CN114032333B - Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof - Google Patents
Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof Download PDFInfo
- Publication number
- CN114032333B CN114032333B CN202111602477.3A CN202111602477A CN114032333B CN 114032333 B CN114032333 B CN 114032333B CN 202111602477 A CN202111602477 A CN 202111602477A CN 114032333 B CN114032333 B CN 114032333B
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- corn
- high temperature
- seq
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of crop molecular biology, and particularly discloses a molecular marker closely linked with a corn high temperature sensitive gene lsht1 and application thereof, wherein molecular markers D65 and C29 are obtained through phenotype analysis and genetic analysis of a corn high temperature sensitive mutant lsht1 and lsht1 gene positioning, the sequence of a primer D65-F for amplifying the molecular marker D65 is shown as SEQ ID NO.11, the sequence of a primer D65-R is shown as SEQ ID NO.12, the sequence of a primer C29-F for amplifying the molecular marker C29 is shown as SEQ ID NO.15, and the sequence of a primer C29-R is shown as SEQ ID NO. 16. The molecular marker D65 and the molecular marker C29 obtained by the invention can be used for identifying high-temperature resistant germplasm resources of corn.
Description
Technical Field
The invention relates to the technical field of crop molecular biology, in particular to a molecular marker closely linked with a corn high temperature sensitive gene lsht1 and application thereof.
Background
Corn is an important grain crop and economic crop in China. In recent years, as the global temperature rises continuously, high temperature heat damage has become one of important natural disasters affecting stable corn yield in China (Wandaka et al, 2017). After the plants are thermally damaged, the corn ears are easy to have abnormal phenomena such as 'lack of grains, malformed ears, bald tips, empty stalks', and the like, so that the corn yield and quality are seriously reduced, and even the corn yield is absolute (Yang and Zhang, 2006). Therefore, the cultivation of the new variety of the high-temperature-resistant corn has very important significance for guaranteeing the safe production of the corn.
Corn is a warm-loving crop and the optimal temperature required in different stages of breeding is different. In general, corn seeds have a minimum germination temperature of 8-10deg.C, with 24deg.C being most desirable. In the jointing period, the normal growth temperature of corn is 18-25 deg.c and 20 deg.c is optimal. The most suitable growth temperature range for flowering phase is 25-28 ℃ (Mitchell and Petolino, 1988). Exceeding the above temperature range can cause high temperature damage to the corn plants. Leaves are the main organs of plant photosynthesis, and high temperature mainly affects the physicochemical properties and structural tissues of thylakoids, resulting in disintegration of cell membranes and degradation of cellular components, thereby affecting leaf photosynthesis efficiency and plant yield.
The application of the high-temperature resistant gene and the closely linked molecular marker can accelerate the breeding process of the new variety with high temperature resistance. At present, part of high temperature stress related genetic loci have been identified in rice. OsTT1 encodes a 26S proteasome alpha 2 subunit involved in the degradation of ubiquitin proteins. Overexpression of OsTT1 can remarkably improve heat resistance of rice, arabidopsis and festuca arundinacea. SLG1 encodes a conserved cytoplasmic tRNA 2-thiolated protein 2, which positively regulates heat tolerance in rice. The mutant SLG1 is sensitive to high temperature, and the over-expression of SLG1 can obviously improve the high temperature tolerance of rice. AET1 encodes a tRNA His Guanylate transferase, which exerts 3 'to 5' RNA polymerase activity on tRNA, is a precursor tRNA His Key step of maturation. AET1 contributes to auxin response and environmental temperature adaptation. However, few reports have been made on maize high temperature stress related genes.
Disclosure of Invention
In order to solve the technical problems, the invention provides a molecular marker closely linked with a corn high temperature sensitive gene lsht1 and application thereof, wherein the molecular marker D65 is positioned on a corn mutant chromosome 2, and the specific position chr2 is as follows: 11047183-11047457, molecular marker C29 is located on chromosome 2 of the maize mutant, and specific position chr2:11390961-11391156, the molecular marker D65 and the molecular marker C29 obtained by the invention can identify the high-temperature resistant germplasm resources of corn.
The invention provides a molecular marker closely linked with a corn high temperature sensitive gene lsht1, wherein the molecular marker comprises a molecular marker D65 and a molecular marker C29, the physical distance between the molecular marker D65 and the molecular marker C29 is 550Kb, and the corn high temperature sensitive gene lsht1 is positioned between the molecular marker D65 and the molecular marker C29 on a corn chromosome 2;
the sequence of the primer D65-F for amplifying the molecular marker D65 is shown as SEQ ID NO.11, and the sequence of the primer D65-R is shown as SEQ ID NO. 12;
the sequence of the primer C29-F for amplifying the molecular marker C29 is shown as SEQ ID NO.15, and the sequence of the primer C29-R is shown as SEQ ID NO. 16.
Further, the molecular marker D65 is located on the 2 nd chromosome of corn, and the specific position chr2 is: 11047183-11047457.
Further, the molecular marker C29 is located on the 2 nd chromosome of corn, and the specific position chr2 is: 11390961-11391156.
The invention also provides primers for identifying the molecular marker D65, wherein the primers are D65-F and D65-R.
The invention also provides application of the primer of the molecular marker D65 in the identification of corn high temperature resistant germplasm resources, wherein the amplification sequence of the molecular marker D65 in a mutant is 275bp, the amplification sequence is shown as SEQ ID NO.22, the amplification sequence of the molecular marker D65 in a wild type is 297bp, and the amplification sequence is shown as SEQ ID NO. 21.
The invention also provides primers for identifying the molecular marker C29, wherein the primers are C29-F and C29-R.
The invention also provides application of the primer of the molecular marker C29 in the identification of corn high temperature resistant germplasm resources, wherein the amplification sequence of the molecular marker C29 in a mutant is 196bp, the amplification sequence is shown as SEQ ID NO.24, the amplification sequence of the molecular marker C29 in a wild type is 203bp, and the amplification sequence is shown as SEQ ID NO. 23.
The invention also provides application of the molecular marker closely linked with the corn high temperature sensitive gene lsht1 in the identification of corn high temperature resistant germplasm resources.
Further, the high temperature resistant germplasm resource identification process of the corn comprises the following steps: extracting genome DNA of corn leaves, taking the genome DNA of the corn leaves as a template, and carrying out PCR amplification by using the primers D65-F and D65-R;
when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is non-high-temperature-resistant corn germplasm.
Further, the high temperature resistant germplasm resource identification process of the corn comprises the following steps: extracting genome DNA of corn leaves, taking the genome DNA of the corn leaves as a template, and carrying out PCR amplification by using the primers C29-F and C29-R;
when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is high-temperature-resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is not high-temperature-resistant corn germplasm.
Compared with the prior art, the invention has the beneficial effects that:
1. the molecular markers D65 and C29 which are closely linked with the corn high temperature sensitive gene lsht1 can be used for identifying corn high temperature resistant germplasm resources, and can lay a foundation for cloning the high temperature sensitive gene.
2. The invention uses the primers D65-F and D65-R of the molecular marker D65 to amplify the genome DNA of the corn leaf, when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is high temperature resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is intolerant corn germplasm;
3. the invention utilizes primers C29-F and C29-R of a molecular marker C29 to amplify corn leaf genome DNA, when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is high-temperature resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is intolerant corn germplasm.
Drawings
In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 shows a maize high temperature sensitive mutant lsht1 phenotyping in an embodiment of the invention;
wherein, the graph A is a Henan summer sowing phenotype, and is a wild type and corn high temperature sensitive mutant lsht1 phenotype in sequence from left to right;
panel B shows a Hainan winter sowing phenotype, and shows a wild type and corn high temperature sensitive mutant lsht1 phenotype in sequence from left to right;
FIG. 2 shows the initial localization result of the maize high temperature sensitive gene lsht1 in the example of the present invention;
FIG. 3 shows the result of fine localization of the maize high temperature sensitive gene lsht1 of the present invention;
FIG. 4 shows the result of PCR electrophoresis of the molecular markers D65 and C29 in the wild type and the high temperature sensitive mutant of the present invention;
wherein, in the graph A, the first lane is Marker, the second lane is wild type, and the third lane is mutant;
panel B shows a C29 molecular Marker band, and in panel B, the first lane is wild type, the second lane is mutant, and the third lane is Marker.
Detailed Description
The following detailed description of specific embodiments of the invention is, but it should be understood that the invention is not limited to specific embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The experimental methods described in the examples of the present invention are conventional methods unless otherwise specified, and materials, reagents, etc. used in the examples described below are commercially available.
Example 1
1. Corn high temperature sensitive mutant lsht1 phenotype analysis and genetic analysis
1. Corn high temperature sensitive mutant lsht1 phenotyping
One maize high temperature sensitive mutant lsht1 (Leaf senescence in high temperature 1) was identified by laboratory preliminary findings, and field phenotype observations found: the mutant is sown in the summer of Henan, plant leaves are all aged in the powder scattering period, and the phenotype of the plant leaves is normal in the winter of Henan, and the result is shown in figure 1.
2. Corn high temperature sensitive mutant lsht1 genetic analysis
Construction of F by crossing mutant lsht1 with inbred line 87-1 1 F is obtained after selfing 2 Isolating the population. F (F) 1 The group has normal performance in both Henan summer sowing and Hainan winter sowing; identification F 2 The segregating population had a summer sowing phenotype in Henan, 1310 strain F 2 In the population, 975 leaves are normal in phenotype, 335 leaves are aged, the phenotype ratio is 3:1 according to chi-square test, the lsht1 mutant high temperature sensitivity character is controlled by a single recessive nuclear gene, and the results are shown in Table 1.
Table 1F 2 Chi-square test for group
Note that: x-shaped articles 2 (0.05)(1) ＝3.84
2. Initial localization of lsht1 gene of corn high temperature sensitive mutant
1、F 2 Construction of a positioning population
The mutant lsht1 is used as a female parent and hybridized with a wild inbred line 87-1 to obtain F 1 ，F 1 Selfing construction F 2 Isolating the population.
2、F 2 Group phenotype identification
2018, F 2 The colony is sown in summer (about 6 months and 10 days) of Yuanyang county in Henan province, and the leaf phenotype of the single plant is respectively identified in the large bell mouth period, the male-pulling period and the powder scattering period.
3. DNA extraction and molecular marker development
Extracting genome DNA of corn leaf by CTAB method, and preserving at-20deg.C for use.
80 pairs of SSR markers and 160 pairs of InDel markers in the interval of 0-20Mb on the 2 nd chromosome of corn are selected from the molecular markers published by a MaizeGDB (http:// www.maizegdb.org /).
4. PCR procedure and amplification product genotyping
The PCR amplification system (10. Mu.L) components contained: 2. Mu.L of DNA, 1. Mu.L of primers (0.5. Mu.L of each of the upstream and downstream primers), 5. Mu.L of 2 XTaq Master Mix (Nanjinozan Biotech Co., ltd.) and 2. Mu.L of ddH 2 O. Using the Touchdown PCR amplification procedure: 95 ℃ for 5min;95 ℃ for 30s,65 ℃ for 30s (1 ℃ drop per cycle), 72 ℃ for 30s, 8 cycles total; 95 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 30s, 28 cycles in total; and at 72℃for 5min. The PCR amplification products were subjected to genotyping by polyacrylamide gel electrophoresis and agarose gel electrophoresis.
5. Initial localization of lsht1 gene of corn high temperature sensitive mutant
Selecting F 2 The mixed pool of 50 wild type and 50 mutant single plant leaf DNA in the isolated population is constructed, a wild type pool and a mutant pool are constructed for BSA sequencing, a remarkable peak is found on chromosome 2, the fact that the maize high temperature sensitive gene lsht1 is located in the range of 0-20Mb of chromosome 2 is indicated, and the result is shown in figure 2.
To verify the BSA sequencing results, 5 pairs of polymorphic molecular markers, 22320, B19, B54, B76, B80, were obtained in total for SSR and InDel molecular markers within the screening interval, and the molecular marker primer information is shown in table 2. Analysis of 200 strains F Using polymorphic molecular markers 2 The group genotype, combined with the single plant leaf phenotype, located the target gene between molecular marker 22320 and B19 on chromosome 2, at a physical distance of 5.54Mb, see FIG. 3 for results.
TABLE 2 molecular marker primer information
3. Fine localization of maize high temperature sensitive mutant lsht1
1. Exchange individual screening
Extraction of F by alkaline cooking 2 Endosperm DNA of 4 ten thousand individual plants in group is marked 22320 with moleculeB80 is a two-end marker screening exchange single plant.
2. Crossover individual phenotype identification
The single plant is exchanged and sown in summer (about 6 months and 10 days) of Yuanyang county in Henan province in 2019, and the leaf phenotype of the single plant is respectively identified in the large bell mouth period, the male pulling period and the powder scattering period.
3. DNA extraction and molecular marker development
Extracting genome DNA of corn leaf by SLS method, and storing in-20deg.C refrigerator.
InDel marker development: 115 pairs of InDel markers between 22320 and B80 were developed and synthesized.
4. PCR procedure and amplification product genotyping
The PCR amplification system (10. Mu.L) components contained: 2. Mu.L of DNA, 1. Mu.L of primers (0.5. Mu.L of each of the upstream and downstream primers), 5. Mu.L of 2 XTaq Master Mix and 2. Mu.L of ddH 2 O. Using the Touchdown PCR amplification procedure: 95 ℃ for 5min;95 ℃ for 30s,65 ℃ for 30s (1 ℃ drop per cycle), 72 ℃ for 30s, 8 cycles total; 95 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 30s, 28 cycles in total; and at 72℃for 5min. The PCR amplification products were genotyped using agarose gel electrophoresis.
5. Fine localization of maize high temperature sensitive mutant lsht1
5 pairs of polymorphic molecular markers D65, C25, C29, D75 and D76 are screened in the initial positioning 5.54Mb interval, and the primer information of the molecular markers is shown in Table 3. The 5 molecular markers are used for analyzing the genotype of the leaf of the single plant exchanged in 2019, and the target gene is positioned between the 2 nd chromosome molecular marker D65 and the C29 in combination with the phenotype of the leaf of the single plant, wherein the physical distance is 550Kb, and the result is shown in figure 3. The molecular marker D65 is positioned on a corn chromosome 2, and the specific position chr2 is: 11047183-11047457 (Zm-B73-REFERENCE-NAM-5.0), molecular marker C29 is located on maize chromosome 2, specific position chr2:11390961-11391156 (Zm-B73-REFERENCE-NAM-5.0).
The size of the amplified sequence of D65 in the wild type is 297bp, the amplified sequence is shown as SEQ ID NO.21, the size of the amplified sequence of D65 in the mutant is 275bp, and the amplified sequence is shown as SEQ ID NO. 22; the size of the C29 amplified sequence in the wild type is 203bp, the amplified sequence is shown as SEQ ID NO.23, the size of the C29 amplified sequence in the mutant is 196bp, and the amplified sequence is shown as SEQ ID NO. 24; as shown in FIG. 4, FIG. A shows the D65 molecular Marker band pattern, and in FIG. A, the first lane is Marker, the second lane is wild type, and the third lane is mutant; panel B shows a C29 molecular Marker band, and in panel B, the first lane is wild type, the second lane is mutant, and the third lane is Marker.
SEQ ID NO.21：
ACGCACCTCTTCAGAAGGAAAAGGGAAAGCACACACACAAGCACACGCAAAAGAGACAACGTCACATGAAGGTGGTGGACTCAAACAGTCAAACTATTGGGTTCACGTGTTCGTCGGTGACCAATGACCATGACCACCGGGTTCACGGAACACCTTGCAGCTGCGGCCTACCAGCAGCCTAGCGATTGGTCTAGCACATAGACCAGTGCATGCGCACGGGCCTGGCATGTAAGCCGGTGGTGGCGTGGTGCTGATTTAGCTTTTCTGCAGCGAAGCAAAAGGAAGGAAGGAACACGG；
SEQ ID NO.22：
ACGCACCTCTTCAGAAGGAAAAGGGAAAGCACACACACAAAAGAGACAACGTCACATGAAGGTGGTGGACTCAAACAGTCGAACTATATTGGGTTCACGTGTTCGTCGGTGACCATGACCACCGGATTCACGGAACATCTTGCAGCTTCGGCCTACCAGCAGCCTAGCGATTGGTCTAGCACATAGACCAGTGCATGCGCACGAGCCTGGCATGTAAGCCGGTGGTGCTGATTTAGCTTTTCTGCAGCGAAGCAAAAAGGAAGGAAGGAACACGG；
SEQ ID NO.23：
CGATAGAAAAAGGAAGTCCACGATTTTCAAATGCTGTTTTATGCTTTAAGATAAGCATTTTTTAGCTCACTTAAGTCGTGTCACGTTGCCTAACTCAATGTACCTTTTTCTACTCTAAGATAGAACAACGAAGAACGGGTCATATCGTGGAGGGATGGGGGTGGGGGGTTAACACTTAAGTCAATCAAAAACAGAACCGAACA；
SEQ ID NO.24：
CGATAGAAAAAGGAAGTCCACGATTTTCAAATGCTGTTTTATGCTTTAAGATAAGCATTTTTTTAGCTCACTTAAGTCGTGTCACGTTGCCTAACTCAATGTACCCTTTTCTACTCTAAGATAGAACAACGAAGAACGAGTCATATCGTCGAGGGGTGGGGGAGGGGGTTAAGTCAATCAAAAACAGAACCGAACA。
TABLE 3 molecular marker primer information
4. Application of molecular markers D65 and C29 obtained by the invention in screening of corn high-temperature resistant germplasm resources
The method for identifying the high temperature resistance of the corn comprises the following steps:
(1) Extracting genome DNA of corn leaves;
(2) Taking corn leaf genome DNA as a template, and respectively carrying out PCR amplification by using the primers D65-F/D65-R, C29-F/C29-R;
(3) Agarose gel electrophoresis identification PCR amplification results: when the adopted primer is D65-F/D65-R, when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is intolerant corn germplasm; when the adopted primer is C29-F/C29-R, the detected sample is high temperature resistant corn germplasm when the size of the molecular marker C29 is detected to be 203bp, and the detected sample is not high temperature resistant corn germplasm when the detected size of the molecular marker C29 is detected to be 196 bp.
The PCR amplification system was 10. Mu.L, and contained: 2. Mu.L of DNA, 0.5. Mu.L of forward and reverse primers each, 5. Mu.L of 2 XTaq Master Mix and 2. Mu.L of ddH 2 O。
In the above application, the TouchDown PCR amplification procedure was used: 95 ℃ for 5min;95 ℃ for 30s,65 ℃ for 30s (1 ℃ drop per cycle), 72 ℃ for 30s, 8 cycles total; 95 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 30s, 28 cycles in total; and at 72℃for 5min.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.
Sequence listing
<110> Henan agricultural university
<120> molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Synthesis
<400> 1
cagtcagaat aagctggccc 20
<210> 2
<211> 21
<212> DNA
<213> Synthesis
<400> 2
gctaactgca accagaactg g 21
<210> 3
<211> 20
<212> DNA
<213> Synthesis
<400> 3
actttgttag cgttgggtgg 20
<210> 4
<211> 20
<212> DNA
<213> Synthesis
<400> 4
ggtcctctgt ccgccatata 20
<210> 5
<211> 20
<212> DNA
<213> Synthesis
<400> 5
acatgctaga tgctccgctt 20
<210> 6
<211> 20
<212> DNA
<213> Synthesis
<400> 6
tcggcagagc tctttgaact 20
<210> 7
<211> 20
<212> DNA
<213> Synthesis
<400> 7
gcaattccca cggtaaggta 20
<210> 8
<211> 20
<212> DNA
<213> Synthesis
<400> 8
catctggacc acaaatgtcg 20
<210> 9
<211> 20
<212> DNA
<213> Synthesis
<400> 9
catgcaattg acgtaggcag 20
<210> 10
<211> 20
<212> DNA
<213> Synthesis
<400> 10
aaatggcatc caacttcagc 20
<210> 11
<211> 20
<212> DNA
<213> Synthesis
<400> 11
acgcacctct tcagaaggaa 20
<210> 12
<211> 20
<212> DNA
<213> Synthesis
<400> 12
ccgtgttcct tccttccttt 20
<210> 13
<211> 20
<212> DNA
<213> Synthesis
<400> 13
ttgcccagct cataatgatg 20
<210> 14
<211> 20
<212> DNA
<213> Synthesis
<400> 14
aagcctatac atgcatggcc 20
<210> 15
<211> 22
<212> DNA
<213> Synthesis
<400> 15
cgatagaaaa aggaagtcca cg 22
<210> 16
<211> 22
<212> DNA
<213> Synthesis
<400> 16
tgttcggttc tgtttttgat tg 22
<210> 17
<211> 20
<212> DNA
<213> Synthesis
<400> 17
accatgctgt acaaaagggc 20
<210> 18
<211> 20
<212> DNA
<213> Synthesis
<400> 18
ttgaagatgc tgatgctgct 20
<210> 19
<211> 20
<212> DNA
<213> Synthesis
<400> 19
accatgctgt acaaaagggc 20
<210> 20
<211> 20
<212> DNA
<213> Synthesis
<400> 20
agtgcaccgg tggatattgt 20
<210> 21
<211> 297
<212> DNA
<213> Synthesis
<400> 21
acgcacctct tcagaaggaa aagggaaagc acacacacaa gcacacgcaa aagagacaac 60
gtcacatgaa ggtggtggac tcaaacagtc aaactattgg gttcacgtgt tcgtcggtga 120
ccaatgacca tgaccaccgg gttcacggaa caccttgcag ctgcggccta ccagcagcct 180
agcgattggt ctagcacata gaccagtgca tgcgcacggg cctggcatgt aagccggtgg 240
tggcgtggtg ctgatttagc ttttctgcag cgaagcaaaa ggaaggaagg aacacgg 297
<210> 22
<211> 275
<212> DNA
<213> Synthesis
<400> 22
acgcacctct tcagaaggaa aagggaaagc acacacacaa aagagacaac gtcacatgaa 60
ggtggtggac tcaaacagtc gaactatatt gggttcacgt gttcgtcggt gaccatgacc 120
accggattca cggaacatct tgcagcttcg gcctaccagc agcctagcga ttggtctagc 180
acatagacca gtgcatgcgc acgagcctgg catgtaagcc ggtggtgctg atttagcttt 240
tctgcagcga agcaaaaagg aaggaaggaa cacgg 275
<210> 23
<211> 203
<212> DNA
<213> Synthesis
<400> 23
cgatagaaaa aggaagtcca cgattttcaa atgctgtttt atgctttaag ataagcattt 60
tttagctcac ttaagtcgtg tcacgttgcc taactcaatg tacctttttc tactctaaga 120
tagaacaacg aagaacgggt catatcgtgg agggatgggg gtggggggtt aacacttaag 180
tcaatcaaaa acagaaccga aca 203
<210> 24
<211> 196
<212> DNA
<213> Synthesis
<400> 24
cgatagaaaa aggaagtcca cgattttcaa atgctgtttt atgctttaag ataagcattt 60
ttttagctca cttaagtcgt gtcacgttgc ctaactcaat gtaccctttt ctactctaag 120
atagaacaac gaagaacgag tcatatcgtc gaggggtggg ggagggggtt aagtcaatca 180
aaaacagaac cgaaca 196
Claims (10)
1. The molecular marker is closely linked with a corn high temperature sensitive gene lsht1, and is characterized in that the molecular marker comprises a molecular marker D65 and a molecular marker C29, the physical distance between the molecular marker D65 and the molecular marker C29 is 550Kb, and the corn high temperature sensitive gene lsht1 is positioned between the molecular marker D65 and the molecular marker C29 on a corn chromosome 2; the nucleotide sequence of the molecular marker D65 is shown as SEQ ID NO.21 or SEQ ID NO.22, and the nucleotide sequence of the molecular marker C29 is shown as SEQ ID NO.23 or SEQ ID NO. 24;
the sequence of the primer D65-F for amplifying the molecular marker D65 is shown as SEQ ID NO.11, and the sequence of the primer D65-R is shown as SEQ ID NO. 12;
the sequence of the primer C29-F for amplifying the molecular marker C29 is shown as SEQ ID NO.15, and the sequence of the primer C29-R is shown as SEQ ID NO. 16.
2. The molecular marker closely linked to the maize high temperature sensitive gene lsht1 according to claim 1, wherein the molecular marker D65 is located on chromosome 2 of maize at position chr2:11047183-11047457 the REFERENCE genome version number is Zm-B73-REFERENCE-NAM-5.0.
3. The molecular marker closely linked to the maize high temperature sensitive gene lsht1 according to claim 1, wherein the molecular marker C29 is located on maize chromosome 2, at position chr2:11390961-11391156 the REFERENCE genome version number is Zm-B73-REFERENCE-NAM-5.0.
4. The primer for identifying the molecular marker D65 according to claim 1, wherein the primer is D65-F and D65-R, the sequence of the D65-F is shown as SEQ ID NO.11, and the sequence of the D65-R is shown as SEQ ID NO. 12.
5. The application of the primer for identifying the molecular marker D65 in the identification of the corn high temperature resistant germplasm resources as claimed in claim 4, wherein the amplification sequence size of the molecular marker D65 in the high temperature sensitive mutant is 275bp, the amplification sequence is shown as SEQ ID NO.22, the amplification sequence size of the molecular marker D65 in the wild type is 297bp, and the amplification sequence is shown as SEQ ID NO. 21.
6. The primer for identifying the molecular marker C29 as claimed in claim 1, wherein the primer is C29-F and C29-R, the sequence of the C29-F is shown as SEQ ID NO.15, and the sequence of the C29-R is shown as SEQ ID NO. 16.
7. The application of the primer for identifying the molecular marker C29 in the identification of the corn high temperature resistant germplasm resources as claimed in claim 6, wherein the amplified sequence of the molecular marker C29 in the high temperature sensitive mutant is 196bp, the amplified sequence is shown as SEQ ID NO.24, the amplified sequence of the molecular marker C29 in the wild type is 203bp, and the amplified sequence is shown as SEQ ID NO. 23.
8. The use of a molecular marker closely linked to the maize high temperature sensitive gene lsht1 as claimed in claim 1 for the identification of maize high temperature resistant germplasm resources.
9. The use of a molecular marker closely linked to a corn high temperature sensitive gene lsht1 in the identification of corn high temperature resistant germplasm resources according to claim 8, wherein the identification process of corn high temperature resistant germplasm resources is as follows: extracting genome DNA of corn leaves, taking the genome DNA of the corn leaves as a template, and carrying out PCR amplification by using the primer D65-F/D65-R;
when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is non-high-temperature-resistant corn germplasm.
10. The use of a molecular marker closely linked to a corn high temperature sensitive gene lsht1 in the identification of corn high temperature resistant germplasm resources according to claim 8, wherein the identification process of corn high temperature resistant germplasm resources is as follows: extracting corn leaf genome DNA, taking corn leaf genome DNA as a template, and carrying out PCR amplification by using the primer C29-F/C29-R;
when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is high-temperature-resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is not high-temperature-resistant corn germplasm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111602477.3A CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111602477.3A CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114032333A CN114032333A (en) | 2022-02-11 |
| CN114032333B true CN114032333B (en) | 2023-07-18 |
Family
ID=80141165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111602477.3A Active CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114032333B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786563B (en) * | 2022-08-19 | 2024-05-07 | 华中农业大学 | Molecular marker closely linked with corn high-temperature response character, amplification primer and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| WO2016050092A1 (en) * | 2014-09-30 | 2016-04-07 | 中国科学院上海生命科学研究院 | New rice high temperature resistance gene and use in crop breeding resistance to high temperature thereof |
| CN107177665A (en) * | 2016-03-09 | 2017-09-19 | 中国科学院上海生命科学研究院 | Function linked marker 0707-1 and its application in corn germplasm improvement |
| CN107400702A (en) * | 2016-05-19 | 2017-11-28 | 东北农业大学 | Chain molecular labeling and application with corn seed keeping quality main effect QTL qSVI-7-2 and qSVI-10 |
| CN113046462A (en) * | 2021-04-07 | 2021-06-29 | 河南农业大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of corn ear length, primer and application |
-
2021
- 2021-12-24 CN CN202111602477.3A patent/CN114032333B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| WO2016050092A1 (en) * | 2014-09-30 | 2016-04-07 | 中国科学院上海生命科学研究院 | New rice high temperature resistance gene and use in crop breeding resistance to high temperature thereof |
| CN107177665A (en) * | 2016-03-09 | 2017-09-19 | 中国科学院上海生命科学研究院 | Function linked marker 0707-1 and its application in corn germplasm improvement |
| CN107400702A (en) * | 2016-05-19 | 2017-11-28 | 东北农业大学 | Chain molecular labeling and application with corn seed keeping quality main effect QTL qSVI-7-2 and qSVI-10 |
| CN113046462A (en) * | 2021-04-07 | 2021-06-29 | 河南农业大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of corn ear length, primer and application |
Non-Patent Citations (2)
| Title |
|---|
| "Molecular markers (RFLPs and HSPs) for the genetic dissection of thermotolerance in maize";E. Ottaviano et al.;《Theor Appl Genet》;第81卷;第713-719页 * |
| "玉米耐高温相关性状的遗传研究";王仕伟;《中国硕士学位论文全文数据库》(第5期);第1-72页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114032333A (en) | 2022-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| US10356992B2 (en) | Maize plants with improved disease resistance | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| WO2013060136A1 (en) | Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel | |
| EP3978613A1 (en) | Parthenogenetic haploid induction gene dmp and application thereof | |
| US20220304266A1 (en) | Maize plants with improved disease resistance | |
| CN107988420B (en) | Molecular marker of maize male nuclear sterility gene ms39 and application thereof | |
| Kumar et al. | Advances in lentil genomics | |
| JP5050189B2 (en) | Processed food varieties judgment method | |
| CN114032333B (en) | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof | |
| Cheng et al. | Identification and characterization of quantitative trait loci for shattering in japonica Rice landrace Jiucaiqing from Taihu Lake Valley, China | |
| JP2011120597A (en) | Method for selecting genomic dna fragment | |
| JP2009060874A (en) | Gene associated with low-temperature germination of rice and utilization thereof | |
| CN113862387B (en) | Molecular marker of rice drought tolerance regulatory gene OsNAC6 and application thereof | |
| WO2007020983A1 (en) | Wheat breeding method using genetic map of diploid wheat created by utilizing barley est sequence | |
| CN105950598B (en) | Rice dormancy-breaking related protein and coding gene and application thereof | |
| CN105986019A (en) | Identifying and utilizing method of rice wide-compatibility recessive male nuclear sterile line | |
| CN112575101A (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| Kinoshita et al. | Development of genome-wide PCR-based markers from insertion, deletion and single nucleotide polymorphisms for closely related Japanese rice cultivars and identification of QTLs for the appearance of cooked rice and polished rice | |
| Pan et al. | cDNA-AFLP profiling for the fiber development stage of secondary cell wall synthesis and transcriptome mapping in cotton | |
| US11647709B1 (en) | Maize plants with improved disease resistance | |
| CN113817754B (en) | Rice short-grain gene SHG1 and application thereof | |
| ZHAO et al. | Differential gene expression between hybrids and their parents during the four crucial stages of cotton growth and development | |
| CN117821632A (en) | Molecular marker closely linked with maize male fertility gene PIA1 and application | |
| CN118028309A (en) | Application of functional molecular marker ZmAD-401 of maize disease-resistant gene ZmAD in maize disease-resistant breeding and method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |