATTCTTC-3 ' (SEQ ID No.15)] (Wu and Tanksley, 1993, Mol.Gen.Genet.241:225-235).Can observe in the polymorphism of this position between two parents.The condition of PCR is: DNA sample (50ng) is containing 1 * PCR damping fluid [10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mM MgCl ₂, 0.01% gelatin], (every kind of primer 10pmol carries out in the 25ml reaction system of the Taq polysaccharase of a unit each dNTPs for AmershamPharmacia Biotech, Sweden) 0.2mM.Initial sex change is 7 minutes under 95 ℃, then carries out 94 ℃ following 1 minute, 55 ℃ following 1 minute, 72 ℃ such circulations in following 2 minutes, carries out 35 circulations altogether, and 72 ℃ of last extensions 7 minutes, sample is stored in 4 ℃, is equipped with next step usefulness.The PCR product is separated on sepharose, observes as seen down with ethidium bromide staining and ultraviolet lamp.The result who is the PCR that primer carries out with SEQ IDNo.14 and SEQ ID No.15 as shown in Figure 8.Real hybrid presents two dna fragmentations, and a fragment provides by recovering the parent, and another fragment is provided by the CMS parent.Off-type has presented the one fragment (Fig. 8) that any DNA band corotation moves among and the parent.In Fig. 8, the corotation of the DNA band of off-type and CMS moves and shows that this specific hybrid population has been polluted by IR 5802A (CMS).The example proof of used little satellite only is an example that is used to detect in many microsatellite markers of paddy rice hybrid purity in this experiment.

The PCR method that detects paddy rice hybrid purity can be done in the sample of a set.Allow from the germinate 400 strain growth of seedling to 15 obtain day of hybrid original seed, excise second vane tip 2cm of each strain, cut the long blade of next 1cm below the zone at this then.The blade that collection is downcut from all plant, according to the program of (1989) such as Kochert as isolation of genomic DNA as described in the embodiment 1.Use the fluorochrome label primer to one 5 ' end in (forward or backwards) by standard program.Carry out the PCR reaction with fluorescently-labeled primer, usually as described in the embodiment 7.The round-robin condition changes according to used primer.Emphasis will should be mentioned that used template DNA should only be 2-3ng, and should use AmpliTaq Gold enzyme (ABI, Foster City, USA).Behind the PCR, get the PCR product of 1 μ l and last sample (loading) dyestuff [methane amide and dextrorotation (Blue dextron) are 5: 1 ratio) and the mark of 1.5 μ l (ABI, Foster City USA) mix.Heat denatured, add 1.5 μ l in automated DNA sequenator 377 (ABI, FosterCity, USA).Carrying out electrophoresis on gel is well separated up to band.(ABI, Foster City USA) analyze the peak height that is produced by band with the genescan analyser.

Detect by this, purity can be by each highly detects in two peaks measuring expectation, and these two peaks (allelotrope that each peak representative is provided by a parent) having can be by the hybrid characteristic of instrument detecting.In PCR detects, use from a single hybrid plant isolating genome to do a template, peak height is supposed to equate, has produced 1: 1 ratio (or 50: 50).In PCR detects, use that isolating genomic dna is as a template from the colony of 400 young plants, departing from of 1: 1 (50: 50) of any two peak heights all will be the index of impurity levels in the hybrid seed original seed.The peak height ratio be 1.02: 0.98 (51: 49) will with the sample correspondence of the hybrid seed original seed of one 98% purity, the peak height ratio be 1.1: 0.9 (55: 45) will with the sample correspondence of the hybrid seed original seed of one 90% purity.

At last, can say so, the invention provides the method for guaranteeing parental line purity, this method is to guarantee the prerequisite of necessity of paddy rice hybrid purity.Being used in three is that culture system carries out cytoplasmic male sterile line that hybrid rice produces and usually is equal to nuclear maintenance line and pollutes.Bao Gao a dna sequence dna is a homologous for Rice mtDNA in the present invention, and cytoplasmic male sterile line is peculiar but it is paddy rice WA.In a polymerase chain reaction (PCR), with genomic total DNA as template, based on the fragment of cytoplasmic male sterile line amplification of the oligonucleotide primer on the basis of above-mentioned dna sequence dna from paddy rice, but can not from its consanguinity maintenance line this fragment of amplification, this shows that this PCR detects that to be used to detect at CMS be the impurity of the maintenance line in the original seed.In the volume code experiment that the blended plant sample that contains CMS and maintenance line is carried out, this PCR detects the genotype that is used to correctly predict these plants.In the Southern hybridization analysis, with the polymorphism of pcr amplified fragment detection between CMS system and maintenance line of these oligonucleotide primers acquisitions.The application has described the application aspect the hybridization pollination that resembles the pollution during CMS system breeds of the so detectable marker detection of codominant PCR of little satellite and sequence tagged site polymorphism, has described in addition with this mark assessment paddy rice hybrid purity.

The analysis and research of table 1. paddy rice system ^*

CMS system

IR 58025 A

IR 62829 A

PMS 8A

PMS 10A

78897 A

Maintenance line

IR 58025 B

IR 62829 B

PMS 8B

PMS 10B

78897 B

Recover system

IR40750

Hybrid

DRRH1(IR 58025A×IR 40750)

^*The unit of providing of employed all paddy rice systems is in this research: paddy rice research board of management, ICAR, Hai Delaba, India.

Table 2. is used for PCR and detects with the CMS of difference paddy rice and the specific oligonucleotide sequence of maintenance line

Oligonucleotide primer is right	The position that is amplified	Be amplified the size of fragment system	Polymorphism between CMS and maintenance line
				(1)F5′-ACTTTTTGTTTTTGTGTAGG-3′ (SEQ ID No.4) R5′-TGCCATATGTCGCTTAGACTTTAC-3′ (SEQ ID No.5)	Rice mtDNA (ribosomal protein S3, L16, S12 and nadh dehydrogenase subunit 3 being carried out the genome area of genes encoding)	325bp	Be

Table 3. is used to distinguish the oligonucleotide primer of the available SEQ ID No.4 of CMS and maintenance line and SEQ ID No.5 MULTIPLE COMPOSITE in PCR detects right

Oligonucleotide primer is right	The position that is amplified	Be amplified segmental about size	Polymorphism between CMS and maintenance line
				(1)F5′-AACACAAGGGACAGCACATTGAGC-3′ (SEQ ID No.8) R5′-GAAAGAGGAGCTAGAGGTGGGTGC-3′ (SEQ ID No.9) (2)F5′-GGGCAATTCCATCGTGCTATGAGC-3′ (SEQ ID No.10) R 5′-GCGTTGGGTTTTCCAACGAAAAAC-3′ (SEQ ID No.11) (3)F5′-CAGGCGAAGGTCATAATTCGCAGG-3′ (SEQ ID No.12) R5′-CGAAGAAGGCAGTCTTGCTTCCTC-3′ (SEQ ID No.13)	Rice chromosome I (position 1372 to 2598; Registration number #P001859) Rice mtDNA (position 4981 to 5641; Registration number #D21251) Rice mtDNA (position 6660 to 7303, registration number #D21251)	1178bp 660bp 643bp	Do not have

The F=forward is right, and R=is oppositely right

Claims (1)

1, a kind of method of utilizing radioactivity or nonradioactive labeling in Southern hybridization detects with the special dna sequence dna of CMS distinguish the WA paddy rice cytoplasmic male sterile line and with its method of consanguinity male-fertile maintenance line.

Images