CN1733916A - siRNA for suppressing Stat3 gene expression and its preparation method - Google Patents

Abstract

The invention discloses a siRNA for inhibiting Stat3 gene expression and its preparing process, wherein the siRNA expression plasmid comprises pBS/U6 vector, and DNA fragment coding siRNA for specifically inhibiting Stat3 gene expression. The invention realizes the construction of Stat3 gene specific RNAi by employing DNA mediated RNA disturbance technique.

Description

Suppress siRNA of Stat3 genetic expression and preparation method thereof

Technical field

The present invention relates to a kind of siRNA, the siRNA of particularly a kind of inhibition Stat3 (signal transducer andantivator of transcription signal transduction and transcriptional activators) genetic expression and and preparation method thereof.

Background technology

RNAi (RNA interference) technology is the novel method of a kind of inhibition of gene expression of growing up in recent years, this method is with Unknown Function gene coding region (exon) or promoter region, express by same promotor control in reverse multiple mode, the RNA that transcribes out in the transgenosis individuality can form dsRNA like this, produce RNA and disturb, make the goal gene silence.This phenomenon is found in the organism of different generas such as plant, fungi (fungi), trypanosome (trypanosome), turbellarian worm (planaria), cysticercus (hydra), fruit bat (drosoph ila), nematode (caneno rhabdit is elegans), zebra fish (zeb rafish), mouse body early embryo.

Exogenous or the endogenic dsRNA of RNAi in cell with a kind of RNA enzyme III (RNAaseIII endonuclease)---Dicer combines, be cut into the short chain dsRNA (double-stranded RNA) that has 5 of 3 ' end strand tail and phosphorylation ' end of 21～23nt immediately, be the initial inductor of RNAi, i.e. siRNA (small interference RNA).SiRNA and Dicer form RNA induce reticent mixture (RNA induces silencing comple, RISC).SiRNA discerns the mRNA that target gene is transcribed out as homing sequence according to the base complementrity principle, and guiding RICS is in conjunction with mRNA.SiRNA and mRNA replace in complex body subsequently, and nuclease Dicer suppresses target gene expression specifically with the fragment that mRNA cuts into 2l～23nt.The new dsRNA fragment that produces can form RISC once more, continues degraded mRNA, thereby produces the cascade scale effect.Therefore, each cell only needs several siRNA molecules just can cause intensive RNAi effect.In addition, siRNA can also (RNAdependent RNA polymerase increases under effect RdRp) in a large number, and transports out cell, makes RNAi be diffused into whole machine body and also can go down to posterity at RNA RNA-dependent polysaccharase.

The RNAi technology has been widely used in the research field of gene function, signal transduction pathway method and therapy of tumor at present.

RNAi identification can be as accurate as a Nucleotide, oncogene such as ras, p53 etc. to being formed by the wild-type point mutation can produce sealing effect accurately and effectively, and wild type gene is then unaffected, can be used to block the expression of some mutator gene, perhaps by cancerating that the albumen overexpression causes.RNAi compares with traditional gene therapy method such as gene substitution, antisense strategy, cytokine gene treatment on therapy of tumor, has the characteristics special, efficient, that toxicity is little, therefore can be used to some tumours are treated.The RNAi technology is used to suppress the expression of tumor growth factor, can suppress the tumor growth of animal model, and has been applied to differentiate fast new tumour target.Because tumour is polygene, multi-factor disease, the inhibition of single oncogene often is difficult to reach result of treatment, and the RNAi technology can suppress a plurality of different genes simultaneously, and suppresses effect and do not disturb mutually.

The restraining effect of tumor-related gene also clearly during RNAi tested clones such as human hela cell Hela, non-small cell lung H1299, squamous cell carcinoma of the head and neck C33, osteosarcoma U22OS, mammary cancer MCF27.

The sequence specificity of siRNA is very rigorous, and base mispairing all can significantly weaken the effect of gene silencing between the said target mrna.

Stat (signal transducer and antivators of transcription) signal transduction and transcriptional activators) be a class potential signal transduction and an activating transcription factor that is present in the tenuigenin.Its protein family has 7 members, Stat1,2,3,4,5a, 5b and 6.Stat3 wherein has important effect in propagation, differentiation, survival and the fetal development of cell.The excessive activation of Stat3 signalling channel has destroyed Normocellular propagation, survival activity, can induce the characteristic of some transformant; The Stat3 that crosses expression has regulated control and the apoptosis activity of cell cycle, shows that the activation of Stat3 may be relevant with carcinogenesis, and blocking-up Stat3 signal path is expected to prevent and to treat human tumor.Therefore utilize above-mentioned RNAi technology to block the Stat3 signal path and can prevent and treat human tumor.

Summary of the invention

The siRNA that the purpose of this invention is to provide a kind of Stat3 of inhibition genetic expression.It utilizes the RNAi of the RNA perturbation technique structure Stat3 gene specific of DNA mediation, be used for expressing under the situation that Stat3 in the observation of cell suppressed by specificity and the variation of signal path, for the function from clone research Stat3 provides effective instrument, have broad application prospects with the treatment tumor area relevant with Stat3 in research.

Another object of the present invention provides the preparation method of a kind of siRNA of the Stat3 of inhibition genetic expression.

Above-mentioned purpose of the present invention can realize by following measure.

Design suppresses the double-stranded siRNA fragment of Stat3 genetic expression.Stat3 RNAi implementation sequence and target NCBI website Genbank database mouse Stat3 gene (sequence number is AY299489) position thereof are respectively:

Article one, (site of action 157-174):

5’＞TCACATGCCACGTTGGTG CACCAACGTGGCATGTGACTTTTTT＜3’

Second (site of action 1226-1243):

5’＞AGTTCAAGCACCTGACCC GGGTCAGGTGCTTGAACTCTTTTTT＜3’

Article three, (site of action 1936-1953):

5’＞CAGCTGAACAACATGTCA

TGACATGTTGTTCAGCTGCTTTTTT＜3’

Article four, (site of action 2334-2351): 5 '＞AAGCTGCAGAGACGTGAC

GTCACGTCTCTGCAGCTTCTTTTTT＜3 '

The carrier that the present invention contains III type RNA polymerase eukaryotic promoter is the pBS/U6 carrier.

Wherein the U6 promotor is a kind of III type RNA polymerase eukaryotic promoter, is used to start transcribing of downstream DNA, and its transcription initiation site is a G (guanine), and transcription pausing is a continuous 5-6 T (thymus pyrimidine).Coding region DNA can transcribe out the mRNA with distinguished sequence, the amino acid that this mRNA does not encode and can translate, but in cell, forming a hair fastener type RNA who has ring automatically, this hair fastener type RNA can mediate the degraded that has the mRNA of identical sequence with it.

The inventor endeavours and in antitumor and genetically engineered research, carries out the research of RNAi antiviral therapy with the knowledge and experience of accumulation for many years.By a large amount of research with experimental results show that, utilize the RNAi of the RNA perturbation technique structure Stat3 gene specific of DNA mediation, can be used for expressing under the situation that Stat3 in the observation of cell suppressed by specificity and the variation of signal path, for the present invention provides effective instrument for the function from clone research Stat3, so the present invention is listed in national natural fund project and Chongqing City's population and family planning council the 3rd batch of scientific research fund project in 2004.

The present invention adopts the RNA interference, and (RNA interference RNAi) prevents the Stat3 expression of gene.Mediate the degraded of target mRNA by the external source importing with native gene homologous dsRNA (double-stranded RNA-is a double-stranded RNA), thereby cause the silence of specific gene in the organism.RNA disturbs by the aspects such as treatment that are expressed in gene expression regulation, defect recognition and disease gene of closing specific gene and shows very important use value.

The present invention is directed to embryo Stat3 in period cell growth, survival and differentiation neurodevelopment situation, can be used for mice embryonic, design the recombinant plasmid pBS/U6-Stat3-RNAi that suppresses Stat3 genetic expression at the RNA interference plasmid of mouse Stat3.As homing sequence, discern the mRNA that target gene is transcribed out with siRNA, and guiding RICS is in conjunction with mRNA according to the base complementrity principle.SiRNA and mRNA replace in complex body subsequently, and nuclease Dicer suppresses target gene expression specifically with the fragment that mRNA cuts into 21～23nt.The new dsRNA fragment that produces can form RISC once more, continues degraded mRNA, thereby produces the cascade scale effect, makes the RNA effects of jamming of Stat3 obvious, almost can curb ectogenic Stat3 fully.

Minimizing and then inhibition Stat3 signal path that the RNA perturbation technique that the present invention uses recent development to get up directly reduces the accumulation of Stat3 gene mRNA and directly causes the Stat3 protein content to accumulate from transcriptional level.The present invention uses the Stat3 antisense oligonucleotide relatively, Stat3 dominant negative Protein S tat3 β, the antagonist of Stat3 upstream specific receptors and acceptor neutralizing antibody, perhaps naturally occurring technology and method such as albumen such as SOCS and PIAS inhibition Stat3 signal transduction pathway treatment tumour is more convenient to operate, and effect is more outstanding.

Description of drawings

Fig. 1 cuts for Stat3 gene interference plasmid enzyme and identifies electrophorogram (positive findings and negative control);

Fig. 2 suppresses the expression of Stat3 albumen in the 293T cell for siRNA;

Fig. 3 detects the expression that 4 kinds of Stat3 interference plasmids suppress Stat3 mRNA in the 293T cell for RT-PCR;

Fig. 4 suppresses the dosage effect that Stat3 albumen is expressed for immunostaining experiment siRNA in the 293T cell;

Fig. 5 detects the dosage effect that the Stat3 interference plasmid suppresses Stat3 protein expression in the 293T cell for immunoblot experiment;

Fig. 6 suppresses the Stat3 dosage effect that mRNA expresses in the 293T cell for RT-PCR detects the Stat3 interference plasmid;

Fig. 7 is a siRNA loop-stem structure rough schematic;

Fig. 8 is pBS/U6-Stat3-RNAi (a 2334) plasmid map;

Embodiment

At first synthetic siRNA interference sequence carries out the processing of RNAi carrier again, and the carrier of handling well is connected with the dsRNA that handles well, transforms then, selects positive colony, and the upgrading grain is identified Stat3 gene interference plasmid at last.

We adopt the negative identification method of convenient feasible double digestion in the screening of the positive colony of the interference plasmid that makes up.And we adopt the immuning dyeing method of visual result under the sxemiquantitative RT-PCR, mirror of immune marking experiment, the mRNA detection level of Protein Detection level respectively to the evaluation of this plasmid validity, and have added the comparison of dosage effect.Thereby be clear that and make up the inhibition effect of plasmid the Stat3 gene.

Its concrete grammar is as follows:

One. synthetic siRNA interference sequence:

Synthetic fundamental principle is:

1. from the AUG initiation codon of mRNA, the length of seeking " AGN18TT " (wherein N is any base) structure is the sequence of 22bp;

A) avoid selecting aim sequence in initiator codon or nonsense zone;

B) the GC content of sequence is 30%-60%;

C) because the non-coding region (UTRs) of 5 ' and 3 ' end has abundant modulin structural region, these UTR are conjugated protein or thereby translation initiation complex may influence siRNA endonuclease enzyme complex and influences the effect of siRNA in conjunction with mRNA, when therefore designing not at 5 ' and the 3 ' non-coding region of holding (UTRs);

D) with the sequence and corresponding genome database such as the people that select, mouse, rats etc. compare, and get rid of and other encoding sequence/EST homologous sequence, for example use BLAST;

F) selecting suitable target sequence synthesizes to find the most effective siRNA sequence;

G) 3 or above T or A can not appear on positive-sense strand and antisense strand sequence continuously, otherwise the premature termination that may cause siRNA to transcribe.

H) preferably C or T of interference sequence terminal nucleotide.

I) interference sequence is avoided the first and last end at goal gene as far as possible.

2. be cloned into DNA in the siRNA expression vector and comprise the inverted repeats of two weak points, middlely separate, form hairpin structure, control by the polIII promotor by the ring sequence.Connect the transcription terminator of 5-6 T subsequently again as rna plymerase iii.

3. two complementary oligonucleotide two ends must have restriction enzyme site (this experiment choosing be ApaI and EcoRI).

4. below the restriction enzyme site in promotor downstream, be close to a C, making insertion segment and promotor that the certain space generation to guarantee to transcribe at interval be arranged.First base of siRNA aim sequence must be that G is to guarantee rna polymerase transcribe.If, must not add a G in the upstream that is close to positive-sense strand with the G beginning.

5.siRNA the ring structure in the insertion fragment should be near the central authorities of oligonucleotide.The size of ring can be different with nucleotide sequence, have siRNA and insert segmental clone but the restriction enzyme site that comprises a uniqueness within it then is beneficial to detection.Find that behind the ring that has compared numerous different lengthss and sequence 5 ' TTCAAGAGA3 ' sequence is the most effective, so we adopt this sequence as the ring structure sequence.

Connection interference sequence positive sequence fragment and the pulsating connexon of inverted sequence that interference sequence will obtain after determining, and in order in time to end transcribing of interference sequence, add that at the interference sequence end polyT is as ending son, utilize operable restriction endonuclease in the pBS/U6 multiple clone site, selected ApaI and EcoRI as inserting the site, added suitable and bases these two kinds of restriction endonucleases couplings respectively at the oligonucleotide sequence end.

According to above principle, press the Stat3 full length sequence of mouse among the GenBank, selected four interference sequences.

Oligonucleotide sequence at four couples of expression in vivo siRNA (short hairpin RNA) of Stat3 design is:

157 sites:

Positive-sense strand

5’＞TCACATGCCACGTTGGTG CACCAACGTGGCATGTGACTTTTTTG＜3’；

Antisense strand

5’＞AATTCAAAAAAGTCACATGCCACGTTGGTG CACCAACGTGGCATGTGA＜3’；

1226 sites:

Positive-sense strand

5’＞AGTTCAAGCACCTGACCC

GGGTCAGGTGCTTGAACTCTTTTTTG＜3’；

Antisense strand

5’＞AATTCAAAAAAGAGTTCAAGCACCTGACCC GGGTCAGGTGCTTGAACT＜3’；

1936 sites:

Positive-sense strand

5’＞CAGCTGAACAACATGTCA

TGACATGTTGTTCAGCTGCTTTTTTG＜3’；

Antisense strand

5’＞AATTCAAAAAAGCAGCTGAACAACATGTCA

TGACATGTTGTTCAGCTG＜3’；

2334 sites:

Positive-sense strand

5’＞AAGCTGCAGAGACGTGAC

GTCACGTCTCTGCAGCTTCTTTTTTG＜3’；

Antisense strand

5’＞AATTCAAAAAAGAAGCTGCAGAGACGTGAC

GTCACGTCTCTGCAGCTT＜3’；

Sequence is the ring structure sequence in the square frame.

The processing of interference sequence:

Article 4, interference sequence is synthetic by the living worker in Shanghai, be 2OD amount (2 pipes, the 1OD/ pipe, 1OD=33 μ g), synthetic good every oligonucleotide sense and antisense all are made into the solution that final concentration is 250umol/L, then positive-sense strand and antisense strand are respectively got 100 μ l and mix in twos in 1: 1 ratio, place the beaker that fills water to boil 10 minutes, in the room temperature naturally cooling, make oligonucleotide chain annealing then, just can form corresponding double-stranded DNA.Promptly obtain the insertion segment siRNA in the pBS/U6 carrier.

Can directly the siRNA fragment be added in the integrated enzyme reaction system during operation.This structure can produce siRNA in cell, the siRNA of its expression in vivo as shown in Figure 7.

The processing of two .RNAi carriers

Because the goal gene of U6 promoters driven must start with guanine, and guanine of ApaI restriction endonuclease digestion after product 3 ' terminal residue just, only need 5 ' sticking Bottoming with complementary strand, get final product the interference plasmid of establishing target gene then by the interference sequence of flush end connection insertion target gene, therefore used pBS/U6 carrier is to be that basis insertion U6 promotor and suitable multiple clone site structure form with pBlueScript.Employed pBS/U6 carrier is Sui G et al.A DNA vector-based RNAi technologyto suppress gene expression in mammalian cells.Proc Natl Acad Sci U S A 2002; 99:5515-5520. the carrier of middle record.

The treating processes of RNAi carrier is as follows:

1, get pBS/U6 carrier 2 μ g, spend the night with ApaI restriction endonuclease room temperature digestion, determine enzyme cut complete after, cut the Klenow enzyme again.It is as follows that enzyme is cut system:

Close 20 μ l

2, after DNA reclaims, get an amount of ApaI enzyme and cut processing back pBS/U6, the Klenow enzyme is cut system below setting up:

Close 20 μ l

Room temperature digestion 30 minutes is determined that enzyme cuts entirely to get final product, and reaction system is placed 75 degrees centigrade of water-bath termination reactions, then the reaction system after the heat shock is placed on ice and anneals.

3, directly carrying out solution system DNA recovery or glue reclaims

What solution reclaimed usefulness is NucleoTrap Gel Extraction Kit (buying from BD Biosciences), and the experimental technique that provides according to producer reclaims DNA.

4, will reclaim the back dna fragmentation restriction endonuclease that directly carries out choosing in the downstream and carry out enzyme and cut, this experimental selection EcoRI enzyme, determine that enzyme cuts entirely to get final product that the enzyme system of cutting is:

37 degrees centigrade of water-baths are more than 2 hours

5, enzyme is cut product and is reclaimed purifying through the DNA electrophoresis again

After enzyme cuts, take a morsel earlier and run the DNA electrophoresis after (as 2 μ l) dilute, cut whether fully to judge enzyme.Cut the time or increase enzyme concentration as also not exclusively then prolonging enzyme, as being the feasible step down fully.The enzyme system of cutting is all run 1%DNA glue, and 110V got final product in 20-30 minute.See band under the ultraviolet lamp.Whether correct, whether enzyme cuts entirely if observing stripe size in the gel imaging instrument.Downcut DNA with cutter then and concentrate that piece.Weighing in advance one is managed in clean EP, and weight behind the gel that add to downcut of weighing again obtains the weight of DNA glue.

Then according to the DNA in the common experimental technique recovery gel.

So far the pBS/U6 vehicle treated finishes.

Three. the pBS/U6 carrier of handling well is connected with the dsDNA that handles well

The principle that pBS/U6 carrier after the processing is connected with dsDNA: carrier and dsDNA mass ratio are 1: 20 to 1: 40

Use Takara Biotech DNA Ligation Kit Ver.2 test kit (buying), connect fast more than 30 minutes, make to connect fully from Takara company.

Can 16 degrees centigrade of placements of spending the night.

Four. transform, select positive colony, the upgrading grain:

The placement reaction solution 10 μ l usual methods that connect that spend the night are all transformed.The flat board that will coat after finishing placed 37 degrees centigrade of incubators interior 16-20 hour.Flat board should just be put earlier, treats to be inverted after bacterium liquid is done dull and stereotyped again.Observation flat board after 16-20 hour, seeing has colony growth, owing to being connects product to transform, so bacterium colony is not so good as the many of plasmid conversion production.

Choose mono-clonal, shake bacterium, 37 degrees centigrade, jolting 9-12 hour, is taken out the LB pipe, the extracting plasmid: use the plasmid sample rapid extraction test kit of vast Tyke, Beijing biological gene technology company, the experimental technique that provides according to producer extracts plasmid, and the plasmid map of its plasmid is seen Fig. 8.(is example with the 4th plasmid that sequence construct forms)

The evaluation of five .Stat3 gene interference plasmids:

What we adopted in the screening of the positive colony of the interference plasmid that makes up is the negative identification method of double digestion.The restriction endonuclease of choosing when interference sequence inserts is ApaI and EcoRI, will replace the restriction endonuclease recognition site between the ApaI and EcoRI in the multiple clone site after sequence is inserted, and is respectively XhoI, SalI, HindIII and EcoRV.According to the pBS/U6 plasmid map as can be known, in U6 promotor front three restriction endonuclease recognition sites being arranged, is respectively KpnI, XbaI and BamH I.So choose the restriction endonuclease of a U6 promotor front arbitrarily and can be inserted into the restriction endonuclease that sequence replaces thereafter and carry out double digestion, interference carrier all will be by single endonuclease digestion, obtain the linearizing interference carrier, if and select for use the restriction endonuclease that interference sequence can not replace and the restriction endonuclease of promotor front to carry out double digestion, then should be able to cut out a segment together with U6 promotor and interference sequence, size should be more bigger than U6 promotor.If there is not interference sequence to insert, then enzyme is cut the pBlueScript skeleton about U6 promotor that about 300bp should appear respectively in the result and about 3kb.

With KpnI and EcoRV and KpnI and XhoI.Qualification result as shown in Figure 1.Through repeating screening, we have obtained 4 male interference plasmids.1-marker among Fig. 1; 2, the 3-pBS/U6 empty carrier is through double digestion result (as negative control); 4,5-plasmid pBS/U6-Stat3-RNAi is through result's (positive findings) of double digestion.Wherein the 2nd, 4 twice are KpnI and EcoRV double digestion, and the 3rd, 5 road is KpnI and XhoI double digestion.The restriction endonuclease of choosing when interference sequence inserts is ApaI and EcoRI, will replace the restriction endonuclease recognition site between the ApaI and EcoRI in the multiple clone site after sequence is inserted, and is respectively XhoI, SalI, HindIII and EcoRV.According to the pBS/U6 plasmid map as can be known, in U6 promotor front three restriction endonuclease recognition sites being arranged, is respectively KpnI, XbaI and BamH I.So choose the restriction endonuclease of a U6 promotor front arbitrarily and can be inserted into the restriction endonuclease that sequence replaces thereafter and carry out double digestion, interference carrier all will be by single endonuclease digestion, obtain the linearizing interference carrier, if and select for use the restriction endonuclease that interference sequence can not replace and the restriction endonuclease of promotor front to carry out double digestion, then should be able to cut out a segment together with U6 promotor and interference sequence, size should be more bigger than U6 promotor.If there is not interference sequence to insert, then enzyme is cut the pBlueScript skeleton about U6 promotor that about 300bp should appear respectively in the result and about 3kb.

The evaluation of the validity of six .pBS/U6-Stat3-RNAi plasmids:

1, pBS/U6-Stat3-RNAi suppresses the expression of mouse Stat3 gene protein in the cell specifically

With mStat3-Flag expression plasmid and the 4 kinds of common transfection 293T of pBS/U6-Stat3-RNAi plasmid cells, by the expression of immunoblotting assay Stat3 in the 293T cell, the influence of mouse Stat3 being expressed with the interference plasmid of research and establishment.Referring to Fig. 2.1-Wild Type 293T among Fig. 2; 2-pBS/U6; 3,4,5,6-is followed successively by pBS/U6-Stat3-RNAi-I, II, III, IV.Cotransfection in the cell behind the interference plasmid pBS/U6-Stat3-RNAi Stat3 expressing quantity have to some extent and reduce, the row of going up lane3,4,5,6 and 2 is compared, illustrate that pBS/U6-Stat3-RNAi can suppress the interior Stat3 expression of gene of cell to some extent and then the albumen resultant quantity is descended; Wherein the interference plasmid effect in target 2334-2351 site is best, almost the expression of mouse Stat3 has been dropped to minimum level (on arrange lane6 and lane1 relatively), because contain endogenic people source Stat3 in the 293T cell, and the pBS/U6-Stat3-RNAi interference plasmid is that mouse Stat3 is sequence-specific, can not disturb the expression of people source Stat3, so the interference plasmid in target 2334-2351 site has all been restrained the expression of mouse Stat3 almost.Simultaneously after the common transfection of GFP plasmid, can see that pBS/U6-Stat3-RNAi only suppresses the expression of Stat3, to the proteic expression of EGFP without any influence (down row lane2,3,4,5,6 compare mutually), this shown the proteic expression of the only specific inhibition of Stat3 interference plasmid Stat3 and to other expression of gene without any influence, illustrate that the RNAi of DNA mediation has the specificity of height.The expression amount of middle row p-actin has shown that the applied sample amount of our per pass is consistent substantially.

2, adopt the technology sxemiquantitative ground of RT-PCR to detect the level of mouse Stat3 gene mRNA in the 293T cell, further to define the reason of mouse Stat3 protein expression minimizing in the 293T cell behind the cotransfection interference plasmid.After 36 hours, collect the 293T cell of each group at the transfection plasmid, extract cell total rna, as template, adopt mouse Stat3 gene-specific primer to carry out pcr amplification, simultaneously as the contrast of cell total rna sampling amount, parallel carrying out the amplification of β-actin gene.Referring to Fig. 3.M-marker among Fig. 3; Stat3 group 1-Wild Type 293T; 2-pBS/U6; 3,4,5,6-is followed successively by pBS/U6-Stat3-RNAi-I, II, III, IV; β-actin group-per pass applied sample amount unanimity.Cotransfection interference plasmid mouse Stat3 gene mRNA in the 293T cell expression amount obviously than cotransfection the experimental group of empty carrier plasmid reduced (lane3,4,5,6 and 2 relatively), especially the interference plasmid effect in target 2334-2351 site is best, and this is consistent with immune marking result of experiment; In addition, although the existence of people source Stat3 gene is arranged in the used wild-type 293T cell total rna template in first road,, bring so can not amplify any because designed primer is a mouse Stat3 gene specific.Same, following row β-actin band shows that the sampling amount of the total RNA when RT-PCR increases is a basically identical.

3, pBS/U6-Stat3-RNAi suppresses the dosage effect of Stat3 genetic expression in the cell

(1) immunostaining (Immunostairnning) can be observed the restraining effect of pBS/U6-Stat3-RNAi to Stat3 genetic expression more intuitively.Select the interference plasmid in the best target 2334-2351 site of effect further to detect to the restraining effect of mouse Stat3 gene in the 293T cell.Transfection simultaneously the interference plasmid of different amounts observe this restraining effect and whether have dosage effect.Referring to Fig. 4.The left side one row among Fig. 4 (a, d, g, j, m p) has shown the expression of the GFP of cotransfection; Middle row (b, e, h, k, n q) has shown the result of immunostaining Stat3 genetic expression; The right one row (c, f, i, l, o r) is the result of left-hand column and middle column Merge.Gold-tinted has been represented the situation of GFP and Stat3 co expression.Transfection Stat3 interference plasmid is compared with the cell of transfection empty carrier pBS/U6 and GFP specificity interference plasmid, the proteic expression of Stat3 reduces (h and b among Fig. 4 significantly, e compares), and along with the increase of interference plasmid transfection amount, the expression of Stat3 more and more lower (from Fig. 4-h to q), and the expression of GFP is (Fig. 4-g, j, m, p compare with a) that equates with control group almost.Simultaneously, the inhibition GFP expression of gene (Fig. 4-d compares with a) that the GFP interference plasmid also can be efficiently special, and Stat3 albumen is not had without any influence (Fig. 4-e compares with b).Illustrate the interference plasmid of target mouse Stat3 can be specific the expression of inhibition mouse Stat3, and present tangible dosage effect.The immunostaining visual result has shown that constructed pBS/U6-Stat3-RNAi can efficiently and specifically suppress the proteic expression of Stat3 at cell levels.

(2) immunoblot experiment detects the influence of the interference plasmid of various dose to mouse Stat3 expression.Referring to Fig. 5.1-GFPi among Fig. 5; 2-pBS/U6; 3,4,5, the dose effect of 6-pBS/U6-Stat3-RNAi-IV is consistent with the result of immunostaining, increase along with the amount of cotransfection interference plasmid, the expression amount of Stat3 is compared control group and has been reduced, and presents tangible dosage effect (on Fig. 5 row in 6 roads, the 3rd road to the), simultaneously pBS/U6-Stat3-RNAi to EGFP proteic expression do not have any restraining effect (Fig. 5 row in 6 roads, the 3rd road to the and the 2nd channel ratio) down.Cotransfection the expression of cell GFP of GFP interference plasmid be suppressed (Fig. 5 row in the 1st road and the 2nd channel ratio) down, and Stat3 albumen be not affected (the 1st road is compared with the 2nd road in arranging on Fig. 5).Same, the expression amount of middle row β-actin has shown that the applied sample amount of our per pass is consistent substantially.

(3) experimental technique of employing sxemiquantitative RT-PCR, the interference plasmid that further detects various dose is to the mouse Stat3 influence that mRNA expresses in the 293T cell.The Stat3 that the total RNA template of same experimental group RT-PCR is amplified and β-actin gene product equivalent are separately mixed to an off agarose gel electrophoresis, referring to Fig. 6.1-pBS/U6 among Fig. 6; 2-U6-GFPi; 3-U6-Stat3-RNAi-IV (0.5ug); 4-U6-Stat3-RNAi-IV (1.0ug); 5-U6-Stat3-RNAi-IV (2.0ug); 6-U6-Stat3-RNAi-IV (3.0ug).Result with immunostaining and immunoblot experiment is consistent, increase along with the amount of cotransfection interference plasmid, the mRNA expression amount of Stat3 is compared control group and has been reduced, and present tangible dosage effect (6 roads, the 3rd road to the in arranging on Fig. 6), the sampling amount of the total RNA the when band of following row β-actin shows the RT-PCR amplification is a basically identical.

The pBS/U6-Stat3-RNAi plasmid of the present invention's preparation can be used for suppressing the expression of tumor growth factor, the tumor growth that suppresses animal model, and differentiate that new tumour target provides theoretical basis fast for being applied to, can be applied in the clinical experiment and preparation antitumor drug of treatment tumour.

Claims (5)

1. a siRNA who suppresses Stat3 genetic expression is characterized in that comprising the wherein any of following four kinds of siRNA, and their base sequence is as follows:

Article one, (site of action 157-174):

5’＞TCACATGCCACGTTGGTG CACCAACGTGGCAT

GTGACTTTTTT＜3’

Second (site of action 1226-1243):

5’＞AGTTCAAGCACCTGACCC GGGTCAGGTGCTTG

AACTCTTTTTT＜3’

Article three, (site of action 1936-1953):

5’＞CAGCTGAACAACATGTCA TGACATGTTGTTCA

GCTGCTTTTTT＜3’

Article four, (site of action 2334-2351):

5’＞AAGCTGCAGAGACGTGAC

GTCACGTCTCTGCA

GCTTCTTTTTT＜3’。

2. the preparation method of the siRNA of an inhibition Stat3 as claimed in claim 1 genetic expression is characterized in that this siRNA can be by external chemosynthesis and expression in vivo.

3. the preparation method of siRNA according to claim 2 is characterized in that external chemosynthesis may further comprise the steps:

(1) from the AUG initiation codon of mRNA, seek " AGN18TT ", wherein N is any base, and the length of structure is the sequence of 22bp;

(2) 3 or above T or A can not appear on positive-sense strand and antisense strand sequence continuously;

(3) interference sequence is avoided the first and last end at goal gene;

(4) get rid of at initiator codon or nonsense zone selection aim sequence;

(5) selecting GC content is the sequence of 30%-60%;

(6) sequence of selecting is carried out homology relatively in public database.

(7) be cloned into the inverted repeats that DNA in the siRNA expression vector comprises two weak points, middlely separated by the ring sequence, ring structure should connect the transcription terminator of 5-6 T as rna plymerase iii subsequently again near the central authorities of oligonucleotide;

(8) the interference sequence terminal nucleotide is C or T;

(9) two complementary oligonucleotide two ends must have restriction enzyme site;

(10) first base of siRNA aim sequence is G, if not with the G beginning, must add a G. in the upstream that is close to positive-sense strand;

(11) below the restriction enzyme site in promotor downstream, be close to a C, making insertion segment and promotor that the certain space generation to guarantee to transcribe at interval be arranged.

4. the preparation method of siRNA according to claim 2 is characterized in that this siRNA expression plasmid comprises:

The carrier that contains III type RNA polymerase eukaryotic promoter;

The coding specificity suppresses the dna fragmentation of the siRNA of Stat3 genetic expression.

5. the preparation method of siRNA according to claim 4, the carrier that it is characterized in that containing III type RNA polymerase eukaryotic promoter is pBS/U6.

Images