CN111778348B - Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof - Google Patents
Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof Download PDFInfo
- Publication number
- CN111778348B CN111778348B CN202010678209.9A CN202010678209A CN111778348B CN 111778348 B CN111778348 B CN 111778348B CN 202010678209 A CN202010678209 A CN 202010678209A CN 111778348 B CN111778348 B CN 111778348B
- Authority
- CN
- China
- Prior art keywords
- sweet pepper
- pcr
- plate
- mass spectrum
- cap91
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to the technical field of molecular genetics, in particular to a flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof. Comprises the steps of extracting DNA of Ji-ground No. 16 seedlings of a sweet pepper nuclear male sterile dual-purpose line; taking DNA of Ji-research No. 16 seedlings of the sweet pepper nuclear male sterile dual-purpose line in the step A as a template, carrying out PCR amplification by using a specific mass spectrometry primer, removing dNTPs and primers remained in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrometry detection typing after single base extension and desalination of a sample; when 28594037 nucleotide on chromosome 5 of sweet pepper is A, C and AC, the said sweet pepper is sterile, homozygously fertile, heterozygously fertile and the like. The invention solves the problems of large workload of test crossing and the like in the prior art, and has the advantages of avoiding the problem of large quantity of measurement and allocation in the transfer process, improving the transfer efficiency and the like.
Description
Technical Field
The invention relates to the technical field of molecular genetics, in particular to a flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof.
Background
The Solanaceae capsicum (Capsicum annuum L) belongs to one or more year crops and is the most main vegetable crop in the world. Sweet pepper (Capsicum annuum var. Grossum) is a variant of Capsicum annuum. Because the sweet pepper hybrid vigor utilization value is higher, the yield of the excellent hybrid seeds can be increased by 30-50% compared with the conventional seeds. The male sterile line of the sweet pepper is utilized to produce first-generation hybrid seeds, links such as manual emasculation and the like can be omitted, the cost and difficulty of seed production are greatly reduced, the seed purity is obviously improved, and the method is an important way for utilizing the hybrid seeds. Therefore, male sterility research has been highly appreciated by many scholars both at home and abroad.
Male sterility is largely divided into two types, nuclear male sterility (Genetic male sterility, GMC for short) and cytoplasmic male sterility (Cytoplasmic male sterility, CMC for short). Cytoplasmic Male (CMC) sterility requires a three-line set, and although it has been applied to pepper varieties, it is still difficult to use it in sweet peppers, and it is critical that it is difficult to find an excellent restorer line in sweet peppers, etc. While nuclear male sterility (GMC) dual-purpose lines are simple to inherit, restorer lines are widely favored by breeders at present. Fan Yanqin et al found sweet pepper nuclear sterile resource AB91, and bred Ji-research 6, ji-research 16, ji-research 20, ji-research 108 and other Ji-research series of 14 new varieties by using the sweet pepper nuclear male sterile two-purpose line, and now sold and widely planted in various places in China.
The stable sterile line is bred by adopting the traditional nuclear male sterile material for 7-10 years, and the molecular marker assisted selective breeding can effectively shorten the breeding period and improve the breeding efficiency. To date, nearly 20 nuclear sterility genes have been reported in capsicum worldwide, and some sterility genes have been initially located using molecular marker technology. However, the molecular markers of the sweet pepper nuclear male sterile gene and the auxiliary selection breeding using the markers have fewer reports.
Patent documents retrieved by the applicant include:
the patent document with publication number of CN109006456A discloses a breeding method of a sweet pepper nuclear male sterile dual-purpose line, wherein a molecular marking technology is utilized to mark a sterile gene (MSMS) and a fertility gene (MSMS) of the sweet pepper nuclear male sterile dual-purpose line AB91, when F2 generation fertility of the sweet pepper nuclear male sterile dual-purpose line is separated, molecular marking is utilized to assist selection to identify sterile plants and fertility plants in a seedling stage, and a fertility plant with a genotype of MSMS is eliminated, and a fertility plant with a genotype of MSms is screened out and is directly used for the transformation of the sterile line. The SSR molecular marker for detecting the nuclear male sterility of the sweet peppers in the patent literature is detected by a conventional PCR method, and is long in time consumption and high in cost; the molecular marker is a closely linked marker, and the flight mass spectrum molecular marker Cap91 related to the male sterility of the sweet pepper nuclei is designed according to the mutation site of the sterile plant, so that the accuracy is relatively high.
A method of "molecular markers and specific primers for assisting in selection of Rf gene, which are closely linked to the pepper Rf gene and have a genetic distance of 0.7cm from the pepper Rf gene", and application thereof are disclosed in publication No. CN 106048012A. The molecular marker is aimed at the restorer gene in cytoplasmic male sterility of capsicum, and the molecular marker of the sweet pepper nuclear male sterility gene is not proposed.
Object of the Invention
The invention aims to provide a flying mass spectrum molecular marker Cap91 related to male sterility of sweet pepper kernels and application thereof, wherein molecular marker sites are obtained by taking Ji-research No. 16 as a test material, and according to published genome information of the sweet pepper, using WGS whole genome resequencing technology to Ji-research No. 16F of the sweet pepper 2 Pool building and sequencing of the purely dominant fertile plants and the recessive sterile plants in the generation, screening SNP (single nucleotide polymorphism) difference sites of the fertile gene and the sterile gene pool, and verifying the obtained difference sites through a flight mass spectrometry genotyping method, fluorescence quantification (qRT-PCR) and protein three-dimensional mechanism prediction.
The invention has the following overall technical concept:
the flight mass spectrum molecular marker Cap91 related to the male sterility of the sweet pepper nuclear is characterized in that the SNP locus thereof is mutated into A corresponding to the 28594037 th nucleotide locus C on the chromosome 5 of the sweet pepper, so as to lead to the difference of fertility phenotypes of the sweet pepper, and the 28594037 th nucleotide on the chromosome 5 of the sweet pepper has a base sequence shown in SEQ ID NO.3, wherein:
when 28594037 nucleotide on chromosome 5 of sweet pepper is A, the sweet pepper is sterile;
when 28594037 nucleotide on chromosome 5 of sweet pepper is C, the sweet pepper is homozygous and fertile;
when the 28594037 nucleotide on chromosome 5 of the sweet pepper is AC, the sweet pepper is heterozygous and fertile.
The application of the flight mass spectrum molecular marker Cap91 related to the male sterility of sweet pepper nuclei comprises the following steps:
A. f obtained by extracting Zanthoxylum piperitum and grinding No. 16 selfing 2 Seedling DNA generation;
B. f obtained by selfing Zanthoxylum piperitum Ji ground No. 16 in step A 2 Carrying out PCR amplification by taking seedling DNA as a template and using the mass spectrometry primer in claim 2, removing the rest dNTPs and primers in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrometry detection typing after single base extension and desalination of a sample;
C. according to the typing result of the step B, when the 28594037 nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when 28594037 nucleotide on chromosome 5 of sweet pepper is C, the sweet pepper is homozygous and fertile;
when the 28594037 nucleotide on chromosome 5 of the sweet pepper is AC, the sweet pepper is heterozygous and fertile.
The sweet pepper Ji-research No. 16 is provided by a solanaceous research laboratory of economic crop research institute of the national academy of sciences of Hebei province, and the variety is obtained by utilizing the hybridization of a sweet pepper nuclear male sterile line and an excellent inbred line, and the sterility is controlled by a pair of recessive nuclear single genes and is genetically stable. The flight mass spectrometry primers were synthesized by takara biosystems.
The specific technical concept of the invention is as follows:
the mass spectrum primer combination for amplifying the SNP locus comprises:
cap91-R ACGTTGGATGACCTTTTTCGTCTTCTGTTG, shown as SEQ ID NO. 1;
cap91-F ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2.
F obtained by selfing the Ji-ground No. 16 sweet pepper extracted in the step A 2 The DNA extraction kit of Chengdu Fuji Biotechnology Co was used for the DNA extraction of young seedlings.
The PCR reaction in the step B adopts a reaction system of 5 mu L: ddH 2 O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl 2 0.4. Mu.L, 25mmol/LdNTP Mix 0.1. Mu.L, 1. Mu. Mol/L Primer Mix 0.5. Mu.L, 5U/. Mu.L PCR Enzyme 0.2. Mu.L, 10 ng/. Mu.L DNA 2.0. Mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95℃for 30 seconds, annealing at 56℃for 30 seconds, extension at 72℃for 1 minute, 45 cycles total; finally, the extension was carried out at 72℃for 5 minutes.
The conditions of the SAP enzyme digestion reaction in the step B are as follows:
the SAP mixed solution comprises the following components: dd H 2 O1.53. Mu.L, SAP Buffer 0.17. Mu.L, SAP Enzyme 0.3. Mu.L at a concentration of 1.7U/. Mu.L;
the 2. Mu.L SAP mix was added to each 96-well PCR well, and the total volume after addition was 7. Mu.L, the plate was sealed with film, vortexed and placed on a PCR instrument for the following procedure: 37 ℃ for 40 minutes; 85 ℃ for 5 minutes; preserving at 4 ℃.
The single base extension reaction conditions in the step B are as follows:
the iPLEX mixed solution consists of the following components: ddH2O 0.819. Mu.L, iPLEX Buffer 0.2. Mu.L, extend Primer Mix 0.94.94. Mu.L, iPLEX Enzyme 0.041. Mu.L;
adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution of the previous step of each PCR hole, mixing, adding 9 mu L of mixed solution, sealing a film, and vortex shaking; the plates were put on a PCR instrument for the following thermal cycles: 94℃for 30 seconds; 94 ℃,5 seconds, 52 ℃,5 seconds, 80 ℃,5 seconds, 40 cycles total; 72 ℃,3 minutes; preserving at 4 ℃.
The process conditions of the desalting step in the step B are as follows: spreading clean resin on the dimple plate, and air-drying for at least 10min; 41. Mu.l of H2O was added to each well of the PCR plate with the sample, followed by centrifugation; lightly and reversely rotating the PCR plate in a high-speed way, placing the PCR plate on a dimple plate with resin, and then turning the dimple plate together with the PCR plate in an alignment way to enable the resin to fall into the hole; sealing the PCR plate with a film, and placing the PCR plate on a rotator for being inverted and uniform for 15 minutes; the PCR plates were centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
The invention has the substantial characteristics and the remarkable technical progress that:
1. in order to further improve breeding efficiency, the invention provides a SNP molecular marker closely linked with the male sterility of the sweet pepper, and the molecular marker and the fertility of the male sterility of the sweet pepper show coseparation, so that the genotypes of the fertility and the sterility plants can be accurately identified. The scatter plot is divided into 3 parts, blue triangles represent homozygous fertile plants, green squares represent heterozygous fertile plants, and orange triangles represent homozygous sterile plants, as can be seen in FIG. 1.
2. According to SNP molecular markers of sweet pepper nuclear sterility, the invention provides a pair of flight mass spectrum primers which can be used for rapidly identifying the fertility phenotype of the capsicum and lay a good foundation for the transfer of male sterile genes of sweet pepper nuclear.
3. Compared with the traditional method for distinguishing plant fertility according to morphological characteristics, fertility characteristics and economic characters, the molecular marker can distinguish plant fertility and genotypes thereof in advance in a seedling stage. In the transfer process, the genotypes (MSms and MSMS) of the F2 generation fertile plants can be identified, the fertile plants (MSms) and the sterile plants (MSms) are hybridized and transferred, the problem of mass side matching in the transfer process is effectively avoided, and the transfer efficiency is improved.
4. Compared with the first generation molecular markers (RELP, RADP, AFLP) and the second generation molecular markers (SSR, ISSR), the mass spectrometry SNP typing technology combines the PCR technology and mass spectrometry, and can realize genotyping high-throughput screening of a large number of SNPs every day. The method has the characteristics of large flux, high speed, high accuracy, strong flexibility, short detection period, low cost and the like.
Drawings
FIG. 1 is a mass spectrometry detection result of the sweet pepper nuclear male sterility AB91 candidate site 28594037.
The scatter plot is divided into 3 parts, blue triangles represent homozygous fertile plants, green squares represent heterozygous fertile plants, and orange triangles represent homozygous sterile plants, as can be seen in FIG. 1.
Detailed Description
The present invention is further described below with reference to examples, but the present invention is not limited thereto, and the claims of the present invention should be construed as being limited thereto, and any equivalent means according to the specification may be substituted without departing from the scope of the present invention.
Example 1
The invention has the following overall technical concept:
the flight mass spectrum molecular marker Cap91 related to the male sterility of the sweet pepper nuclear is characterized in that the SNP locus thereof is mutated into A corresponding to the 28594037 th nucleotide locus C on the chromosome 5 of the sweet pepper, so as to lead to the difference of fertility phenotypes of the sweet pepper, and the 28594037 th nucleotide on the chromosome 5 of the sweet pepper has a base sequence shown in SEQ ID NO.3, wherein:
when 28594037 nucleotide on chromosome 5 of sweet pepper is A, the sweet pepper is sterile;
when 28594037 nucleotide on chromosome 5 of sweet pepper is C, the sweet pepper is homozygous and fertile;
when the 28594037 nucleotide on chromosome 5 of the sweet pepper is AC, the sweet pepper is heterozygous and fertile.
The application of the flight mass spectrum molecular marker Cap91 related to the male sterility of sweet pepper nuclei comprises the following steps:
A. f obtained by extracting Zanthoxylum piperitum and grinding No. 16 selfing 2 Seedling DNA generation;
B. f obtained by selfing Zanthoxylum piperitum Ji ground No. 16 in step A 2 Carrying out PCR amplification by taking seedling DNA as a template and using the mass spectrometry primer in claim 2, removing the rest dNTPs and primers in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrometry detection typing after single base extension and desalination of a sample;
C. according to the typing result of the step B,
when 28594037 nucleotide on chromosome 5 of sweet pepper is A, the sweet pepper is sterile;
when 28594037 nucleotide on chromosome 5 of sweet pepper is C, the sweet pepper is homozygous and fertile;
when the 28594037 nucleotide on chromosome 5 of the sweet pepper is AC, the sweet pepper is heterozygous and fertile.
The mass spectrum primer combination for amplifying the SNP locus comprises:
cap91-R ACGTTGGATGACCTTTTTCGTCTTCTGTTG, shown as SEQ ID NO. 1;
cap91-F ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2.
F obtained by selfing the Ji-ground No. 16 sweet pepper extracted in the step A 2 The DNA extraction kit of Chengdu Fuji Biotechnology Co was used for the DNA extraction of young seedlings.
The PCR reaction in the step B adopts a reaction system of 5 mu L: ddH 2 O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl 2 0.4. Mu.L, 25mmol/LdNTP Mix 0.1. Mu.L, 1. Mu. Mol/L Primer Mix 0.5. Mu.L, 5U/. Mu.L PCR Enzyme 0.2. Mu.L, 10 ng/. Mu.L DNA 2.0. Mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95℃for 30 seconds, annealing at 56℃for 30 seconds, extension at 72℃for 1 minute, 45 cycles total; finally, the extension was carried out at 72℃for 5 minutes.
The conditions of the SAP enzyme digestion reaction in the step B are as follows:
the SAP mixed solution comprises the following components: dd H 2 O1.53. Mu.L, SAP Buffer 0.17. Mu.L, SAP Enzyme 0.3. Mu.L at a concentration of 1.7U/. Mu.L;
the 2. Mu.L SAP mix was added to each 96-well PCR well, and the total volume after addition was 7. Mu.L, the plate was sealed with film, vortexed and placed on a PCR instrument for the following procedure: 37 ℃ for 40 minutes; 85 ℃ for 5 minutes; preserving at 4 ℃.
The single base extension reaction conditions in the step B are as follows:
the iPLEX mixed solution consists of the following components: ddH2O 0.819. Mu.L, iPLEX Buffer 0.2. Mu.L, extend Primer Mix 0.94.94. Mu.L, iPLEX Enzyme 0.041. Mu.L;
adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution of the previous step of each PCR hole, mixing, adding 9 mu L of mixed solution, sealing a film, and vortex shaking; the plates were put on a PCR instrument for the following thermal cycles: 94℃for 30 seconds; 94 ℃,5 seconds, 52 ℃,5 seconds, 80 ℃,5 seconds, 40 cycles total; 72 ℃,3 minutes; preserving at 4 ℃.
The process conditions of the desalting step in the step B are as follows: spreading clean resin on the dimple plate, and air-drying for at least 10min; 41. Mu.l of H2O was added to each well of the PCR plate with the sample, followed by centrifugation; lightly and reversely rotating the PCR plate in a high-speed way, placing the PCR plate on a dimple plate with resin, and then turning the dimple plate together with the PCR plate in an alignment way to enable the resin to fall into the hole; sealing the PCR plate with a film, and placing the PCR plate on a rotator for being inverted and uniform for 15 minutes; the PCR plates were centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
1. Identification of field traits
F obtained by selfing Zanthoxylum piperitum with Zanthoxylum piperitum Hemsms No. 16 2 The 239 strain is planted in a field, and fertility identification is carried out in the flowering phase. Through investigation F 2 In the population, 169 plants and 70 plants were sterile. Will F 2 And (3) reserving single plants of the fertile plants (MSms ) in the generation groups, respectively planting, wherein each single plant planting group is 30-40 plants, and deducing the genotype of the fertile plants in the F2 generation of Ji-research No. 16 of sweet pepper according to the fertility separation condition in the F3 generation plant group. F (F) 2 60 plants (MSMS) with pure dominant generation and mixed seeds109 fertile plants (MSms) were combined (see Table 1).
2. Plant DNA extraction
Zanthoxylum piperitum Ji research No. 16 (MSms) selfing F 2 The 239 generation individuals were subjected to DNA extraction using DNA extraction kit from Chengdu Fuji Biotechnology Co.
3. Construction of DNA Gene pool and sequencing
Randomly selecting 20 homozygous fertile strains of DNA from the Zanthoxylum piperitum Hemsl research 16F 2 generation group, and mixing the same amount to construct a fertile DNA pool (MSMS); the sterile DNA pools (msms) were constructed by randomly selecting 20 sterile strains of DNA equivalent mix. MSMS and MSMS gene pools were sequenced by BSA-seq technique, respectively.
4. Sequencing data analysis
In order to reduce the influence of sequencing errors and alignment errors, SNP-index and InDel-index polymorphic sites are filtered, and 11,348,482 filtered polymorphic marker sites are obtained. The method comprises the steps of taking difference between two offspring SNP-index and InDel-index, selecting a window which is larger than a threshold value at a 95% confidence level as a candidate interval, selecting 27541 and 1865 SNP and InDel polymorphism marker loci altogether, extracting ANNOVAR annotation results for the candidate loci, preferentially selecting the genes of stop loss, stop gain and loci with non-synonymous mutation or alternative splicing as candidate genes, and screening 35 SNP candidate genes of a fertility gene library and a sterile gene library.
5. SNP-Index analysis
The 33 genes for the relevant region were compared to NR, swissProt, GO and kegg databases by BLAST software. Finally, 10 candidate genes related to the sterility of sweet pepper nuclei are knocked out, 11 candidate sites are obtained, and all candidate sites are located on chromosome 5. Therefore, the Male sterile Ji-research No. 16 candidate gene of the sweet pepper nucleus is positioned on chromosome 5.
The 11 mutation sites are detected in the selfing F2 generation group of the Ji-research No. 16 fertile strain (Msms) of the sweet pepper nuclear male sterile dual-purpose line by utilizing the flight mass spectrometry genotyping technology. The mutation site 28594037 and fertility investigation have the highest accuracy.
6. Identification of plant fertility genotype by flight mass spectrometry genotyping method
Designing a flight mass spectrum primer according to a candidate gene SNP locus 28594037 on a sweet pepper chromosome 5, wherein a base C of the locus is mutated into A, cap91-R is 5'-ACGTTGGATGACCTTTTTCGTCTTCTGTTG-3'; cap 91-F5'-ACGTTGGATGAGATGCATTTTCCGTGCTGG-3'.
PCR amplification reaction
The PCR reaction used was 5. Mu.L of reaction system: ddH 2 O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl 2 0.4μL，25mmol/LdNTP Mix 0.1μL，1μmol/L Primer Mix 0.5μL，5U/μL PCR Enzyme 0.2μL，10ng/μL DNA 2.0μL。
PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95℃for 30 seconds, annealing at 56℃for 30 seconds, extension at 72℃for 1 minute, 45 cycles total; finally, the extension was carried out at 72℃for 5 minutes.
SAP enzyme digestion reaction
The SAP blend was formulated according to the following components: dd H 2 O1.53. Mu.L, SAP Buffer 0.17. Mu.L, SAP Enzyme (1.7U/. Mu.L) 0.3. Mu.L. The 2. Mu.L SAP mix described above was added to each 96-well PCR well (total volume after mix: 7. Mu.L), the plate was sealed with film, vortexed and placed on a PCR instrument for the following procedure: 37 ℃ for 40min;85 ℃ for 5min; preserving at 4 ℃.
Single base extension reaction
The iPLEX mixed solution consists of the following components: ddH 2 O 0.819μL，iPLEX Buffer 0.2μL，Extend Primer Mix 0.94μL，iPLEX Enzyme 0.041μL；
Adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution of the previous step of each PCR hole, mixing, adding 9 mu L of mixed solution, sealing a film, and vortex shaking; the plates were put on a PCR instrument for the following thermal cycles: 94℃for 30 seconds; 94 ℃,5 seconds, 52 ℃,5 seconds, 80 ℃,5 seconds, 40 cycles total; 72 ℃,3 minutes; preserving at 4 ℃.
Sample desalination: spreading clean resin on dimple plate, and air drying for at least 10min; 41 mu LH was added to each well of the PCR plate with samples 2 O, and then centrifuging; lightly and reversely rotating the PCR plate in a high-speed manner, placing the PCR plate on a dimple plate with resin, and then reversely rotating the dimple plate together with the PCR plate in an alignment manner to enable the resin to fall into the hole; with film handleSealing the PCR plate, and placing the PCR plate on a rotator for being inverted and uniformly for 15min; the PCR plates were centrifuged at 4000rpm for 5min using a standard plate centrifuge.
And (3) naturally crystallizing the desalted sample on a chip target point, performing mass spectrum detection on the sample on a machine, and collecting data. The plant with SNP locus 28594037 polymorphism A has a homozygous sterile plant, the plant with SNP locus 28594037 polymorphism A has a homozygous fertile plant, and the plant with SNP locus A has a heterozygous fertile plant.
Detecting the sterile genotyping result of the sweet pepper by a flight mass spectrometry typing method: 109 heterozygous fertile plants, 59 homozygous fertile plants, 70 sterile plants and other plants with the exception of No. 112 have no SNP typing results, and all other plants are consistent with the field shape expression, so that the reliability of the candidate SNP locus is verified (Table 1).
TABLE 1 flight mass spectrometry genotyping and field data results of Zanthoxylum piperitum Hemsl et al, no. 16 nuclear male sterility SNP locus 28594037
Annotation: b represents sterility; k represents fertility; y represents a sterile plant; m represents no sterile strain. The in-frame color red is the number for which no genotype was detected by the mass spectrometry.
Example 2
Molecular marker identification method for pepper in fertility seedling stage
1. Seedling and DNA extraction
The sweet pepper seedlings are cultured as follows: seed soaking and germination accelerating are carried out on the No. 16 sweet pepper seeds, the seeds are sowed into seedling trays after white exposure, and DNA is extracted by adopting a DNA extraction kit of Chengdu Fuji biotechnology Co after 2-3 true leaves grow on the plants.
2. Identification of plant genotypes by flight mass spectrometry
The flight mass spectrum primer Cap91 provided by the invention is used for PCR amplification reaction, and the SAP enzyme digestion reaction, single base extension and desalination method mentioned in the example 1 are used for sample preparation before on-machine, and statistical data after mass spectrum detection are adopted.
The accurate molecular weight of the sample is obtained by detecting the flight time of the nucleic acid molecules in the vacuum tube, and SNP locus information is detected according to the molecular weight. The plant with SNP locus 28594037 polymorphism A has a homozygous sterile plant, the plant with SNP locus 28594037 polymorphism A has a homozygous fertile plant, and the plant with SNP locus A has a heterozygous fertile plant.
Sequence listing
<110> institute of economic crop and crop at academy of sciences of agriculture and forestry in Hebei province
<120> flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof
<130> none
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> An artificial sequence
<400> 1
acgttggatg acctttttcg tcttctgttg 30
<210> 2
<211> 30
<212> DNA
<213> An artificial sequence
<400> 2
acgttggatg agatgcattt tccgtgctgg 30
<210> 3
<211> 1350
<212> DNA
<213> An artificial sequence
<400> 3
atgggaacta gggttccggt gcagcactat gatatgaggt cggcggcgga ttcgtatata 60
gagacgtctt tgcatgatct caatgcagag ggtattggtg gcggtggtgg tggtgatgat 120
gttgatcgtg gaggaggtga tgtaacggat gatagcatgg gtagtggtga tgaatctaca 180
gctgttgatt gtctccagga gaccttcaga aactcattac cacttcatgg tatggtggtg 240
gaggatgatc atactagcat tgaaaatagc ggatcttcaa cgggttccta caatattgtt 300
accattgatg atatatcacc aattgaaaca gcaaggacaa gatttttgga cattattgtc 360
gatcatttta taaggccaca tgtagttgat gttgtagatt cagaggcaga cttcgctgct 420
caaacatcac aagataaaat gagcaagcgg aagtttagag aaatccaata tgaaggtgat 480
gctacatatg ttttgccgtt gatgtacgtg gctaacatgt atgaaacact ggttaatgaa 540
gtgaatgtaa gactctcttc tttgaatgga atgcgtgaaa aaaccatcgg tgtcgccctt 600
gaagcagctg gtggtttata cagaaagctt gcaaaaaaat ttcctaggaa aggaccttgc 660
atgtttaaaa ggcgggagtt ggctacatct tttgaaacaa gggcaaggtt tcctgaatta 720
gtgatacaag aggagaagcg tgtccgattt gtcgtggtta atggtttagc cattgtggag 780
aaaccaacaa gcttatgtat tgatgatgca gaatggttca gaagaatgac tggccgaaac 840
gaagtcgcta tatcccctag agactataaa ttctatgctc caagacacaa gtatagacgt 900
gcgtcaaact caatttccaa catcactggt ttgtcacgta acaccagcac ggaaaatgca 960
tcttcattgt ctgcaggtca aagctaccgc tctgttagtg aagaaagtca acagactacg 1020
tcaaagcagc atatgcaacc tctggcccat caggctcaat ttcatcccct tcagcagagc 1080
caccatatca accaaagtca acatatcagt catttctcgc acaatcaaca atgtggccca 1140
caatctcatt tgtccgaaat ttctcatact cagcagtcgc caaccattcc tccacatatg 1200
gcttgcttac aacaattagg ccatgtagga gggcgcatgc atataatgcc tgcaagtcct 1260
gcaaagttct gtgatgaatg tggtactccc tacttgagag agacttcaaa gttctgctca 1320
gaatgtggta ctaagaggtt agggatatga 1350
Claims (6)
1. The method for identifying the male sterility of the sweet pepper nuclei by using the flight mass spectrum molecular marker Cap91 is characterized by comprising the following steps:
A. f obtained by extracting Zanthoxylum piperitum and grinding No. 16 selfing 2 Seedling DNA generation;
B. f obtained by selfing Zanthoxylum piperitum Ji ground No. 16 in step A 2 The seedling DNA is taken as a template, the mass spectrum primer is used for PCR amplification, the SAP enzyme digestion reaction is used for removing the rest dNTPs and primers in a PCR reaction system, the mass spectrum detection typing is carried out after the sample single base extension and desalination, and the mass spectrum primer combination comprises the following components:
cap91-R ACGTTGGATGACCTTTTTCGTCTTCTGTTG, shown as SEQ ID NO. 1;
cap91-F ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2;
C. according to the typing result of the step B, the base of the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is the 937bp locus in the sequence SEQ ID NO.3, and when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile; when the 28594037 nucleotide on chromosome 5 of the sweet pepper is C, the sweet pepper is homozygous and fertile.
2. The method according to claim 1, wherein F obtained by selfing of Ji-research No. 16 of sweet pepper is extracted in the step A 2 The DNA extraction kit of Chengdu Fuji Biotechnology Co was used for the DNA extraction of young seedlings.
3. The method according to claim 1, wherein the PCR reaction in step B is performed using a reaction system of 5. Mu.L: ddH 2 O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl 2 0.4. Mu.L, 25mmol/LdNTP Mix 0.1. Mu.L, 1. Mu. Mol/L Primer Mix 0.5. Mu.L, 5U/. Mu.LPCR Enzyme 0.2. Mu.L, 10 ng/. Mu.L DNA 2.0. Mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95℃for 30 seconds, annealing at 56℃for 30 seconds, extension at 72℃for 1 minute, 45 cycles total; finally, the extension was carried out at 72℃for 5 minutes.
4. The method according to claim 1, wherein the SAP enzyme digestion reaction conditions in step B are:
the SAP mixed solution comprises the following components: dd H 2 O1.53. Mu.L, SAP Buffer 0.17. Mu.L, SAP Enzyme 0.3. Mu.L at a concentration of 1.7U/. Mu.L;
the 2. Mu.L SAP mix was added to each 96-well PCR well, and the total volume after addition was 7. Mu.L, the plate was sealed with film, vortexed and placed on a PCR instrument for the following procedure: 37 ℃ for 40 minutes; 85 ℃ for 5 minutes; preserving at 4 ℃.
5. The method according to claim 1, wherein the single base extension reaction conditions in step B are:
the iPLEX mixed solution consists of the following components: ddH 2 O 0.819μL，iPLEX Buffer 0.2μL，Extend Primer Mix 0.94μL，iPLEX Enzyme 0.041μL；
Adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution of the previous step of each PCR hole, mixing, adding 9 mu L of mixed solution, sealing a film, and vortex shaking; the plates were put on a PCR instrument for the following thermal cycles: 94℃for 30 seconds; 94 ℃,5 seconds, 52 ℃,5 seconds, 80 ℃,5 seconds, 40 cycles total; 72 ℃,3 minutes; preserving at 4 ℃.
6. The method of claim 1, wherein the desalting step in step B is performed under the following conditions:
spreading clean resin on the dimple plate, and air-drying for at least 10min; 41. Mu.l of H was added to each well of the PCR plate with samples 2 O, and then centrifuging; lightly and reversely rotating the PCR plate in a high-speed way, placing the PCR plate on a dimple plate with resin, and then turning the dimple plate together with the PCR plate in an alignment way to enable the resin to fall into the hole; sealing the PCR plate with a membranePut on a rotator and reverse for 15 minutes; the PCR plates were centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010678209.9A CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010678209.9A CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111778348A CN111778348A (en) | 2020-10-16 |
| CN111778348B true CN111778348B (en) | 2023-05-16 |
Family
ID=72768799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010678209.9A Active CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111778348B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109006456B (en) * | 2018-07-13 | 2021-06-18 | 河北省农林科学院经济作物研究所 | Breeding method of pimento nuclear male sterile dual-purpose line |
-
2020
- 2020-07-15 CN CN202010678209.9A patent/CN111778348B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN111778348A (en) | 2020-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108779459B (en) | Cotton whole genome SNP chip and application thereof | |
| CN108060261B (en) | Method for capturing and sequencing corn SNP marker combination and application thereof | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN105925721A (en) | Single nucleotide polymorphism marker site, primer and kit for identifying coloring property of peach epidermis and application | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN105603083B (en) | Method for carrying out corn-assisted efficient breeding by using two molecular markers including SSR (simple sequence repeat) and SNP (Single nucleotide polymorphism) | |
| CN116814673A (en) | Genomic structural variation for regulating and controlling content of soluble solids in tomato fruits, related products and application | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN111778348B (en) | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof | |
| CN113736907B (en) | SNP locus combination for detecting tomato gray leaf spot resistance and application thereof | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN114525360A (en) | SNP marker closely linked with green fruit color Gv1 gene of eggplant and application | |
| KR101359542B1 (en) | Microsatellite primer sets for discriminating cultivars of peach and uses thereof | |
| WO2012017679A1 (en) | Stalk-length-related marker of plant of the genus saccharum and the use thereof | |
| CN116875728B (en) | KASP molecular marker group for identifying five-leaf strawberries and application thereof | |
| JP2010239960A (en) | Variety identification marker of vegetative propagation crop | |
| CN105861496A (en) | Molecular marker in close linkage with bitter gourd powdery mildew resistance gene and application thereof | |
| WO2012017682A2 (en) | Leaf-blade-length-related marker of plant of the genus saccharum and the use thereof | |
| CN117737294A (en) | Molecular marker and method for rapidly identifying purity of tomato winter rhyme hybrid seeds | |
| WO2012017683A1 (en) | Leaf-area-related marker of plant of the genus saccharum and the use thereof | |
| CN117757977A (en) | KASP molecular marker TMSK23 related to eggplant reverse thermosensitive core male sterility and application thereof | |
| CN114854895A (en) | Molecular marker BnZn-3A1 closely linked with rape zinc content trait QTL and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |