CN114032333A - Molecular marker closely linked with corn high-temperature sensitive gene lsht1 and application thereof - Google Patents
Molecular marker closely linked with corn high-temperature sensitive gene lsht1 and application thereof Download PDFInfo
- Publication number
- CN114032333A CN114032333A CN202111602477.3A CN202111602477A CN114032333A CN 114032333 A CN114032333 A CN 114032333A CN 202111602477 A CN202111602477 A CN 202111602477A CN 114032333 A CN114032333 A CN 114032333A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- corn
- lsht1
- maize
- temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of crop molecular biology, and particularly discloses a molecular marker closely linked with a corn high-temperature sensitive gene lsht1 and application thereof, wherein the molecular markers D65 and C29 are obtained through phenotype analysis and genetic analysis of a corn high-temperature sensitive mutant lsht1 and gene location of lsht1, the sequence of a primer D65-F of an amplified molecular marker D65 is shown as SEQ ID No.11, the sequence of D65-R is shown as SEQ ID No.12, the sequence of a primer C29-F of the amplified molecular marker C29 is shown as SEQ ID No.15, and the sequence of C29-R is shown as SEQ ID No. 16. The molecular marker D65 and the molecular marker C29 obtained by the invention can be used for identifying high-temperature-resistant germplasm resources of corn.
Description
Technical Field
The invention relates to the technical field of crop molecular biology, in particular to a molecular marker closely linked with a corn high-temperature sensitive gene lsht1 and application thereof.
Background
Corn is an important food crop and economic crop in China. In recent years, with the rising of global air temperature, high temperature thermal injury has become one of important natural disasters affecting the stable yield of corn in China (Wandaka et al, 2017). After the plants are thermally damaged at high temperature, abnormal phenomena such as' grain lack, deformed ears, bald tips, empty stalks and the like easily occur to corn ears, so that the yield and the quality of the corn are seriously reduced, and even the corn is produced absolutely (Yang and Zhang, 2006). Therefore, the cultivation of new high-temperature-resistant corn varieties has very important significance for guaranteeing the safe production of the corn.
Corn is a temperature-favored crop and requires different optimum temperatures at different growth stages. Generally, the minimum germination temperature of the corn seeds is 8-10 ℃, and 24 ℃ is most suitable. In the jointing stage, the temperature range of the normal growth of the corn is 18-25 ℃, and the temperature of 20 ℃ is the optimum growth temperature. During the flowering phase, the optimum growth temperature range is 25-28 deg.C (Mitchell and Petolino, 1988). Above the above temperature range, high temperature heat damage to the corn plants is caused. The leaves are the main organs of plant photosynthesis, and high temperature mainly affects the physicochemical properties and structural tissues of thylakoids, resulting in the disintegration of cell membranes and the degradation of cell components, thereby affecting the photosynthetic efficiency of the leaves and the yield of plants.
The application of the high temperature resistant gene and the closely linked molecular marker thereof can accelerate the process of breeding new high temperature resistant varieties. At present, part of high temperature stress related genetic loci have been identified in rice. OsTT1 encodes a 26S proteasome alpha 2 subunit involved in ubiquitination protein degradation. The overexpression of OsTT1 can obviously improve the heat resistance of rice, arabidopsis thaliana and festuca arundinacea. SLG1 encodes a conserved cytoplasmic tRNA 2-thiolated protein 2, positively regulating rice thermotolerance. The mutant SLG1 is sensitive to high temperature, and the overexpression SLG1 can obviously improve the high temperature tolerance of rice. AET1 encodes a tRNAHisGuanosine transferase, exerting 3 'to 5' RNA polymerase activity on tRNA, is a precursor tRNAHisKey steps of maturation. AET1 contributes to auxin response and ambient temperature adaptation. However, there are few reports on maize high temperature stress-related genes.
Disclosure of Invention
In order to solve the technical problems, the invention provides a molecular marker closely linked with a corn high temperature sensitive gene lsht1 and application thereof, wherein the molecular marker D65 is located on the 2 nd chromosome of a corn mutant, specifically at the chr 2: 11047183-11047457, molecular marker C29 is located on chromosome 2 of maize mutant, at specific position chr 2: 11390961-11391156, the molecular marker D65 and the molecular marker C29 obtained by the invention can identify the high-temperature resistant germplasm resources of the corn.
The invention provides a molecular marker closely linked with a corn high-temperature sensitive gene lsht1, wherein the molecular marker comprises a molecular marker D65 and a molecular marker C29, the physical distance between the molecular marker D65 and the molecular marker C29 is 550Kb, and the corn high-temperature sensitive gene lsht1 is positioned between the molecular marker D65 and the molecular marker C29 on a2 nd chromosome of corn;
the sequence of a primer D65-F for amplifying the molecular marker D65 is shown as SEQ ID NO.11, and the sequence of D65-R is shown as SEQ ID NO. 12;
the sequence of a primer C29-F for amplifying the molecular marker C29 is shown as SEQ ID NO.15, and the sequence of C29-R is shown as SEQ ID NO. 16.
Further, the molecular marker D65 is located on the maize chromosome 2, specifically at position chr 2: 11047183-11047457.
Further, the molecular marker C29 is located on the maize chromosome 2, specifically at position chr 2: 11390961-11391156.
The invention also provides a primer for identifying the molecular marker D65, wherein the primer is D65-F and D65-R.
The invention also provides application of the primer of the molecular marker D65 in identification of high-temperature resistant germplasm resources of corn, wherein the amplification sequence size of the molecular marker D65 in a mutant is 275bp, the amplification sequence is shown as SEQ ID No.22, the amplification sequence size of the molecular marker D65 in a wild type is 297bp, and the amplification sequence is shown as SEQ ID No. 21.
The invention also provides a primer for identifying the molecular marker C29, wherein the primer is C29-F and C29-R.
The invention also provides application of the primer of the molecular marker C29 in identification of high-temperature resistant germplasm resources of corn, wherein the amplification sequence size of the molecular marker C29 in a mutant is 196bp, the amplification sequence is shown as SEQ ID NO.24, the amplification sequence size of the molecular marker C29 in a wild type is 203bp, and the amplification sequence is shown as SEQ ID NO. 23.
The invention also provides application of the molecular marker closely linked with the high-temperature sensitive gene lsht1 of the corn in the identification of the high-temperature resistant germplasm resources of the corn.
Further, the identification process of the high-temperature resistant germplasm resources of the corn comprises the following steps: extracting corn leaf genome DNA, and performing PCR amplification by using the primers D65-F and D65-R by using the corn leaf genome DNA as a template;
when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is the non-high-temperature-resistant corn germplasm.
Further, the identification process of the high-temperature resistant germplasm resources of the corn comprises the following steps: extracting corn leaf genome DNA, and performing PCR amplification by using the primers C29-F and C29-R by using the corn leaf genome DNA as a template;
when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is the non-high-temperature-resistant corn germplasm.
Compared with the prior art, the invention has the beneficial effects that:
1. the molecular markers D65 and C29 which are tightly linked with the high-temperature sensitive gene lsht1 of the corn and are obtained by the invention can be used for identifying the high-temperature resistant germplasm resources of the corn and simultaneously lay a foundation for cloning the high-temperature sensitive gene.
2. The method comprises the steps of amplifying the genome DNA of the maize leaf by using primers D65-F and D65-R of a molecular marker D65, wherein when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is high-temperature-resistant maize germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is non-high-temperature-resistant maize germplasm;
3. the invention utilizes primers C29-F and C29-R of a molecular marker C29 to amplify the genome DNA of the corn leaf, when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is the high-temperature resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is the non-high-temperature resistant corn germplasm.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 shows phenotypic analysis of high temperature sensitive corn mutant lsht1 in the example of the present invention;
wherein, the graph A is a Henan summer sowing phenotype, and the phenotypes of a wild type and a corn high-temperature sensitive mutant lsht1 are sequentially arranged from left to right;
panel B shows the winter sowing phenotype in Hainan, from left to right, the wild type and maize high temperature sensitive mutant lsht1 phenotypes;
FIG. 2 shows the initial positioning result of the maize hyperthermostable gene lsht1 in the embodiment of the present invention;
FIG. 3 shows the fine positioning result of the maize hyperthermostable gene lsht1 of the present invention;
FIG. 4 shows the results of PCR electrophoresis of the markers D65 and C29 in the wild type and the thermostable mutant of the present invention;
wherein, the graph A is a D65 molecular Marker band type, and in the graph A, a first lane is Marker, a second lane is wild type, and a third lane is mutant type;
panel B shows the C29 molecular Marker band pattern, wherein the first lane is wild type, the second lane is mutant, and the third lane is Marker.
Detailed Description
The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. The experimental methods described in the examples of the present invention are all conventional methods unless otherwise specified, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
Phenotypic analysis and genetic analysis of maize high-temperature sensitive mutant lsht1
1. Phenotypic analysis of maize high-temperature sensitive mutant lsht1
A corn high-temperature sensitive mutant lsht1(Leaf senescence in high temperature 1) is identified in the early laboratory, and the field phenotype observation shows that: the mutant is sowed in summer in Henan, the leaves of the plant are all aged in the powder scattering period, and the phenotype of the leaves of the mutant sowed in winter in Hainan is normal, and the result is shown in figure 1.
2. Genetic analysis of maize high-temperature sensitive mutant lsht1
F is constructed by hybridizing the mutant lsht1 with the inbred line 87-11Selfing to obtain F2Isolating the population. F1The group shows normal leaf blade in summer sowing in Henan and winter sowing in Hainan; identification F2Isolate in the Henan summer-sown phenotype, strain 1310F2In the population, 975 leaves have normal phenotype, 335 leaves have aging, and the karst test shows that the phenotype ratio accords with 3:1, which shows that the lsht1 mutant high-temperature sensitive character is controlled by a single recessive nuclear gene, and the result is shown in Table 1.
TABLE 1F2Chi-square test of populations
Note: chi shape2 (0.05)(1)＝3.84
Secondly, primary positioning of maize high-temperature sensitive mutant lsht1 gene
1、F2Construction of location populations
Taking the mutant lsht1 as a female parent, hybridizing with a wild type inbred line 87-1 to obtain F1，F1Construction of F by Re-selfing2Isolating the population.
2、F2Population phenotype identification
2018, F2The group is sown in summer (about 6 months and 10 days) in Yuanyang county in Henan province, and the phenotype of the leaf blade of the single plant is identified in a large-horn period, a male-drawing period and a pollen-scattering period respectively.
3. DNA extraction and molecular marker development
The CTAB method is used for extracting the genome DNA of the corn leaf, and the corn leaf is stored at the temperature of minus 20 ℃ for standby.
From the molecular markers published in the MazeGDB (http:// www.maizegdb.org /) database, 80 pairs of SSR markers and 160 pairs of InDel markers within the 0-20Mb interval on chromosome 2 of maize were selected.
4. PCR procedure and genotype analysis of amplification products
The PCR amplification system (10. mu.L) components contained: mu.L of DNA, 1. mu.L of primers (0.5. mu.L of each of the upstream and downstream primers), 5. mu.L of 2 XTAQA Master Mix (Nanjing Novodazan Biotech Co., Ltd.) and 2. mu.L of ddH2And O. Using Touchdown PCR amplification program: 5min at 95 ℃; 30s at 95 ℃, 30s at 65 ℃ (1 ℃ drop per cycle), 30s at 72 ℃ for 8 cycles; 30s at 95 ℃, 30s at 58 ℃ and 30s at 72 ℃ for 28 cycles; 5min at 72 ℃. And (3) carrying out genotype analysis on the PCR amplification product by utilizing polyacrylamide gel electrophoresis and agarose gel electrophoresis.
5. Primary localization of maize high-temperature sensitive mutant lsht1 gene
Selecting F250 wild type and 50 mutant single plant leaf DNA mixed pools in the segregating population are constructed, a wild type pool and a mutant pool are constructed for BSA sequencing, and a remarkable peak is found on the 2 nd chromosome, which indicates that the maize high temperature sensitive gene lsht1 is located in the 0-20Mb interval of the 2 nd chromosome, and the result is shown in figure 2.
In order to verify the sequencing result of BSA, SSR and InDel molecular markers in the interval are screened, 5 pairs of polymorphic molecular markers are obtained, wherein the polymorphic molecular markers are 22320, B19, B54, B76 and B80 respectively, and the molecular marker primer information is shown in Table 2. Analysis of 200 strains F Using polymorphic molecular markers2Population genotype, combined with the individual leaf phenotype, mapped the gene of interest between molecular marker 22320 and B19 on chromosome 2 at a physical distance of 5.54Mb, and the results are shown in FIG. 3.
TABLE 2 molecular marker primer information
Thirdly, fine positioning of the maize high-temperature sensitive mutant lsht1
1. Selection of crossover Individual plants
Alkaline cooking process for extracting F2Endosperm DNA of 4 ten thousand individuals in the population was screened for crossover individuals with molecular markers 22320 and B80 as the two end markers.
2. Phenotypic identification of crossover individuals
The individual plants are planted in summer (about 6 months and 10 days) in Yuanyang county in Henan province in 2019, and the phenotype of the individual plant leaves is identified in a large-horn mouth period, a staminate period and a pollen scattering period respectively.
3. DNA extraction and molecular marker development
The genome DNA of the corn leaves is extracted by an SLS method and stored in a refrigerator at the temperature of minus 20 ℃ for later use.
InDel marker development: 115 pairs of InDel tags were developed and synthesized between 22320 and B80.
4. PCR procedure and genotype analysis of amplification products
The PCR amplification system (10. mu.L) components contained: mu.L of DNA, 1. mu.L of primers (0.5. mu.L of each of the upstream and downstream primers), 5. mu.L of 2 XTAQAQA Master Mix and 2. mu.L of ddH2And O. Using Touchdown PCR amplification program: 5min at 95 ℃; 30s at 95 ℃, 30s at 65 ℃ (1 ℃ drop per cycle), 30s at 72 ℃ for 8 cycles; 30s at 95 ℃, 30s at 58 ℃ and 30s at 72 ℃ for 28 cycles; 5min at 72 ℃. The PCR amplification product was subjected to genotype analysis by agarose gel electrophoresis.
5. Fine positioning of maize high-temperature sensitive mutant lsht1
5 pairs of polymorphic molecular markers are screened within the initial positioning 5.54Mb interval, namely D65, C25, C29, D75 and D76, and the molecular marker primer information is shown in Table 3. The 5 molecular markers are used for analyzing the leaf genotype of the cross-over individual plant in 2019, and the target gene is positioned between the 2 nd chromosome molecular marker D65 and C29 by combining the leaf phenotype of the cross-over individual plant, wherein the physical distance is 550Kb, and the result is shown in figure 3. Molecular marker D65 is located on maize chromosome 2, at specific position chr 2: 11047183 one 11047457(Zm-B73-REFERENCE-NAM-5.0), molecular marker C29 is located on the 2 nd chromosome of maize, at specific positions chr 2: 11390961-11391156 (Zm-B73-REFERENCE-NAM-5.0).
The size of the amplification sequence of D65 in the wild type is 297bp, the amplification sequence is shown as SEQ ID NO.21, the size of the amplification sequence of D65 in the mutant is 275bp, and the amplification sequence is shown as SEQ ID NO. 22; the amplification sequence size of C29 in the wild type is 203bp, the amplification sequence is shown as SEQ ID NO.23, the amplification sequence size of C29 in the mutant is 196bp, and the amplification sequence is shown as SEQ ID NO. 24; as shown in FIG. 4, the graph A shows the molecular Marker band type D65, and in the graph A, the first lane is Marker, the second lane is wild type, and the third lane is mutant type; panel B shows the C29 molecular Marker band pattern, wherein the first lane is wild type, the second lane is mutant, and the third lane is Marker.
SEQ ID NO.21：
ACGCACCTCTTCAGAAGGAAAAGGGAAAGCACACACACAAGCACACGCAAAAGAGACAACGTCACATGAAGGTGGTGGACTCAAACAGTCAAACTATTGGGTTCACGTGTTCGTCGGTGACCAATGACCATGACCACCGGGTTCACGGAACACCTTGCAGCTGCGGCCTACCAGCAGCCTAGCGATTGGTCTAGCACATAGACCAGTGCATGCGCACGGGCCTGGCATGTAAGCCGGTGGTGGCGTGGTGCTGATTTAGCTTTTCTGCAGCGAAGCAAAAGGAAGGAAGGAACACGG；
SEQ ID NO.22：
ACGCACCTCTTCAGAAGGAAAAGGGAAAGCACACACACAAAAGAGACAACGTCACATGAAGGTGGTGGACTCAAACAGTCGAACTATATTGGGTTCACGTGTTCGTCGGTGACCATGACCACCGGATTCACGGAACATCTTGCAGCTTCGGCCTACCAGCAGCCTAGCGATTGGTCTAGCACATAGACCAGTGCATGCGCACGAGCCTGGCATGTAAGCCGGTGGTGCTGATTTAGCTTTTCTGCAGCGAAGCAAAAAGGAAGGAAGGAACACGG；
SEQ ID NO.23：
CGATAGAAAAAGGAAGTCCACGATTTTCAAATGCTGTTTTATGCTTTAAGATAAGCATTTTTTAGCTCACTTAAGTCGTGTCACGTTGCCTAACTCAATGTACCTTTTTCTACTCTAAGATAGAACAACGAAGAACGGGTCATATCGTGGAGGGATGGGGGTGGGGGGTTAACACTTAAGTCAATCAAAAACAGAACCGAACA；
SEQ ID NO.24：
CGATAGAAAAAGGAAGTCCACGATTTTCAAATGCTGTTTTATGCTTTAAGATAAGCATTTTTTTAGCTCACTTAAGTCGTGTCACGTTGCCTAACTCAATGTACCCTTTTCTACTCTAAGATAGAACAACGAAGAACGAGTCATATCGTCGAGGGGTGGGGGAGGGGGTTAAGTCAATCAAAAACAGAACCGAACA。
TABLE 3 molecular marker primer information
Fourth, the molecular markers D65 and C29 obtained by the invention are applied to screening of high-temperature resistant germplasm resources of corn
The method for identifying the high-temperature resistance character of the corn comprises the following steps:
(1) extracting the genomic DNA of the corn leaves;
(2) using corn leaf genome DNA as a template, and respectively carrying out PCR amplification by using the primers D65-F/D65-R, C29-F/C29-R;
(3) identifying the PCR amplification result by agarose gel electrophoresis: when the adopted primer is D65-F/D65-R, when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is the non-high-temperature-resistant corn germplasm; when the adopted primer is C29-F/C29-R, when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is the non-high-temperature-resistant corn germplasm.
The PCR amplification system is 10 μ L, and comprises: mu.L of DNA, 0.5. mu.L each of forward and reverse primers, 5. mu.L of 2 XTAQQ Master Mix and 2. mu.L of ddH2 O。
In the above application, Touchdown PCR amplification procedure is used: 5min at 95 ℃; 30s at 95 ℃, 30s at 65 ℃ (1 ℃ drop per cycle), 30s at 72 ℃ for 8 cycles; 30s at 95 ℃, 30s at 58 ℃ and 30s at 72 ℃ for 28 cycles; 5min at 72 ℃.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> Henan university of agriculture
<120> molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 1
cagtcagaat aagctggccc 20
<210> 2
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 2
gctaactgca accagaactg g 21
<210> 3
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 3
actttgttag cgttgggtgg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 4
ggtcctctgt ccgccatata 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 5
acatgctaga tgctccgctt 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 6
tcggcagagc tctttgaact 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 7
gcaattccca cggtaaggta 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 8
catctggacc acaaatgtcg 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 9
catgcaattg acgtaggcag 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 10
aaatggcatc caacttcagc 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 11
acgcacctct tcagaaggaa 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 12
ccgtgttcct tccttccttt 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 13
ttgcccagct cataatgatg 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 14
aagcctatac atgcatggcc 20
<210> 15
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 15
cgatagaaaa aggaagtcca cg 22
<210> 16
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 16
tgttcggttc tgtttttgat tg 22
<210> 17
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 17
accatgctgt acaaaagggc 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 18
ttgaagatgc tgatgctgct 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 19
accatgctgt acaaaagggc 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 20
agtgcaccgg tggatattgt 20
<210> 21
<211> 297
<212> DNA
<213> Artificial Synthesis
<400> 21
acgcacctct tcagaaggaa aagggaaagc acacacacaa gcacacgcaa aagagacaac 60
gtcacatgaa ggtggtggac tcaaacagtc aaactattgg gttcacgtgt tcgtcggtga 120
ccaatgacca tgaccaccgg gttcacggaa caccttgcag ctgcggccta ccagcagcct 180
agcgattggt ctagcacata gaccagtgca tgcgcacggg cctggcatgt aagccggtgg 240
tggcgtggtg ctgatttagc ttttctgcag cgaagcaaaa ggaaggaagg aacacgg 297
<210> 22
<211> 275
<212> DNA
<213> Artificial Synthesis
<400> 22
acgcacctct tcagaaggaa aagggaaagc acacacacaa aagagacaac gtcacatgaa 60
ggtggtggac tcaaacagtc gaactatatt gggttcacgt gttcgtcggt gaccatgacc 120
accggattca cggaacatct tgcagcttcg gcctaccagc agcctagcga ttggtctagc 180
acatagacca gtgcatgcgc acgagcctgg catgtaagcc ggtggtgctg atttagcttt 240
tctgcagcga agcaaaaagg aaggaaggaa cacgg 275
<210> 23
<211> 203
<212> DNA
<213> Artificial Synthesis
<400> 23
cgatagaaaa aggaagtcca cgattttcaa atgctgtttt atgctttaag ataagcattt 60
tttagctcac ttaagtcgtg tcacgttgcc taactcaatg tacctttttc tactctaaga 120
tagaacaacg aagaacgggt catatcgtgg agggatgggg gtggggggtt aacacttaag 180
tcaatcaaaa acagaaccga aca 203
<210> 24
<211> 196
<212> DNA
<213> Artificial Synthesis
<400> 24
cgatagaaaa aggaagtcca cgattttcaa atgctgtttt atgctttaag ataagcattt 60
ttttagctca cttaagtcgt gtcacgttgc ctaactcaat gtaccctttt ctactctaag 120
atagaacaac gaagaacgag tcatatcgtc gaggggtggg ggagggggtt aagtcaatca 180
aaaacagaac cgaaca 196
Claims (10)
1. The molecular marker closely linked with the maize high temperature sensitive gene lsht1 is characterized in that the molecular marker comprises a molecular marker D65 and a molecular marker C29, the physical distance between the molecular marker D65 and the molecular marker C29 is 550Kb, and the maize high temperature sensitive gene lsht1 is positioned between the molecular marker D65 and the molecular marker C29 on the maize 2 nd chromosome;
the sequence of a primer D65-F for amplifying the molecular marker D65 is shown as SEQ ID NO.11, and the sequence of D65-R is shown as SEQ ID NO. 12;
the sequence of a primer C29-F for amplifying the molecular marker C29 is shown as SEQ ID NO.15, and the sequence of C29-R is shown as SEQ ID NO. 16.
2. The molecular marker tightly linked to maize high temperature sensitive gene lsht1 as claimed in claim 1, wherein the molecular marker D65 is located on maize chromosome 2, specifically at position chr 2: 11047183-11047457.
3. The molecular marker tightly linked to maize high temperature sensitive gene lsht1 as claimed in claim 1, wherein the molecular marker C29 is located on maize chromosome 2, specifically at position chr 2: 11390961-11391156.
4. The primer for identifying the molecular marker D65 of claim 1, wherein the primer is D65-F and D65-R.
5. The application of the primers for identifying the molecular marker D65 in the identification of maize high-temperature resistant germplasm resources as claimed in claim 4, wherein the amplification sequence size of the molecular marker D65 in a mutant is 275bp, the amplification sequence is shown as SEQ ID NO.22, the amplification sequence size of the molecular marker D65 in a wild type is 297bp, and the amplification sequence is shown as SEQ ID NO. 21.
6. The primer for identifying the molecular marker C29 of claim 1, wherein the primer is C29-F and C29-R.
7. The application of the primer for identifying the molecular marker C29 in the identification of the high-temperature resistant germplasm resources of corn as claimed in claim 6, wherein the amplification sequence size of the molecular marker C29 in a mutant is 196bp, the amplification sequence is shown as SEQ ID NO.24, the amplification sequence size of the molecular marker C29 in a wild type is 203bp, and the amplification sequence is shown as SEQ ID NO. 23.
8. The use of the molecular marker tightly linked to maize high temperature sensitive gene lsht1 as claimed in claim 1 in the identification of maize high temperature resistant germplasm resources.
9. The application of the molecular marker tightly linked with the maize high-temperature sensitive gene lsht1 in the identification of maize high-temperature resistant germplasm resources, which is characterized in that the identification process of the maize high-temperature resistant germplasm resources is as follows: extracting corn leaf genome DNA, and performing PCR amplification by using the primer D65-F/D65-R by using the corn leaf genome DNA as a template;
when the size of the molecular marker D65 is detected to be 297bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker D65 is detected to be 275bp, the sample to be detected is the non-high-temperature-resistant corn germplasm.
10. The application of the molecular marker tightly linked with the maize high-temperature sensitive gene lsht1 in the identification of maize high-temperature resistant germplasm resources, which is characterized in that the identification process of the maize high-temperature resistant germplasm resources is as follows: extracting corn leaf genome DNA, and performing PCR amplification by using the primer C29-F/C29-R by using the corn leaf genome DNA as a template;
when the size of the molecular marker C29 is detected to be 203bp, the sample to be detected is the high-temperature-resistant corn germplasm, and when the size of the molecular marker C29 is detected to be 196bp, the sample to be detected is the non-high-temperature-resistant corn germplasm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111602477.3A CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111602477.3A CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114032333A true CN114032333A (en) | 2022-02-11 |
| CN114032333B CN114032333B (en) | 2023-07-18 |
Family
ID=80141165
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111602477.3A Active CN114032333B (en) | 2021-12-24 | 2021-12-24 | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114032333B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786563A (en) * | 2022-08-19 | 2023-03-14 | 华中农业大学 | Molecular marker closely linked with high-temperature response character of corn, and amplification primer and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| WO2016050092A1 (en) * | 2014-09-30 | 2016-04-07 | 中国科学院上海生命科学研究院 | New rice high temperature resistance gene and use in crop breeding resistance to high temperature thereof |
| CN107177665A (en) * | 2016-03-09 | 2017-09-19 | 中国科学院上海生命科学研究院 | Function linked marker 0707-1 and its application in corn germplasm improvement |
| CN107400702A (en) * | 2016-05-19 | 2017-11-28 | 东北农业大学 | Chain molecular labeling and application with corn seed keeping quality main effect QTL qSVI-7-2 and qSVI-10 |
| CN113046462A (en) * | 2021-04-07 | 2021-06-29 | 河南农业大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of corn ear length, primer and application |
-
2021
- 2021-12-24 CN CN202111602477.3A patent/CN114032333B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000905A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Identification and characterization of plant genes |
| WO2016050092A1 (en) * | 2014-09-30 | 2016-04-07 | 中国科学院上海生命科学研究院 | New rice high temperature resistance gene and use in crop breeding resistance to high temperature thereof |
| CN107177665A (en) * | 2016-03-09 | 2017-09-19 | 中国科学院上海生命科学研究院 | Function linked marker 0707-1 and its application in corn germplasm improvement |
| CN107400702A (en) * | 2016-05-19 | 2017-11-28 | 东北农业大学 | Chain molecular labeling and application with corn seed keeping quality main effect QTL qSVI-7-2 and qSVI-10 |
| CN113046462A (en) * | 2021-04-07 | 2021-06-29 | 河南农业大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of corn ear length, primer and application |
Non-Patent Citations (2)
| Title |
|---|
| E. OTTAVIANO ET AL.: ""Molecular markers (RFLPs and HSPs) for the genetic dissection of thermotolerance in maize"", 《THEOR APPL GENET》, vol. 81, pages 713 - 719 * |
| 王仕伟: ""玉米耐高温相关性状的遗传研究"", 《中国硕士学位论文全文数据库》, no. 5, pages 1 - 72 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115786563A (en) * | 2022-08-19 | 2023-03-14 | 华中农业大学 | Molecular marker closely linked with high-temperature response character of corn, and amplification primer and application thereof |
| CN115786563B (en) * | 2022-08-19 | 2024-05-07 | 华中农业大学 | Molecular marker closely linked with corn high-temperature response character, amplification primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114032333B (en) | 2023-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| CN107201404B (en) | Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof | |
| CN111197101B (en) | Codominant SSR marker closely linked with tobacco leafy gene mLN and application thereof | |
| WO2013060136A1 (en) | Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel | |
| Kumar et al. | Advances in lentil genomics | |
| CN105695478B (en) | Gene for regulating plant type and yield of plant and application thereof | |
| Smýkal | Pea (Pisum sativum L.) in biology prior and after Mendel’s discovery | |
| CN111153974A (en) | Corn disease-resistant gene and molecular marker and application thereof | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| US8779233B1 (en) | QTL regulating ear productivity traits in maize | |
| CN113005221B (en) | Molecular marker SNP-392 closely linked with muskmelon pedicle-resistance gene CmAL3 and application thereof | |
| CN114032333B (en) | Molecular marker closely linked with corn high temperature sensitive gene lsht1 and application thereof | |
| CN109837295A (en) | A kind of the rice haploid inducing line and its method for creating of gene editing initiative and application | |
| JP5087349B2 (en) | Genes for low-temperature germination of rice and their utilization | |
| CN113862387B (en) | Molecular marker of rice drought tolerance regulatory gene OsNAC6 and application thereof | |
| Schober et al. | Analysis of the (1, 3)-β-D-glucan synthase gene family of barley | |
| CN113122653B (en) | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application | |
| US20100269212A1 (en) | Genetic loci associated with fusarium ear rot (fkr) resistance in maize and generation of improved fkr resistant maize inbred lines | |
| Yun et al. | Early Identification of Putative Zygotic Seedlings in Citrus Crosses between'Morita unshiu'(Citrus. unshiu Marc.) and'Ponkan'(C. reticulata Blanco) Using RAPD and SRAP | |
| CN105986019A (en) | Identifying and utilizing method of rice wide-compatibility recessive male nuclear sterile line | |
| CN115976055B (en) | Corn dwarf gene and molecular marker thereof | |
| CN111808981B (en) | Method for improving corn haploid ear fertility restoration and special primer thereof | |
| CN114717354B (en) | Molecular marker combination, primer set, kit, identification method and application for identifying asparagus super-male plants | |
| JP4298538B2 (en) | Genetic markers linked to loci involved in dormancy and their use | |
| US12002546B2 (en) | Methods of determining sensitivity to photoperiod in cannabis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |