CN111778348A - Flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof - Google Patents
Flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof Download PDFInfo
- Publication number
- CN111778348A CN111778348A CN202010678209.9A CN202010678209A CN111778348A CN 111778348 A CN111778348 A CN 111778348A CN 202010678209 A CN202010678209 A CN 202010678209A CN 111778348 A CN111778348 A CN 111778348A
- Authority
- CN
- China
- Prior art keywords
- pcr
- sweet pepper
- pimento
- plate
- mass spectrum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6872—Methods for sequencing involving mass spectrometry
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of molecular genetics, in particular to a flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof. Comprises extracting DNA of No. 16 seedling of Ji' an dual-purpose line of nuclear male sterility of sweet pepper; b, taking DNA of seedlings of the pimento nuclear male sterile line Ji ground No. 16 in the step A as a template, carrying out PCR amplification by using a specific mass spectrum primer, removing residual dNTPs and primers in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrum detection and typing after single base extension and desalination of a sample; when 28594037 th nucleotides on the chromosome 5 of the sweet pepper are A, C and AC, the sweet pepper is sterile, homozygous fertile, heterozygous fertile and other process steps. The invention solves the problems of large workload of test cross and the like in the prior art, has the advantages of avoiding the problem of large-scale distribution in the transfer process, improving the transfer efficiency and the like.
Description
Technical Field
The invention relates to the technical field of molecular genetics, in particular to a flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof.
Background
Capsicum annuum (Capsicum annuum L) of the Solanaceae family belongs to annual or perennial crops, and is the most important vegetable crop in the world. Sweet pepper (Capsicum annuum var. grossum) is a variety of Capsicum. Because the heterosis utilization value of the sweet pepper is higher, the yield of the excellent hybrid seeds can be increased by 30 to 50 percent compared with the conventional seeds. The first generation hybrid seeds are produced by utilizing the sweet pepper male sterile line, so that the links of artificial emasculation and the like can be saved, the cost and the difficulty of seed production are greatly reduced, the seed purity is obviously improved, and the method is an important way for the utilization of hybrid vigor. Therefore, the study of male sterility is highly regarded by many scholars at home and abroad.
Male sterility is mainly divided into two types, nuclear male sterility (GMC) and Cytoplasmic male sterility (CMC). Cytoplasmic Male (CMC) sterility needs three-line matching, and although the Cytoplasmic Male (CMC) sterility is applied to pepper varieties, the Cytoplasmic Male (CMC) sterility is still difficult to use in sweet peppers, and the key point is that excellent restorer lines and the like are difficult to find in sweet peppers. The genetic simplicity of the dual-purpose line of the nuclear male sterility (GMC) is realized, and the restorer line is widely favored by breeders at present. Yanqi celery and the like find a sweet pepper nuclear sterile resource AB91, and 14 new varieties of Ji-researched series such as Ji-researched No. 6, Ji-researched No. 16, Ji-researched No. 20, Ji-researched No. 108 and the like are bred by utilizing the sweet pepper nuclear male sterile dual-purpose line, and are sold and widely planted in various places of China.
The stable sterile line bred by adopting the traditional nuclear male sterile material needs 7-10 years, and the breeding period can be effectively shortened and the breeding efficiency can be improved by utilizing molecular marker-assisted selective breeding. To date, nearly 20 nuclear sterile genes have been reported in pepper worldwide, and some of the sterile genes have been primarily located by using molecular marker technology. However, there are few reports on the molecular marker of the nuclear male sterility gene of sweet pepper and the use of the marker to assist selective breeding.
Patent documents retrieved by the applicant include:
patent document No. CN109006456A discloses a "breeding method of a pimento nuclear male sterile dual-purpose line", which utilizes a molecular marker technology to mark a sterile gene (MSMS) and a fertile gene (MSMS) of a pimento nuclear male sterile dual-purpose line AB91, and when fertility of F2 generation of pimento nuclear male sterile dual-purpose line is separated, a molecular marker is used to assist selection to identify a sterile plant and a fertile plant at a seedling stage, a fertile plant with the genotype of MSMS is eliminated, and a fertile plant with the genotype of MSMS is selected and directly used for the transformation of the sterile line. The patent literature mentioned above is SSR molecular marker for detecting pimento nuclear male sterility, and the molecular marker is detected by conventional PCR method, which takes long time and has high cost; the molecular marker is a closely linked marker, and the flight mass spectrum molecular marker Cap91 related to the pimento nuclear male sterility mentioned in the patent is designed according to the mutation site of the sterile plant, so that the accuracy rate is relatively high.
The publication No. CN106048012A discloses a method of 'molecular marker for assisting Rf gene selection, specific primer and application', wherein the molecular marker is closely linked with the pepper Rf gene, and the genetic distance with the pepper Rf gene is 0.7 cm. The molecular marker is a restoring gene in hot pepper cytoplasmic male sterility, and the molecular marker of the hot pepper nuclear male sterility gene is not provided.
Object of the Invention
The invention aims to provide a flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof, wherein the molecular marker locus is obtained by taking Ji & researched No. 16 as a test material and utilizing WGS whole genome re-sequencing technology to grind No. 16F of pimento according to published pepper genome information2Pure dominant fertile plants and recessive sterile plants in the generation are built and sequenced, SNP (single nucleotide polymorphism) differential sites of fertile genes and sterile gene pools are screened out, and the differential sites obtained by flight mass spectrometry genotyping, fluorescence quantification (qRT-PCR) and protein three-dimensional mechanism prediction verification are used.
The overall technical concept of the invention is as follows:
the flight mass spectrum molecular marker Cap91 related to the pimento nuclear male sterility is characterized in that the C of the 28594037 nucleotide site on the SNP site corresponding to the chromosome 5 of the pimento is mutated into A, so that the difference of the pimento fertility phenotype is caused, the nucleotide sequence of the 28594037 nucleotide on the chromosome 5 of the pimento is shown in SEQ ID NO.3, wherein:
when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
The application of flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility comprises the following steps:
A. f obtained by extracting sweet pepper Ji ground No. 16 selfing2DNA of the generation seedling;
B. f obtained by selfing sweet pepper Ji No. 16 obtained in step A2Taking the DNA of the seedling generation as a template, carrying out PCR amplification by using the mass spectrum primer in claim 2, removing residual dNTPs and the primer in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrum detection typing after single base extension and desalination of a sample;
C. according to the typing result of the step B, when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
The sweet pepper Ji research No. 16 in the application is provided by a solanaceous fruit research institute of economic crop research institute of academy of agriculture and forestry, Hebei province, the variety is obtained by hybridizing a sweet pepper nuclear male sterile line and a good inbred line, the sterility is controlled by a pair of recessive nuclear single genes, and the inheritance is stable. The primers for flight mass spectrometry were synthesized by takara Bio Inc.
The specific technical concept of the invention is as follows:
the mass spectrum primer combination for amplifying the SNP locus comprises:
cap91-R is ACGTTGGATGACCTTTTTCGTCTTCTGTTG as shown in SEQ ID NO. 1;
cap91-F: ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2.
F obtained by extracting sweet pepper Ji powder in the step A and selfing No. 162DNA extraction kit of Chengdu Fujian biotechnology limited company is adopted for DNA extraction of the seedlings.
In the step B, 5 mu L of reaction system is adopted for PCR reaction: ddH2O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl20.4. mu.L, 25mmol/L dNTP Mix 0.1. mu.L, 1. mu. mol/L Primer Mix 0.5. mu.L, 5U/. mu.L LPCR Enzyme 0.2. mu.L, 10 ng/. mu.L DNA 2.0. mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 45 cycles; final extension at 72 ℃ for 5 min.
The SAP enzyme digestion reaction conditions in the step B are as follows:
the composition of the SAP blend was: dd H2O1.53. mu.L, SAP Buffer 0.17. mu.L, SAPENzyme 0.3. mu.L at a concentration of 1.7U/. mu.L;
add the above 2. mu.L SAP mixture to each 96-well PCR well, add the total volume of the mixture to 7. mu.L, seal the plate with membrane, vortex, place the plate on the PCR instrument for the following procedures: 40 minutes at 37 ℃; 5 minutes at 85 ℃; storing at 4 ℃.
The single base extension reaction conditions in the step B are as follows:
the iPLEX mixed solution consists of the following components: ddH2O 0.819.819. mu.L, iPLEX Buffer 0.2. mu.L, Extendprimer Mix 0.94. mu.L, iPLEX Enzyme 0.041. mu.L;
adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution in the previous step of each PCR hole, mixing well, adding the mixed solution, then sealing the membrane, and performing vortex oscillation; place the plate on a PCR instrument for the following thermal cycling: 30 seconds at 94 ℃; 40 cycles of 94 ℃, 5 seconds, 52 ℃, 5 seconds, 80 ℃, 5 seconds; 3 minutes at 72 ℃; storing at 4 ℃.
The process conditions of the desalting step in the step B are as follows: spreading clean resin on a dimple plate, and air-drying for at least 10 minutes; add 41. mu.l H2O to each well of the PCR plate with the sample, and then centrifuge; the PCR plate is slightly and freely inverted, the PCR plate is placed on the dimple plate with the resin, and then the dimple plate is aligned with the PCR plate and is turned over together, so that the resin falls into the hole; sealing the PCR plate with a membrane, and placing the PCR plate on a rotator to be overturned evenly for 15 minutes; the PCR plate was centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
The invention has the substantive characteristics and the obvious technical progress is that:
1. in order to further improve the breeding efficiency, the invention provides an SNP molecular marker closely linked with the pimento nuclear male sterility, the molecular marker and the fertility of the pimento nuclear male sterility show coseparation, and the genotype of fertile and sterile plants can be accurately identified. As can be seen from FIG. 1, the dot plot is divided into 3 parts, the blue triangles represent homozygous fertile plants, the green squares represent heterozygous fertile plants, and the orange triangles represent homozygous sterile plants.
2. According to the SNP molecular marker of the pimento nuclear sterility, the invention provides a pair of flight mass spectrum primers, and the primers can be used for rapidly identifying the pepper fertility phenotype and lay a good foundation for the transformation of pimento nuclear male sterility genes.
3. Compared with the traditional method for distinguishing the plant fertility according to morphological characteristics, fertility characteristics and economic characters, the molecular marker can distinguish the plant fertility and the genotype thereof in advance in the seedling stage. In the transformation process, the F2 generation fertile plant genotypes (MSms and MSMS) can be identified, the fertile plant (MSms) and the sterile plant (MSms) are hybridized and transformed, the problem of large amount of side matching in the transformation process is effectively avoided, and the transformation efficiency is improved.
4. Compared with the first generation molecular markers (RELP, RADP, AFLP) and the second generation molecular markers (SSR, ISSR), the mass spectrum SNP typing technology combines the PCR technology and the mass spectrum, and can realize the genotyping high-throughput screening of a large amount of SNPs every day. The method has the characteristics of high flux, high speed, high accuracy, strong flexibility, short detection period, low cost and the like.
Drawings
FIG. 1 shows the mass spectrometric detection result of the candidate site 28594037 of male sterility AB91 of pimento nucleus.
As can be seen from FIG. 1, the dot plot is divided into 3 parts, the blue triangles represent homozygous fertile plants, the green squares represent heterozygous fertile plants, and the orange triangles represent homozygous sterile plants.
Detailed Description
The present invention is further described with reference to the following examples, which are not intended to limit the scope of the present invention, and the claims are not to be interpreted as limiting the scope of the present invention.
Example 1
The overall technical concept of the invention is as follows:
the flight mass spectrum molecular marker Cap91 related to the pimento nuclear male sterility is characterized in that the C of the 28594037 nucleotide site on the SNP site corresponding to the chromosome 5 of the pimento is mutated into A, so that the difference of the pimento fertility phenotype is caused, the nucleotide sequence of the 28594037 nucleotide on the chromosome 5 of the pimento is shown in SEQ ID NO.3, wherein:
when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
The application of flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility comprises the following steps:
A. f obtained by extracting sweet pepper Ji ground No. 16 selfing2DNA of the generation seedling;
B. f obtained by selfing sweet pepper Ji No. 16 obtained in step A2Taking the DNA of the seedling generation as a template, carrying out PCR amplification by using the mass spectrum primer in claim 2, removing residual dNTPs and the primer in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrum detection typing after single base extension and desalination of a sample;
C. according to the result of the typing in the step B,
when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
The mass spectrum primer combination for amplifying the SNP locus comprises:
cap91-R is ACGTTGGATGACCTTTTTCGTCTTCTGTTG as shown in SEQ ID NO. 1;
cap91-F: ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2.
F obtained by extracting sweet pepper Ji powder in the step A and selfing No. 162DNA extraction kit of Chengdu Fujian biotechnology limited company is adopted for DNA extraction of the seedlings.
In the step B, 5 mu L of reaction system is adopted for PCR reaction: ddH2O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl20.4. mu.L, 25mmol/L dNTP Mix 0.1. mu.L, 1. mu. mol/L Primer Mix 0.5. mu.L, 5U/. mu.L LPCR Enzyme 0.2. mu.L, 10 ng/. mu.L DNA 2.0. mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 45 cycles; final extension at 72 ℃ for 5 min.
The SAP enzyme digestion reaction conditions in the step B are as follows:
the composition of the SAP blend was: dd H2O1.53. mu.L, SAP Buffer 0.17. mu.L, SAPENzyme 0.3. mu.L at a concentration of 1.7U/. mu.L;
add the above 2. mu.L SAP mixture to each 96-well PCR well, add the total volume of the mixture to 7. mu.L, seal the plate with membrane, vortex, place the plate on the PCR instrument for the following procedures: 40 minutes at 37 ℃; 5 minutes at 85 ℃; storing at 4 ℃.
The single base extension reaction conditions in the step B are as follows:
the iPLEX mixed solution consists of the following components: ddH2O 0.819.819. mu.L, iPLEX Buffer 0.2. mu.L, Extendprimer Mix 0.94. mu.L, iPLEX Enzyme 0.041. mu.L;
adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution in the previous step of each PCR hole, mixing well, adding the mixed solution, then sealing the membrane, and performing vortex oscillation; place the plate on a PCR instrument for the following thermal cycling: 30 seconds at 94 ℃; 40 cycles of 94 ℃, 5 seconds, 52 ℃, 5 seconds, 80 ℃, 5 seconds; 3 minutes at 72 ℃; storing at 4 ℃.
The process conditions of the desalting step in the step B are as follows: spreading clean resin on a dimple plate, and air-drying for at least 10 minutes; add 41. mu.l H2O to each well of the PCR plate with the sample, and then centrifuge; the PCR plate is slightly and freely inverted, the PCR plate is placed on the dimple plate with the resin, and then the dimple plate is aligned with the PCR plate and is turned over together, so that the resin falls into the hole; sealing the PCR plate with a membrane, and placing the PCR plate on a rotator to be overturned evenly for 15 minutes; the PCR plate was centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
First, field character identification
F obtained by selfing sweet pepper Ji in No. 16 (MSms)2The generation 239 plants are planted in a field, and the fertility of the plants is identified in the flowering phase. Is investigated F2Among the groups, there were 169 fertile plants and 70 sterile plants. F is to be2And (3) reserving single plants of fertile plants (MSms and MSMS) in the generation groups, planting the plants respectively, wherein each single plant planting group is 30-40 plants, and deducing the genotype of the fertile plants in the No. 16F 2 generation of the Zanthoxylum piperitum Hei research according to the fertility segregation condition in the F3 generation plant group. F 260 pure dominant fertile plants (MSMS) and 109 heterozygous fertile plants (MSms) (see Table 1).
Second, plant DNA extraction
Sweet pepper Ji grind No. 16 (MSms) selfing F2The generation 239 individual plants adopt a DNA extraction kit of Chengdu intertechnology limited to extract DNA.
Thirdly, constructing a DNA gene pool and sequencing
Randomly selecting DNA of 20 homozygous fertile strains from a sweet pepper Ji research No. 16F 2 generation population, and equivalently mixing to construct a fertile DNA pool (MSMS); DNA of 20 sterile plants is randomly selected and mixed in equal amount to construct a sterile DNA pool (msms). MSMS and MSMS gene pools are sequenced by a BSA-seq technology respectively.
Fourth, sequencing data analysis
In order to reduce the influence caused by sequencing errors and alignment errors, the SNP-index and InDel-index polymorphic sites are filtered, and 11,348,482 polymorphic marker sites are obtained after filtration. By making a difference between two filial generation SNP-index and InDel-index, selecting a window which is larger than a threshold value at a 95% confidence level as a candidate interval, selecting 27541 and 1865 SNP and InDel polymorphic marker sites in total, extracting ANNOVAR annotation results for the candidate sites, preferentially selecting genes where sites of stop loss, stop gain, non-synonymous mutation or alternative splicing are located as candidate genes, and selecting 35 SNP candidate genes of a fertile gene bank and a sterile gene bank.
Fifth, SNP-Index analysis
The 33 genes in the relevant region were compared to the NR, SwissProt, GO and kegg databases by BLAST software. And finally, knocking out 10 candidate genes related to the pimento nuclear sterility, 11 candidate loci, wherein all the candidate loci are positioned on the No. 5 chromosome. Therefore, candidate gene Ji' an No. 16 male sterility of pimento nucleus is positioned on chromosome 5.
The 11 screened mutation sites are detected in a sweet pepper nuclear male sterility dual-purpose line Ji-researched No. 16 fertile plant (Mmss) inbred F2 generation population by using a flight mass spectrum genotyping technology. The screening of the mutation site 28594037 and fertility investigation have the highest accuracy.
Sixthly, identifying plant fertility genotype by flight mass spectrum genotyping method
Designing a flight mass spectrum primer according to a candidate gene SNP site 28594037 on a sweet pepper chromosome 5, wherein the base C of the site is mutated into A, Cap91-R: 5'-ACGTTGGATGACCTTTTTCGTCTTCTGTTG-3'; cap91-F: 5'-ACGTTGGATGAGATGCATTTTCCGTGCTGG-3'.
PCR amplification reaction
The PCR reaction was performed using a 5. mu.L reaction system: ddH2O 1.3μL，10×PCR Buffer 0.5μL， 25mmol/LMgCl20.4μL，25mmol/LdNTP Mix 0.1μL，1μmol/L Primer Mix 0.5 μL，5U/μL PCR Enzyme0.2μL，10ng/μL DNA 2.0μL。
PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 45 cycles; final extension at 72 ℃ for 5 min.
SAP enzymatic digestion reaction
The SAP blend was prepared according to the following ingredients: dd H2O1.53. mu.L, SAP Buffer 0.17. mu.L, SAP Enzyme (1.7U/. mu.L) 0.3. mu.L. Add the above 2. mu.L of SAP mixture to each 96 wellsIn the PCR wells (total volume after addition of the mixture: 7. mu.L), the plates were sealed with a membrane, vortexed, and placed in a PCR apparatus for the following procedures: at 37 ℃ for 40 min; 5min at 85 ℃; storing at 4 ℃.
Single base extension reaction
The iPLEX mixed solution consists of the following components: ddH2O 0.819μL，iPLEX Buffer 0.2μL， ExtendPrimer Mix 0.94μL，iPLEX Enzyme 0.041μL；
Adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution in the previous step of each PCR hole, mixing well, adding the mixed solution, then sealing the membrane, and performing vortex oscillation; place the plate on a PCR instrument for the following thermal cycling: 30 seconds at 94 ℃; 40 cycles of 94 ℃, 5 seconds, 52 ℃, 5 seconds, 80 ℃, 5 seconds; 3 minutes at 72 ℃; storing at 4 ℃.
Sample desalting: spreading clean resin on the dimple plate, and air-drying for at least 10 min; add 41. mu.LH to each well of the PCR plate with the sample2O, then centrifuging; the PCR plate is slightly and freely inverted and is placed on the dimple plate with the resin, and then the dimple plate is aligned with the PCR plate to be inverted together, so that the resin falls into the hole; sealing the PCR plate with a membrane, and placing on a rotator to be overturned for 15 min; the PCR plate was centrifuged at 4000rpm for 5min using a standard plate centrifuge.
And (3) spotting the sample subjected to desalting treatment on a chip target spot, naturally crystallizing, and performing mass spectrum detection on a computer and collecting data. The plants with the polymorphism of the SNP locus 28594037A are homozygous sterile plants, the plants with the polymorphism of C are homozygous fertile plants, and the plants with the polymorphism of AC are heterozygous fertile plants.
Detecting the typing result of the sterile gene of the sweet pepper by a flight mass spectrum typing method: in the sweet pepper Ji research No. 16F 2 generation 239 single plants, 109 heterozygous fertile plants, 59 homozygous fertile plants and 70 sterile plants exist, except that the plant with the serial number 112 has no SNP typing result, the other plants are consistent with the expression of the field shape, and the reliability of the candidate SNP loci is verified (Table 1).
TABLE 1 pimento Ji research flight mass spectrum genotyping and field data results of No. 16 nuclear male sterility SNP locus 28594037
Note that: b represents sterility; k represents fertile; y represents a sterile plant; m represents a non-sterile strain. The color red in the box is the number of genotypes undetected by flight mass spectrometry.
Example 2
Method for identifying molecular marker of pepper in fertility seedling stage
First, seedling raising and DNA extraction
The sweet pepper seedlings are cultured as follows: soaking seeds of No. 16 ground sweet pepper wings to accelerate germination, sowing the seeds into a seedling tray after white emergence, and extracting DNA by adopting a DNA extraction kit of Chengdu Fuji biotechnology limited company after 2-3 true leaves grow out from the plants.
Second, identifying plant genotype by flight mass spectrometry
The flight mass spectrum primer Cap91 provided by the invention is used for PCR amplification reaction, SAP enzyme digestion reaction, single base extension and desalting method mentioned in example 1 are adopted for sample preparation before computer, and statistical data are obtained after mass spectrum detection.
The accurate molecular weight of the sample is obtained by detecting the flight time of the nucleic acid molecules in the vacuum tube, and the SNP locus information is detected according to the molecular weight. The plants with the polymorphism of the SNP locus 28594037A are homozygous sterile plants, the plants with the polymorphism of C are homozygous fertile plants, and the plants with the polymorphism of AC are heterozygous fertile plants.
Sequence listing
<110> institute of economic crops of academy of agriculture, forestry and science of Hebei province
<120> flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility and application thereof
<130>none
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>30
<212>DNA
<213>An artificial sequence
<400>1
acgttggatg acctttttcg tcttctgttg 30
<210>2
<211>30
<212>DNA
<213>An artificial sequence
<400>2
acgttggatg agatgcattt tccgtgctgg 30
<210>3
<211>1350
<212>DNA
<213>An artificial sequence
<400>3
atgggaacta gggttccggt gcagcactat gatatgaggt cggcggcgga ttcgtatata 60
gagacgtctt tgcatgatct caatgcagag ggtattggtg gcggtggtgg tggtgatgat 120
gttgatcgtg gaggaggtga tgtaacggat gatagcatgg gtagtggtga tgaatctaca 180
gctgttgatt gtctccagga gaccttcaga aactcattac cacttcatgg tatggtggtg 240
gaggatgatc atactagcat tgaaaatagc ggatcttcaa cgggttccta caatattgtt 300
accattgatg atatatcacc aattgaaaca gcaaggacaa gatttttgga cattattgtc 360
gatcatttta taaggccaca tgtagttgat gttgtagatt cagaggcaga cttcgctgct 420
caaacatcac aagataaaat gagcaagcgg aagtttagag aaatccaata tgaaggtgat 480
gctacatatg ttttgccgtt gatgtacgtg gctaacatgt atgaaacact ggttaatgaa 540
gtgaatgtaa gactctcttc tttgaatgga atgcgtgaaa aaaccatcgg tgtcgccctt 600
gaagcagctg gtggtttata cagaaagctt gcaaaaaaat ttcctaggaa aggaccttgc 660
atgtttaaaa ggcgggagtt ggctacatct tttgaaacaa gggcaaggtt tcctgaatta 720
gtgatacaag aggagaagcg tgtccgattt gtcgtggtta atggtttagc cattgtggag 780
aaaccaacaa gcttatgtat tgatgatgca gaatggttca gaagaatgac tggccgaaac 840
gaagtcgcta tatcccctag agactataaa ttctatgctc caagacacaa gtatagacgt 900
gcgtcaaact caatttccaa catcactggt ttgtcacgta acaccagcac ggaaaatgca 960
tcttcattgt ctgcaggtca aagctaccgc tctgttagtg aagaaagtca acagactacg 1020
tcaaagcagc atatgcaacc tctggcccat caggctcaat ttcatcccct tcagcagagc 1080
caccatatca accaaagtca acatatcagt catttctcgc acaatcaaca atgtggccca 1140
caatctcatt tgtccgaaat ttctcatact cagcagtcgc caaccattcc tccacatatg 1200
gcttgcttac aacaattagg ccatgtagga gggcgcatgc atataatgcc tgcaagtcct 1260
gcaaagttct gtgatgaatg tggtactccc tacttgagag agacttcaaa gttctgctca 1320
gaatgtggta ctaagaggtt agggatatga 1350
Claims (8)
1. The flight mass spectrum molecular marker Cap91 related to the pimento nuclear male sterility is characterized in that the C of the 28594037 nucleotide site on the SNP site corresponding to the pimento No. 5 chromosome is mutated into A, so that the difference of the pimento fertility phenotype is caused, the nucleotide sequence of the 28594037 nucleotide on the pimento No. 5 chromosome is shown in SEQ ID NO.3, wherein:
when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
2. The molecular marker Cap91 of flight mass spectrometry related to pimento nuclear male sterility according to claim 1, wherein the primer combination for amplifying SNP locus mass spectrometry comprises:
cap91-R is ACGTTGGATGACCTTTTTCGTCTTCTGTTG as shown in SEQ ID NO. 1;
cap91-F: ACGTTGGATGAGATGCATTTTCCGTGCTGG, shown as SEQ ID NO. 2.
3. The application of flight mass spectrum molecular marker Cap91 related to pimento nuclear male sterility is characterized by comprising the following steps:
A. f obtained by extracting sweet pepper Ji ground No. 16 selfing2DNA of the generation seedling;
B. f obtained by selfing sweet pepper Ji No. 16 obtained in step A2Taking the DNA of the seedling generation as a template, carrying out PCR amplification by using the mass spectrum primer in claim 2, removing residual dNTPs and the primer in a PCR reaction system by using SAP enzyme digestion reaction, and carrying out mass spectrum detection typing after single base extension and desalination of a sample;
C. according to the typing result of the step B, when the 28594037 th nucleotide on the chromosome 5 of the sweet pepper is A, the sweet pepper is sterile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is C, the sweet pepper is homozygously fertile;
when the 28594037 th nucleotide on the sweet pepper chromosome 5 is AC, the sweet pepper is heterozygous and fertile.
4. The use as claimed in claim 3, wherein said F obtained from selfing of sweet pepper Ji & No. 16 extracted in step A2DNA extraction kit of Chengdu Fujian biotechnology limited company is adopted for DNA extraction of the seedlings.
5. The use according to claim 3, wherein the PCR reaction in step B is performed in a 5 μ L reaction system: ddH2O 1.3μL，10×PCR Buffer 0.5μL，25mmol/L MgCl20.4. mu.L, 25mmol/L dNTP Mix 0.1. mu.L, 1. mu. mol/L Primer Mix 0.5. mu.L, 5U/. mu.L PCR Enzyme 0.2. mu.L, 10 ng/. mu.L DNA 2.0. mu.L; PCR amplification procedure: pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 45 cycles; final extension at 72 ℃ for 5 min.
6. The use according to claim 3, wherein the SAP enzymatic digestion reaction conditions in step B are:
the composition of the SAP blend was: dd H2O1.53. mu.L, SAP Buffer 0.17. mu.L, SAP enzyme 0.3. mu.L at a concentration of 1.7U/. mu.L;
add the above 2. mu.L SAP mixture to each 96-well PCR well, add the total volume of the mixture to 7. mu.L, seal the plate with membrane, vortex, place the plate on the PCR instrument for the following procedures: 40 minutes at 37 ℃; 5 minutes at 85 ℃; storing at 4 ℃.
7. The use according to claim 3, wherein the conditions for the single base extension reaction in step B are:
the iPLEX mixed solution consists of the following components: ddH2O 0.819μL，iPLEX Buffer 0.2μL，Extend Primer Mix0.94μL，iPLEX Enzyme 0.041μL；
Adding 2 mu L of iPLEX extension mixed solution into the reaction mixed solution in the previous step of each PCR hole, mixing well, adding the mixed solution, then sealing the membrane, and performing vortex oscillation; place the plate on a PCR instrument for the following thermal cycling: 30 seconds at 94 ℃; 40 cycles of 94 ℃, 5 seconds, 52 ℃, 5 seconds, 80 ℃, 5 seconds; 3 minutes at 72 ℃; storing at 4 ℃.
8. The use according to claim 3, wherein the desalting step in step B is carried out under the following conditions:
spreading clean resin on a dimple plate, and air-drying for at least 10 minutes; add 4 to each well of the PCR plate with sample1μlH2O, then centrifuging; the PCR plate is slightly and freely inverted, the PCR plate is placed on the dimple plate with the resin, and then the dimple plate is aligned with the PCR plate and is turned over together, so that the resin falls into the hole; sealing the PCR plate with a membrane, and placing the PCR plate on a rotator to be overturned evenly for 15 minutes; the PCR plate was centrifuged using a standard plate centrifuge at 4000rpm for 5 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010678209.9A CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010678209.9A CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111778348A true CN111778348A (en) | 2020-10-16 |
| CN111778348B CN111778348B (en) | 2023-05-16 |
Family
ID=72768799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010678209.9A Active CN111778348B (en) | 2020-07-15 | 2020-07-15 | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111778348B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109006456A (en) * | 2018-07-13 | 2018-12-18 | 河北省农林科学院经济作物研究所 | A kind of selection of pimento genic male sterility dual purpose |
-
2020
- 2020-07-15 CN CN202010678209.9A patent/CN111778348B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109006456A (en) * | 2018-07-13 | 2018-12-18 | 河北省农林科学院经济作物研究所 | A kind of selection of pimento genic male sterility dual purpose |
Non-Patent Citations (2)
| Title |
|---|
| NCBI GENBANK: "PREDICTED: Capsicum annuum uncharacterized protein At2g02148 (LOC107870453), transcript variant X1, mRNA NCBI Reference Sequence: XM_016716985.1，1795bp mRNA linear", 《NCBI GENBANK》 * |
| NCBI GENBANK: "PREDICTED: Capsicum annuum uncharacterized protein At2g02148 (LOC107870453), transcript variant X2, mRNA NCBI Reference Sequence: XM_016716987.1，1789 bp mRNA linear", 《NCBI GENBANK》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111778348B (en) | 2023-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108779459B (en) | Cotton whole genome SNP chip and application thereof | |
| CN108060261B (en) | Method for capturing and sequencing corn SNP marker combination and application thereof | |
| CN111961750A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof | |
| Ahmad et al. | Applications of molecular markers in fruit crops for breeding programs--A review. | |
| CN105925721A (en) | Single nucleotide polymorphism marker site, primer and kit for identifying coloring property of peach epidermis and application | |
| CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| EP3045533A1 (en) | Anthracnose resistance-associated marker for plant of genus fragaria, and use thereof | |
| KR101699149B1 (en) | DNA marker for selecting fruit shape of watermelon | |
| CN114032333B (en) | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN111118192B (en) | KASP molecular marker of wheat ear base small ear fruition main effect QTL and application thereof | |
| CN111778348B (en) | Flight mass spectrum molecular marker Cap91 related to sweet pepper nuclear male sterility and application thereof | |
| CN114525360A (en) | SNP marker closely linked with green fruit color Gv1 gene of eggplant and application | |
| CN109207629B (en) | SSR molecular marker BvRE049 for detecting granularity of beet seeds and application thereof | |
| JP5849317B2 (en) | Variety identification marker of vegetative propagation crop | |
| WO2012017679A1 (en) | Stalk-length-related marker of plant of the genus saccharum and the use thereof | |
| CN112725515B (en) | Iris florida ground color SNP molecular marker primer composition and application thereof | |
| CN113151563B (en) | Method, primer pair and kit for identifying watermelon pulp color and application of kit | |
| CN111057786B (en) | SNP marker closely linked with cucumber seed pre-harvest germination resistance character and application thereof | |
| KR102526682B1 (en) | Molecular marker for predicting fruit orientation in pepper and uses thereof | |
| CN111118191B (en) | KASP molecular marker of wheat head top spikelet fructicity main effect QTL and application thereof | |
| CN109161610B (en) | SSR molecular marker BvRE016 for detecting granularity of beet seeds and application thereof | |
| CN105861496A (en) | Molecular marker in close linkage with bitter gourd powdery mildew resistance gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |