CN1710079A - Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method - Google Patents
Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method Download PDFInfo
- Publication number
- CN1710079A CN1710079A CN 200510066531 CN200510066531A CN1710079A CN 1710079 A CN1710079 A CN 1710079A CN 200510066531 CN200510066531 CN 200510066531 CN 200510066531 A CN200510066531 A CN 200510066531A CN 1710079 A CN1710079 A CN 1710079A
- Authority
- CN
- China
- Prior art keywords
- pcsh1
- shrna
- carrier
- transcription unit
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to one kind of carrier pcCsh1 - n which simultaneously express many kinds of shRNA, which can simultaneously realize the genes's disturbance on one carrier, the carrier pcCsh1 contains the basic plasmid sequence, shcRna copies the unit and more than two groups of clones position spot, and inserts after the target gene shcRna template, the extension dyes the cell either the animal may specially and effectively suppresses two or the many targets genes expression, thus can be conveniently used in this invention of the gene function research and use in the anti- tumor medicine research and the development.
Description
Technical field:
The present invention relates to can be used in the medical technical field of molecular biology expressing simultaneously carrier pcSH 1-n and the construction process thereof of multiple shRNA.
Background technology:
The mRNA molecule that RNA disturbs (RNAi) to be meant that double-stranded RNA (dsRNA) brings out specifically with its homologous sequence is degraded, cause corresponding gene to express repressed phenomenon, be a kind of special PTGS (post-transcriptional gene silence, PTGS) phenomenon.ShRNA is meant the hair fastener type structure when construction expression short rna fragment.Since 1998 find, all obtained challenging achievement aspect mechanism research and the application and development.Its detailed process is the dsRNA that is introduced by modes such as external source or transgenosis, virus infectiones, the mode that in cell, is relied on ATP by RNA enzyme Dicer, be cut into 3 ' long-end of 21-23 Nucleotide the outstanding double-stranded RNA of 2 Nucleotide is arranged, be small molecules interference RNA (smallinterfering RNA, siRNA).SiRNA form with protein binding such as nuclease the reticent mixture of RNA induced gene (RNAs inducedsilencing complex, RISC).RISC is opened into strand with double-stranded siRNA under the effect of ATP, combine with the complimentary positions specificity of the mRNA of expression of target gene, brings out the mRNA degraded, the quantity of the mRNA of target gene is reduced, thereby suppress expression of target gene on rna level.
At present the RNA interferential is used and is mainly concentrated on antiviral, antitumor and to the aspects such as research of gene function.In mammalian cell, because the existence of Interferon, rabbit effect can only be adopted the double-stranded RNA less than 29bp.The method of the dsRNA that the method that obtains siRNA in the experimentation mainly contains chemosynthesis siRNA method, the synthetic siRNA method of in-vitro transcription, shRNA expression vector method, grow with RNaseIII (Dicer) cutting, (siRNA that is obtained by PCR transcribes template to PCR expression cassette method, be dna fragmentation, only contain promotor, siRNA template and termination site) etc. five kinds.
In antiviral, antineoplastic research, chemical synthesis is with its advantage and making progress rapidly conveniently, but its high relatively cost has limited its further popularization.And shRNA expression vector rule is with low cost, also can be effectively in vivo, external realization RNA disturbs, and recent development is also very rapid.
The basic ideas of shRNA expression vector method are as follows: thus intracellular rna plymerase iii can discern that specific promotor is initial transcribes, and when running into 4～6 T of successive, transcribes and will stop.Scientists has designed the plasmid that can express specific short rna thus, and transfection enters cell and can obtain short rna after rna plymerase iii is just transcribed.Nucleotide reverse complemental about 21 of this RNA two ends can form hairpin structure.(short hairpin RNA, shRNA) meeting be sheared and become siRNA the RNA of this hairpin structure very soon, thereby plays the effect of RNA interferential.This method is easy and simple to handle, and cost is low, and siRNA compares with chemosynthesis, and the DNA plasmid is more stable in vivo, and target gene expression is suppressed the efficient height, is convenient to carry out the gene functional research of long period, thereby day by day becomes popular research topic.
ShRNA expression vector method is divided into two kinds of virus vector method and non-virus carrier methods.Although for non-virus carrier, the virus vector consumption is few, the transfection efficiency height, and its security receives much attention always.Non-virus carrier is comparatively safe, and its shortcoming is that transfection efficiency is low, and the carrier consumption is big etc.
Discoveries such as Alan J Bridge, the shRNA expression vector of q.s also can inspire the Interferon, rabbit effect, and when common plasmid such as Bluscript transfection mammalian cell, as long as reach certain consumption, also can cause the Interferon, rabbit effect of cell, especially in experiment in vitro.This down phenomenon limits the consumption of carrier during transfection, often be very restricted when especially needing to suppress two or more gene simultaneously in some test.
Purpose of the present invention, be that a kind of carrier pcSH 1-n that can be used for expressing simultaneously multiple shRNA will be provided, specifically, be in order to overcome the known above-mentioned defective of non-virus carrier, make to have a plurality of shRNA transcription unit on the carrier simultaneously, improve the shRNA interference effect, producing effective special RNA interferential simultaneously, reduce the consumption of carrier, to reduce the nonspecific action that transfection process produces as far as possible.
Summary of the invention:
The invention provides a kind of carrier pcSH 1-n that can be used for expressing simultaneously multiple shRNA (n represents the number of shRNA transcription unit, n=1,2 ..., n).Said carrier pcSH 1-n, its composition comprise the expression vector (Fig. 1) of a plurality of shRNA transcription unit, plasmid basic sequence and multiple clone site.The present invention utilize generally use at present, also be the H1 promotor of one of shRNA expression vector pSilencer H1 3.0 carriers of molecular weight minimum; the H1 promotor is together in series with proper restriction site; and respectively connect a multiple clone site in the front and back of H1 promoter transcription unit; to connect product then is connected to and contains on plasmid basic sequence such as the pUC19 called after pCSH1-n.Carrier pcSH 1-n after structure is finished includes basic plasmid sequence, two or more shRNA transcription unit and two groups of multiple clone site.Two groups of multiple clone site lay respectively at the front and back of shRNA transcription unit, and the combination that utilizes a restriction enzyme site of suitable before and after the transcription unit two restriction enzyme sites such as isocaudarner restriction enzyme site and multiple clone site to carry out can realize that a plurality of shRNA transcription unit is connected on the carrier.This a plurality of shRNA transcription unit can be designed to the same site at a target gene, also can be designed to different loci at a target gene, can also be designed at different target genes, thereby realize the inhibition effective and special one or more target genes.Therefore, the said carrier of the present invention can be used for the siRNA reagent of preparation research gene function or is used for the research and development of siRNA antitumor drug.The construction step of shRNA expression vector pCSH1-n of the present invention is as follows:
1, design restriction enzyme site combination
In order to utilize the characteristic of isocaudarner, realization is connected on a purpose on the carrier with a plurality of shRNA transcription unit, need select a pair of isocaudarner and two groups of multiple clone site of design in shRNA transcription unit both sides, these two groups of multiple clone site and shRNA expression transcription unit, basic plasmid sequence are made up in order, be built into plasmid vector.
2, synthetic two pairs of primers
According to above mentality of designing, need two pairs of primers of synthetic, every pair of corresponding multiple clone site of primer.
3, primer is annealed becomes double-stranded DNA
After these two pairs of primer annealings formed two strands ,-20 ℃ of preservations were standby.
4, each segment is connected
With the basic plasmid sequence of carrier such as pUC19 with utilize suitable before and after the H1 promotor among transcription unit such as the pSilencer H1 3.0 (available from Ambion company) two restriction enzyme sites such as isocaudarner restriction enzyme site, add that the primer that contains two multiple clone site couples together with engineered means.The combination that utilizes a restriction enzyme site of suitable before and after the transcription unit two restriction enzyme sites such as isocaudarner restriction enzyme site and multiple clone site to carry out can realize the series connection of two or more shRNA transcription unit.Sequence verification is inserted pulsating correcting errors then, makes up to form the pCSH1-n expression vector.Carrier pcSH 1-n of the present invention is made up by basic plasmid sequence, two or more shRNA transcription unit and two groups of multiple clone site and forms, and can be implemented on the carrier and expresses multiple shRNA simultaneously.
5, the pCSH1-n carrier is expressed multiple shRNA simultaneously carry out the RNAi effect detection in tumour cell
After carrier pCSH1-1 makes up and to finish, synthesize the shRNA template of two tumor-related genes such as N-Ras and c-Myc, made up the pCSH1-1 carrier that contains single N-Ras or c-Myc shRNA, i.e. pCSH1-shN2 and pCSH1-shMyc respectively.Utilize thinking of the present invention then, or shN2 and shMyc are connected into the pCSH1-shNM carrier of two transcription units, or, constitute the pCSH1-2shN2 expression vector, carry out the RNAi effect detection two shN2 transcription unit series connection.The result shows that the said carrier of the present invention can be expressed two or more shRNA simultaneously.The interference effect of the carrier pCSH1-2shN2 pair cell after the series connection presents enhancing.Show that the shRNA transcription unit that this carrier is applied to connect identical can strengthen the RNA effects of jamming.
The invention effect:
The present invention is a technology platform with the plasmid expression RNA interfering, a kind of new carrier pcSH 1-n and the construction process thereof that can express multiple RNA interfering on a carrier are provided, show through the detection of siRNA growth in vitro restraining effect, mRNA and protein level silence effect detection etc., constructed carrier can realize that the inhibition effect of two different target spots is obvious, and the identical target spot transcription unit that is applied to connect can strengthen the RNA effects of jamming.Compare with single shRNA expression vector such as pSilencer H1 3.0, carrier of the present invention has reduced the usage quantity of plasmid, has reduced the non-special toxicity that produces in the carrier transfered cell process.Therefore, carrier pcSH 1-n has application promise in clinical practice in the therapy of tumor based on the RNA interference.
Description of drawings:
Fig. 1 .pCSH1-n plasmid structural representation,
Wherein: n represents the number of shRNA transcription unit, n=1, and 2 ..., n.
Fig. 2. two placed in-line schemas of shRNA transcription unit,
Wherein: the relative position of Sal I, Xho I and three restriction enzyme sites of Pst I remains unchanged.
Fig. 3 .pCSH1-1 plasmid construction schema,
Wherein: three restriction enzyme sites of Sal I, Xho I and Pst I are to carry out the placed in-line key enzyme of shRNA transcription unit.
Fig. 4 .pCSH1-shN2 reduces the said target mrna level,
Wherein: the Marker:DNA molecular weight standard;
Control: any plasmid group of untransfected;
PsiMock: transfection pCSH1-shMock group;
PsiN2: transfection pCSH1-shN2 group.
Fig. 5 .pCSH1-shN2 reduces the target protein level,
Wherein: Control: any plasmid group of untransfected;
PsiMock: transfection pCSH1-shMock group;
PsiN2: transfection pCSH1-shN2 group.
Fig. 6 .pCSH1-shMyc reduces the said target mrna level,
Wherein: the Marker:DNA molecular weight standard;
Control: any plasmid group of untransfected;
PsiMock: transfection pCSH1-shMock group;
PsiMyc: transfection pCSH1-shMyc group.
Fig. 7 .pCSH1-shMyc reduces the target protein level,
Wherein: Control: any plasmid group of untransfected;
PsiMock: transfection pCSH1-shMock group;
PsiMyc: transfection pCSH1-shMyc group.
The influence that Fig. 8 .pCSH1-2shN2, pCSH1-shN2 grow to the HepG2 cell,
Wherein: Control: any plasmid group of untransfected;
ShMock: transfection pCSH1-shMock group;
2shMock: transfection pCSH1-2shMock group;
ShN2: transfection pCSH1-shN2 group;
2shN2: transfection pCSH1-2shN2 group.
Fig. 9 .pCSH1-shN2, pCSH1-shMyc and pCSH1-shNM reduce the target protein level,
Wherein: Control: any plasmid group of untransfected;
PsiMock: transfection pCSH1-shMock group;
PsiN2: transfection pCSH1-shN2 group;
PsiMyc: transfection pCSH1-shMyc group;
PsiNM: transfection pCSH1-shNM group.
Embodiment:
When emphasizing constructed hair fastener type short interfering rna structure, use shRNA to represent among the specification sheets embodiment of the present invention, when emphasizing the effect of short interfering rna, represent with siRNA.
Following illustrated embodiment is for helping further to understand the present invention, and does not have any restriction.
Embodiment 1: the structure that can express the carrier pcSH 1-n of multiple shRNA simultaneously
To on a carrier, realize the series connection of a plurality of shRNA transcription unit, need utilize the restriction enzyme site that does not have in the shRNA transcription unit of initial carrier, promptly guaranteeing to utilize proper restriction site under the complete situation of transcription unit, so that series connection becomes possibility.The present invention utilizes isocaudarner in the restriction endonuclease can produce that identical sticking end can connect but the principle that no longer is cut open after connecting realizes placed in-line target, comprises isocaudarner but be not limited to selected restriction endonuclease.Sal I and Xho I are a pair of isocaudarners, and the site of Sal I identification is G
TCGAC, the site of Xho I identification is C
TCGAG, the enzyme of the two cut product and all contain identical sticking end
TCGA, can connect with ligase enzyme, connection is finished postorder and is classified G as
TCGAG, this a pair of isocaudarner all can not be identified.According to these characteristics, the present invention has designed a scheme, adds Sal I site before transcription unit, adds Xho I site and Pst I site after transcription unit.The carrier of reincarnate is cut back to close small pieces with SalI+Pst I enzyme, cut back to close big segment with Xho I+Pst I enzyme again, the segment connection of two recovery can be realized the series connection of two shRNA transcription units, and the relative position of these three restriction enzyme sites remains unchanged, and can continue to be used for connecting other shRNA transcription unit (Fig. 2).
The said carrier pcSH 1-n of the present invention is made up by basic plasmid sequence, a n shRNA transcription unit and two multiple clone site and forms, and can be implemented on the carrier and expresses multiple shRNA simultaneously.
One, the design of multiple clone site is with synthetic
Two multiple clone site are carried out the placed in-line thinking design of a plurality of shRNA transcription unit according to the characteristic of isocaudarner, and trust match Parkson company is synthetic, and the annealing back is frozen, difference called after KSEE and HXEP, synthetic
Primer sequence is respectively:
KSEEa：5′-AATT
GGTACCGTCGAC
GATATCG-3′
KSEEas：3′-
CCATGGCAGCTG
CTATAGCTTAA-5′
HXEPa：5′-AGCTT
CTCGAGATAT
CTGC-3′
HXEPas：3′-A
GAGCTCTATA
GACGTCGA-5′
KSEEa and KSEEas can anneal and form two strands, contain Kpn I, Sal I, four restriction enzyme sites of EcoR V, EcoR I on the two strands; HXEPa and HXEPas can form two strands, contain Hind III, Xho I, four restriction enzyme sites of EcoR V, Pst I on the two strands.
Two, primer is annealed becomes double-stranded DNA
Primer adds no RNase water dissolution to 1 μ g/ μ L.Each 2 μ L adds 46 μ LDNA annealing buffer (10mM Tris-HCl pH7.5 with paired primer, 100mM NaCl, 1mM EDTA pH8.0) to cumulative volume 50 μ L, hatched in 1 hour for 95 ℃ 5 minutes, 37 ℃, make primer annealing become double-stranded DNA, called after KSEE and HXEP contain Kpn I, Sal I, four restriction enzyme sites of EcoR V, EcoR I on the KSEE respectively, contain Hind III, Xho I, four restriction enzyme sites of EcoR V, Pst I on the HXEP.Wherein Sal I and Xho I are a pair of isocaudarners.DNA-20 behind the primer annealing ℃ of preservation is standby.
Three, each segment is connected
With engineered means H1 promotor and the HXEP of carrier pUC19, KSEE, pSilencer H1 3.0 (available from Ambion company) coupled together (Fig. 3) called after pCSH1-1.
Four, the detection of shRNA expression vector pCSH1-1 of the present invention
The carrier that builds is entrusted the order-checking of precious biotech firm, primer be M13 ±, two-way sequencing result is all correct, prove that transformation finishes.
Five, the structure of shRNA expression vector pCSH1-n of the present invention (n＞1 o'clock)
Make up the pCSH1-n carrier contain an above shRNA transcription unit if desired, then finish structure according to the method for embodiment 6.
Embodiment 2: use pCSH1-n and realize disturbing at the RNA of tumor-related gene N-Ras
In order to verify whether pCSH1-n can realize disturbing at the RNA of individual gene, need the siRNA target sequence of design at specific gene, link pCSH1-1 and detect the variation of target gene at rna level and protein level.Design is not at the siRNA sequence of any specific gene simultaneously, and promptly the mock sequence is linked the pCSH1-1 carrier and is used as negative control.
One, the selection of siRNA target sequence
N-Ras is a kind of in the Ras protein family, undergos mutation in many tumours, and can cause the constitutive activation of Raf-MAPK approach after the sudden change.The expression of the N-Ras of mutation inhibiting in tumour cell can suppress the propagation of tumour cell effectively, is a popular target spot in the oncotherapy.
The selection of shRNA target sequence at present mainly is to follow the Tushl principle of comparatively generally acknowledging and with reference to some other standard.Carry out the Blast retrieval behind the selected target sequence, make this target sequence and other gene not have higher homology.
Determining behind the target sequence need be according to the shRNA template DNA of the synthetic target sequence of existing rule (see Thijn R.Brummelkamp etc., Science 296,550-553＜2002 〉).The shRNA template DNA comprises justice, two complementary short dnas of antisense strand, and its fundamental unit is: the ring sequence of BamH I site, target sequence positive-sense strand, 9bp, target sequence antisense strand, 6 T, HindIII site always are about 60bp.
The said target mrna sequence of N-Ras-siRNA and few dna primer sequence are as follows:
mRNA?Target(N19)
5’-GUGUGAUUUGCCAACAAGG-3’(SEQ?ID?No1)
Primer sequence is:
Sense：
5′-GATCC
GTGTGATTTGCCAACAAGGTTCAAGAGA
CCTTGTTGGCAAATCA
CACTTTTTTGGAAA-3′(SEQ?ID?No2)
Antisense：
5′-AGCTTTTCCAAAAAA
GTGTGATTTGCCAACAAGGTCTCTTGAA
CCTTGTT
GGCAAATCACACG-3′(SEQ?ID?No3)
The mock-siRNA sequence that adopts in the experiment is:
mRNA?Target(N19)
5’-GGAUAGUACGAGAUUACAC-3’
Primer sequence is:
Sense：
5′-GATCCC
GGATAGTACGAGATTACACTTCAAGAGA
GTGTAATCTCGTACTA
TCCTTTTTTGGAAA-3′
Antisense：
5′-AGCTTTTCCAAAAAA
GGATAGTACGAGATTACACTCTCTTGAA
GTGTAA
TCTCGTACTATCCGG-3′
Line part is dna sequence dna or its complementary sequence of respective target mRNA sequence in the primer, is transcribed into the double-stranded part that can form hairpin structure RNA behind the RNA herein.It is synthetic that primer is delivered to match Parkson company.
Two, with N-Ras be the structure of the interference sequence expression plasmid pCSH1-shN2 of target spot
Primer adds no RNase water dissolution to 1 μ g/ μ L.Each 2 μ L adds 46 μ L DNA annealing buffers with paired primer, and 95 ℃, 5 minutes, 37 ℃, to hatch in 1 hour ,-20 ℃ of preservations are standby.5 ' end of the double-stranded RNA that forms behind the primer annealing has the sticking end of BamH I restriction enzyme site, and 3 ' end has the sticking art end of Hind III restriction enzyme site, can be directly used in connection.
Plasmid pCSH1-1 with restriction endonuclease BamH I and Hind III double digestion, is reclaimed big segment, and-20 ℃ of preservations are standby.
The short double-stranded DNA that forms behind the big segment of plasmid that reclaims and the primer annealing is connected screening, the evaluation of checking order.With N-Ras is the interference sequence expression plasmid called after pCSH1-shN2 of target spot, contrast interference sequence expression plasmid called after pCSH1-shMock, and the contrast interference sequence is analyzed not mRNA at any gene through Blast.
Three, the transfection of interference sequence expression plasmid
The present invention uses LipofectAMINE
TM2000 liposomes (Life Technologies, product article No.: 11668-027) carry out transfection, carried out reticent effect measuring after the transfection in 24-48 hour.
Four, RT-PCR detects the gene silencing effect of interference sequence expression plasmid
Behind the cell transfecting 24 hours, with TRIzol (Ivitrogen, product article No.: 15596-026) extract total RNA, and measure concentration and the quality of RNA with ultraviolet spectrophotometer (BECKMAN DU800).(Invitrogen Cat.No.10928-34) detects the mRNA level to adopt the RT-PCR test kit.With GAPDH is that interior mark carries out RT-PCR, after reaction is finished product is carried out agarose electrophoresis, takes a picture and analytical results with the gel imaging instrument.The result shows that pCSH1-shN2 can effectively reduce the level of N-Ras gene mRNA, and pCSH1-shMock is to the not influence (Fig. 4) of level of N-Ras gene mRNA.
Five, Western Blotting detects the influence of interference sequence expression plasmid to the target protein level
Behind the cell transfecting 36 hours, 10% SDS-PAGE, the small-sized vertical electrophoresis groove of Bole (Bio-RadMini-PROTEAN 3) gel electrophoresis separates each albumen, and half-dried commentaries on classics film instrument (Amersham Biosciences, Hoefer TE 70) forwards albumen on the pvdf membrane to.The film that has changeed is dipped in and contains 5% (w/v) skim-milk TBS (10mM Tris HCl, pH 7.5,150mM NaCl) room temperature jolting sealing is spent the night in the solution, TBS room temperature rinse 5 times, each 5 minutes, the hybridization bag of packing into, with the TBS solution dilution first antibody that contains 1%BSA, the room temperature jolting was hatched 3 hours, TBS room temperature rinse 5 times, each 5 minutes.Pack in the new hybridization bag, resist (horseradish peroxidase-labeled sheep anti mouse two is anti-) incubated at room 3 hours, TBS room temperature rinse 5 times, each 5 minutes with two.Drip chemiluminescence intensifier (Santa Cruz Biotechnology sc-2048) on the film, operate, catch image by chemoluminescence imaging system ChemiImager5500 (Alpha Innotech.) according to the reagent explanation.The Dilution ratio of antibody is as follows, mouse monoclonal N-RAS antibody (Santa Cruz product, sc-31) 1/150 dilution, mouse monoclonal PCNA antibody (Oncogene Product, NA-03) 1/500 dilution, horseradish peroxidase-labeled sheep anti-mouse antibody (ZB-2305) 1/3000 dilution.The result shows that pCSH1-shN2 can suppress the expression of corresponding protein in the HepG2 cell, and through pCSH1-shMock the N-RAS protein level is not influenced (Fig. 5).Contrast as last sample with PCNA (Proliferating cell nuclear antigen) albumen simultaneously.
Embodiment 3: use pCSH1-n and realize disturbing at the RNA of tumor-related gene c-Myc
Disturb when verifying whether pCSH1-n can realize two genes, the present invention has designed the siRNA template at tumor-related gene c-Myc again.C-Myc is a kind of in the Myc protein family, is a transcription factor, has participated in growth, differentiation and the apoptosis of cell.C-myc takes place to develop relevant with kinds of tumors.C-Myc helps the development of cancer cells, is playing the part of critical role in the morbid state development of malignant tumour.C-Myc is an important target of oncotherapy at present.
Determining behind the target sequence need be according to the shRNA template DNA with the synthetic target sequence of method of embodiment 2.
Said target mrna sequence and the few dna sequence dna of c-Myc-siRNA are as follows:
mRNA?Target(N19)
5’-GGAAGAAAUUCGAGCUGCU-3’(SEQ?ID?No4)
Primer sequence is:
Sense：
5′-GATCCC
GGAAGAAATTCGAGCTGCTTTCAAGAGA
AGCAGCTCGAATTTC
TTCCTTTTTTGGAAA-3′(SEQ?ID?No5)
Antisense：
5′-AGCTTTTCCAAAAAA
GGAAGAAATTCGAGCTGCTTCTCTTGAA
AGCAGC
TCGAATTTCTTCCGG-3′(SEQ?ID?No6)
Line part is dna sequence dna or its complementary sequence of respective target mRNA sequence in the primer, is transcribed into the double-stranded part that can form hairpin structure RNA behind the RNA herein.It is synthetic that primer is delivered to match Parkson company.The mock-siRNA sequence that adopts in the experiment is with embodiment 2.
According to finish with c-Myc with the method for embodiment 2 be the structure of interference sequence expression plasmid pCSH1-shMyc of target spot after, plasmid transfection HepG2 cell, and it is carried out RT-PCR and WesternBlotting detect, the result shows, pCSH1-shN2 can effectively reduce the level of c-Myc gene mRNA, and pCSH1-shMock is to the not influence (Fig. 6) of level of c-Myc gene mRNA.Mouse monoclonal c-Myc antibody (Santa Cruz product during Western Blotting detects, sc-31) 1/150 dilution, pCSH1-shMyc can suppress the expression of corresponding protein in the HepG2 cell, and through pCSH1-shMock the c-Myc protein level is not influenced (Fig. 7).(Santa Cruz product is sc-1616) as last sample contrast with actin simultaneously.
Embodiment 4: use pCSH1-n and realize connecting at the shRNA transcription unit in the same site of tumor-related gene N-Ras
In order to verify whether meaningful pCSH1-n connects to same shRNA transcription unit, the present invention has made up the placed in-line carrier pCSH1-2shN2 at the shRNA transcription unit in the same site of tumor-related gene N-Ras, and checks the influence of its cell growth with the growth curve method.
One, the structure of pCSH1-2shN2
PCSH1-shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut back to close big segment with Xho I+Pst I enzyme again, the segment of two recovery connects, transform, screening just can obtain containing two identical placed in-line carriers of shRNA transcription unit, called after pCSH1-2shN2.Make up two identical placed in-line carriers of shRNA transcription unit of Mock simultaneously, called after pCSH1-2shMock.
Two, the influence of pCSH1-2shN2 cell growth
PCSH1-shN2, pCSH1-2shN2, pCSH1-shMock and pCSH1-2shMock transfection HepG 2 cell after 24 hours, are taped against cell in 24 orifice plates with 3000 cells in every hole continuous counter 6 days.The inhibition of the pCSH1-2shN2 cell growth of equal in quality obviously is better than pCSH1-shN2, and the inhibition of the pCSH1-2shMock cell growth of equal in quality is better than pCSH1-shMock (Fig. 8) slightly.The usage quantity that pCSH1-n connects and can increase the RNA interference effect or reduce plasmid when guaranteeing identical interference effect at the shRNA transcription unit in same site is described.
Embodiment 5: use the series connection of pCSH1-n realization at the shRNA transcription unit of tumor-related gene N-Ras and the different target genes of c-Myc
In order to verify whether pCSH1-n can realize the series connection at the shRNA transcription unit of different target genes, the present invention has made up will be at the placed in-line carrier pCSH1-shNM of shRNA transcription unit of tumor-related gene N-Ras and the different target genes of c-Myc, and detect the variation of these two genes simultaneously at rna level and protein level, see whether they can reduce simultaneously.
One, the structure of pCSH1-shNM
PCSH1-shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut pCSH1-shMyc with Xho I+Pst I enzyme again and reclaim big segment, the segment of two recovery connects, transform, screening just can obtain containing two placed in-line carriers of shRNA transcription unit, called after pCSH1-shNM.
Two, the effect detection of pCSH1-shNM
With pCSH1-shMock, pCSH1-shN2 and pCSH1-shNM transfection HepG 2 cell after 48 hours, Western Blotting detects the influence of plasmid to the target protein level, and pCSH1-shNM can effectively suppress the protein expression level (Fig. 9) that N-Ras can effectively suppress c-Myc again.Illustrate that pCSH1-n can realize two genes are disturbed simultaneously, do not have obvious restraining effect between two shRNA transcription units.
Embodiment 6:Use pCSH1-n and realize the series connection of a plurality of shRNA transcription units
In order to verify whether pCSH1-n can realize the series connection at a plurality of shRNA transcription unit, we have made up and have contained 3 placed in-line carriers of shRNA transcription unit, 4 placed in-line carriers of shRNA transcription unit, 5 placed in-line carriers of shRNA transcription unit, 6 placed in-line carriers of shRNA transcription unit.These are connected on-individual year intravital shRNA transcription unit and can be the same or different.
One, the structure of pCSH1-3shN2
PCSH1-shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut pCSH1-2shN2 with Xho I+Pst I enzyme again and reclaim big segment, the segment of two recovery connects, transform, screening just can obtain containing 3 placed in-line carriers of shRNA transcription unit, called after pCSH1-3shN2.
Two, the structure of pCSH1-4shN2
PCSH1-2shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut pCSH1-2shN2 with Xho I+Pst I enzyme again and reclaim big segment, the segment of two recovery connects, transform, screening just can obtain containing 4 placed in-line carriers of shRNA transcription unit, called after pCSH1-4shN2.
Three, the structure of pCSH1-5shN2
PCSH1-2shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut pCSH1-3shN2 with Xho I+Pst I enzyme again and reclaim big segment, the segment of two recovery connects, transform, screening just can obtain containing 5 placed in-line carriers of shRNA transcription unit, called after pCSH1-5shN2.
Four, the structure of pCSH1-6shN2
PCSH1-3shN2 is cut back to close small pieces with Sal I+Pst I enzyme, cut pCSH1-3shN2 with Xho I+Pst I enzyme again and reclaim big segment, the segment of two recovery connects, transform, screening just can obtain containing 6 placed in-line carriers of shRNA transcription unit, called after pCSH1-6shN2.
Claims (7)
1, a kind of plasmid vector pCSH1-n that can express multiple shRNA simultaneously is characterized in that said carrier pcSH 1-n is made up of basic plasmid sequence, a plurality of shRNA transcription unit and two groups of multiple clone site.A plurality of shRNA transcription unit can be used for repeatedly expressing a target gene, or expresses a plurality of different loci of a target gene, can also express different target genes, thereby realizes the inhibition effective and special to one or more target genes.
2. the plasmid vector pCSH1-n of the multiple shRNA of expression as claimed in claim 1 is characterized in that can being built into two sections RNA interference sequences at therapy of tumor target spot N-Ras and/or c-Myc by series connection in the shRNA expression vector.
3, carrier pcSH 1-n as claimed in claim 1 or 2 is characterized in that the RNA interference sequence of therapy of tumor target spot N-Ras is:
5′-GATCC
TTCAAGAGA
TTTTTTGGAAA-3′(SEQ?ID?No2)
5′-AGCTTTTCCAAAAAA
TCTCTTGAA
G-3′(SEQ?ID?No3)
Wherein the said target mrna sequence of N-Ras-siRNA is:
5’-GUGUGAUUUGCCAACAAGG-3’(SEQ?ID?No?1)。
4, carrier pcSH 1-n as claimed in claim 1 or 2 is characterized in that the interference sequence of therapy of tumor target spot c-Myc is:
5′-GATCCC
TTCAAGAGA
TTTTTTGGAAA-3′(SEQ?ID?No5)
5′-AGCTTTTCCAAAAAA
TCTCTTGAA
GG-3′(SEQ?ID?No6)
Wherein the said target mrna sequence of c-Myc-siRNA is:
5’-GGAAGAAAUUCGAGCUGCU-3’(SEQ?ID?No4)。
5, a kind of structure method of carrier pcSH 1-n according to claim 1, it is characterized in that selecting a pair of isocaudarner restriction enzyme site in shRNA transcription unit both sides, synthetic and annealing obtains to contain the sequence of two groups of multiple clone site by design of primers, make contain two groups of multiple clone site sequences and shRNA transcription unit, basic plasmid sequence makes up in order; Utilize a restriction enzyme site of isocaudarner restriction enzyme site before and after the transcription unit and multiple clone site to carry out the combination of a plurality of shRNA transcription unit, can a plurality of shRNA plasmid vector of construction expression pCSH1-n.
6, the application of shRNA expression vector pCSH1-n in preparation therapy of tumor medicine according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100665311A CN1307311C (en) | 2005-04-27 | 2005-04-27 | Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100665311A CN1307311C (en) | 2005-04-27 | 2005-04-27 | Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1710079A true CN1710079A (en) | 2005-12-21 |
| CN1307311C CN1307311C (en) | 2007-03-28 |
Family
ID=35706369
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100665311A Expired - Fee Related CN1307311C (en) | 2005-04-27 | 2005-04-27 | Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1307311C (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010025584A1 (en) * | 2008-09-04 | 2010-03-11 | Wang Lei | Dna molecule for expressing haripin rna, the constructing method and the use thereof |
| CN101139615B (en) * | 2007-08-06 | 2011-10-19 | 湖北大学 | Method for quickly and highly effectively constructing mammal cell RNA interference carrier and its checking carrier |
| CN102433352A (en) * | 2011-11-16 | 2012-05-02 | 中国科学技术大学 | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1276976C (en) * | 2003-10-30 | 2006-09-27 | 封江南 | Unique vector coded hair pin structure small interference RNA expression system and its establishing method |
-
2005
- 2005-04-27 CN CNB2005100665311A patent/CN1307311C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101139615B (en) * | 2007-08-06 | 2011-10-19 | 湖北大学 | Method for quickly and highly effectively constructing mammal cell RNA interference carrier and its checking carrier |
| WO2010025584A1 (en) * | 2008-09-04 | 2010-03-11 | Wang Lei | Dna molecule for expressing haripin rna, the constructing method and the use thereof |
| CN102144031A (en) * | 2008-09-04 | 2011-08-03 | 中国农业科学院生物技术研究所 | DNA molecule for expressing hairpin RNA, the constructing method and the use thereof |
| CN102144031B (en) * | 2008-09-04 | 2013-07-17 | 中国农业科学院生物技术研究所 | DNA molecule for expressing hairpin RNA, the constructing method and the use thereof |
| CN102433352A (en) * | 2011-11-16 | 2012-05-02 | 中国科学技术大学 | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1307311C (en) | 2007-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luo et al. | Drosophila tsRNAs preferentially suppress general translation machinery via antisense pairing and participate in cellular starvation response | |
| Zhao et al. | The IncRNA SNHG5/miR‐32 axis regulates gastric cancer cell proliferation and migration by targeting KLF4 | |
| Juanchich et al. | Characterization of an extensive rainbow trout miRNA transcriptome by next generation sequencing | |
| Zhang et al. | MicroRNA-145 inhibits the growth, invasion, metastasis and angiogenesis of neuroblastoma cells through targeting hypoxia-inducible factor 2 alpha | |
| Gu et al. | MicroRNA-493 suppresses tumor growth, invasion and metastasis of lung cancer by regulating E2F1 | |
| US9388466B2 (en) | Precursor miRNA loop-modulated target regulation | |
| US20090004668A1 (en) | Pre-miRNA loop-modulated target regulation | |
| Søkilde et al. | Passenger strand loading in overexpression experiments using microRNA mimics | |
| CN107177598B (en) | Oligonucleotide molecule for inhibiting mRNA expression of BIRC5 target gene and its composition set | |
| Sun et al. | Long noncoding RNA LINC00963 induces NOP2 expression by sponging tumor suppressor miR-542-3p to promote metastasis in prostate cancer | |
| Parolia et al. | The long noncoding RNA HORAS 5 mediates castration‐resistant prostate cancer survival by activating the androgen receptor transcriptional program | |
| Dittmann et al. | New roles for nuclear EGFR in regulating the stability and translation of mRNAs associated with VEGF signaling | |
| Shkurnikov et al. | LAMA4-regulating miR-4274 and its host gene SORCS2 play a role in IGFBP6-dependent effects on phenotype of basal-like breast cancer | |
| Wang et al. | MicroRNA‑133b targets TGFβ receptor I to inhibit TGF‑β‑induced epithelial‑to‑mesenchymal transition and metastasis by suppressing the TGF‑β/SMAD pathway in breast cancer Corrigendum in/10.3892/ijo. 2023.5531 | |
| Orafidiya et al. | Crosstalk between long non coding RNAs, microRNAs and DNA damage repair in prostate cancer: new therapeutic opportunities? | |
| Chen et al. | Biological functions and clinical significance of tRNA-derived small fragment (tsRNA) in tumors: Current state and future perspectives | |
| CN1710079A (en) | Carrier pcSH1-n capable of concurrently expressing multiple shRNA and its constructing method | |
| CN1733916A (en) | siRNA for suppressing Stat3 gene expression and its preparation method | |
| CN104031916B (en) | New RNAi precursors and its preparation and application | |
| US20110034535A1 (en) | Positive controls for expression modulating experiments | |
| Jia et al. | Pseudogene AK4P1 promotes pancreatic ductal adenocarcinoma progression through relieving miR-375-mediated YAP1 degradation | |
| St Laurent et al. | Insights from the HuR-interacting transcriptome: ncRNAs, ubiquitin pathways, and patterns of secondary structure dependent RNA interactions | |
| Xu et al. | Circular RNA circ‐TNRC6B inhibits the proliferation and invasion of esophageal squamous cell carcinoma cells by regulating the miR‐452‐5p/DAG1 axis | |
| US20170002349A1 (en) | Small rna, preparation method therefor and application thereof in pharmaceuticals for specifically up-regulating gene transcriptional activity | |
| Zenke et al. | Establishing an effective gene knockdown system using cultured cells of the model fish medaka (Oryzias latipes) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Jiangsu Huililong Plastic Industry Group Co., Ltd. Assignor: Biomedical Technology Inst., Chinese Academy of Medical Sciences Contract fulfillment period: 2009.2.10 to 2019.2.10 contract change Contract record no.: 2009320000450 Denomination of invention: Vector shRNA capable of simultaneously expressing multiple pCSH1-n and construction method thereof Granted publication date: 20070328 License type: exclusive license Record date: 2009.3.19 |
|
| LIC | Patent licence contract for exploitation submitted for record |
Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2009.2.10 TO 2019.2.10; CHANGE OF CONTRACT Name of requester: JIANGSU HUILILONG PLASTIC INDUSTRY GROUP CO.,LTD. Effective date: 20090319 |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20070328 Termination date: 20120427 |