CN1712418A - Production of low-molecular heparin - Google Patents

Production of low-molecular heparin Download PDF

Info

Publication number
CN1712418A
CN1712418A CN 200510088970 CN200510088970A CN1712418A CN 1712418 A CN1712418 A CN 1712418A CN 200510088970 CN200510088970 CN 200510088970 CN 200510088970 A CN200510088970 A CN 200510088970A CN 1712418 A CN1712418 A CN 1712418A
Authority
CN
China
Prior art keywords
heparin
molecular weight
lys
heparinase
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 200510088970
Other languages
Chinese (zh)
Other versions
CN100344769C (en
Inventor
邢新会
况莹
陈银
罗明芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to CNB2005100889702A priority Critical patent/CN100344769C/en
Publication of CN1712418A publication Critical patent/CN1712418A/en
Application granted granted Critical
Publication of CN100344769C publication Critical patent/CN100344769C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

Production of low-molecular weight heparin is carried out by using heparin as substrate , degrading heparin from malt sugar combined protein-heparinase I fusion protein, which is amino acid residual sequence protein with SEQ ID No:1, and obtaining low-molecular weight heparin. It achieves controllable degradation time, ideal average molecular weight and higher enzyme activity.

Description

A kind of method for preparing low molecular weight heparin
Technical field
The present invention relates to a kind of method for preparing low molecular weight heparin, particularly a kind of method of utilizing Heparinase I fusion rotein MBP-HepA to prepare low molecular weight heparin.
Background technology
Heparin is the mucopolysaccharide that is alternately formed with 1 → 4 glycosidic link by hexuronic acid (L-iduronic acid, D-glucuronic acid) and D-Glucosamine Sulphate, linear chain-like structure with six sugar or eight sugared repeating units, its molecular weight is between 3000-37000, and molecular-weight average is 15000.Since 1916 found heparin first, its application as anti-freezing reagent and anti-bolt reagent aspect medical more and more was subjected to people's attention.In addition, heparin also have anti-inflammatory, antianaphylaxis, antiviral, anticancer, transfer various biological function such as blood fat.But, because heparin has anticoagulating active, thus use heparin to cause bleeding in a large number and side effect such as induced platelet minimizing, thus limited heparin application clinically greatly.
Low molecular weight heparin (low-molecular-weight heparin oligose) (being called for short LMWHs) (Robert J.Linhardt, PH.D.AndNur Sibel Guany, M.S, Seminar in Thrombosis and Hemostasis, 1999,25 (3): 5-16) be some lower-molecular-weight components that when separating unfractionated heparin, obtain, or the small molecule segment that produces after the heparin cracking, length is about 1/3 of unfractionated heparin.The LMWHs molecular weight is between 3000-8000Da, and molecular-weight average is about 5000Da.Compare with unfractionated heparin, find by the inside and outside experiment of body, under Isodose, the anticoagulation of LMWHs is less than heparin, but its body is interior and external anti thrombotic action obviously is better than heparin.In addition, LMWHs also has some other advantages, and is little as molecular weight, the bioavailability height, and plasma half-life is long; Do not combine with heparin-binding protein, therefore more stable dose-effect relationship is arranged, by the body weight administration, control dosage does not need the chamber of experimentizing monitoring; Lessly combine, be difficult for causing thrombopenia with thrombocyte.So LMWHs can effectively prevent thrombosis, can reduce the hemorrhage untoward reaction of Denging again, be a kind of antithrombotic reagent safely and effectively, can be used as the surrogate of heparin.The Heparin Oligosaccharides energy and the different protein factor effects of different polymerization degree (dp), thus present different biological actions.Range of molecular weight distributions is narrow, and relatively the drug effect of the LMWHs of homogeneous is better.LMWHs is being carried out aspect the quality control, each production unit has all been stipulated its molecular-weight average and range of molecular weight distributions.So the LMWHs and the narrow Heparin Oligosaccharides of range of molecular weight distributions of producing required molecular-weight average have great importance.
At present, the preparation method of LMWHs (Zhang Wanzhong, Wang Yunshan, Ma Runyu, Su Zhiguo, state's biochemical drug magazine, 2001,22 (1): 48-51) mainly contain chemical cracking method and enzyme liberating method.Chemical degradation method is the method for industrial normal employing, mainly contains nitrous acid edman degradation Edman, β-cancellation edman degradation Edman, hydrogen peroxide degradation method, Periodic acid, hypochlorous acid, sulfuric acid-chlorsulfonic acid and gamma-irradiation method etc.But chemical cracking heparin reaction is violent, makes that some functional group in the heparin molecule is destroyed more or less in reaction process, thereby some bioactive functions is in various degree by more or less destruction.And the enzyme liberating method reaches the environment nontoxicity owing to reaction conditions gentleness, productive rate height, becomes many glycobiology research workers' research focus.United States Patent (USP) (Nielsen, US 5106734,1992) utilizes the absorbance control quality product at 232nm place, can prepare the low molecule heparin product with ideal average molecular weight.(Yu Guangli, Wang Qun, Guan Huashi, Xu Jiamin, Robert J.Linhardt, Qingdao Marine University's journal, 2002,32 (2): 231-235) utilize heparinase that ox lung heparin is controlled enzymolysis, obtained the pure product of oligosaccharides of the polymerization degree 2~20 such as Yu Guangli.(high Ningguo such as high Ningguo, Cheng Xiulan, Yang Jing, Zhang Shuzheng, the microorganism journal, 1999,39 (1): 64-67) filtered out a kind of sheath amine alcohol liver bacterium that can produce heparinase, and utilize the enzyme liberating heparin produced, obtained a series ofly having anti-proliferation of smooth muscle activity and the anti-freezing very low Heparin Oligosaccharides of living.But used heparinase need be through the purification step of multistep in these methods, and yield is lower, cause the cost of enzyme very expensive (price of the commodity heparinase that the yellow liver bacterium of heparin produces be 40 dollars/U), limited the development that enzyme process prepares Low molecular heparin.Utilizing recombinant bacterial strain to produce Heparinase I is an extremely promising approach, but the as easy as rolling off a log formation inclusion body of the Heparinase I of generally recombinating needs complicated renaturation process could form activated protein.
Summary of the invention
The purpose of this invention is to provide a kind of method for preparing low molecular weight heparin.
The method for preparing low molecular weight heparin provided by the present invention is to be substrate with the heparin, with maltose binding protein-Heparinase I fusion rotein (MBP-hepA) degraded heparin, obtains low molecular weight heparin; Described maltose binding protein-Heparinase I fusion rotein (MBP-hepA) is the protein with the amino acid residue sequence of the SEQ ID N:1 in the sequence table.
Sequence 1 in the sequence table is made up of 756 amino-acid residues.
Described maltose binding protein-Heparinase I fusion rotein (MBP-hepA) can prepare in accordance with the following methods: with pMal-hepA transformed into escherichia coli TB1, obtain containing the recombination bacillus coli TB1 (pMal-hepA) of pMal-hepA, cultivate recombination bacillus coli TB1 (pMal-hepA), abduction delivering obtains maltose binding protein-Heparinase I fusion rotein (MBP-hepA); Described pMal-hepA will have SEQ ID № in the sequence table: the recombinant vectors that obtains between the BamHI of the described maltose binding protein of 2 dna sequence dna-Heparinase I fusion rotein (MBP-hepA) encoding gene insertion pMal-p2x or pMal-c2x carrier and PstI recognition site.
Dna sequence dna in the sequence 2 is made up of 2271 deoxynucleotides, and the encoding sequence of this gene is from the 1st to the 2271st deoxynucleotide of 5 ' end.
Described heparin can obtain from commercial channels, also can be synthetic according to existing method.
The starting point concentration of described heparin is 1-100g/l, is preferably 25g/l.
The solvent that is used to dissolve described heparin can be and contains 3.5mM Ca (CH 3COO) 2And 0.05%NaN 3PH be the NH of 0.1M for 6.5-8.0 concentration 4COOCH 3Damping fluid.
The consumption of described maltose binding protein-Heparinase I fusion rotein is the 1.875-187.5IU/g substrate, is preferably the 7.5IU/g substrate.
In the described method, temperature of reaction can be 10-45 ℃, is preferably 15-20 ℃.
In the described method, the reaction times is 6-12 hour.
Reaction times is preferably 9-12 hour; Especially be preferably 9 hours.
In the described method, purifying low molecular weight heparin in accordance with the following methods: after the termination reaction mixture carried out the ultrafiltration that molecular weight cut-off is 10000Da, utilize TSK-GEL G2000SW post to carry out gel permeation chromatography the filtrate that obtains, the collection retention time is 18-20 minute a elution peak, obtains low molecular weight heparin; Used damping fluid is that to contain the quality percentage composition be 0.05% NaN in the described gel permeation chromatography 3, pH is that 7.0 concentration are the NH of 0.1M 4COOCH 3Damping fluid, the flow velocity of described damping fluid are 0.5ml/min.
Method employing of the present invention has high enzyme maltose binding protein-Heparinase I fusion rotein alive and prepares heparin, because maltose binding protein has the ability with the affine absorption of maltose, therefore recombinant expressed MBP-HepA helps the separation and purification of heparinase, it is about 95% MBP-HepA that single step purification just can obtain purity, thereby can reduce the separation and purification cost of enzyme greatly; Utilize the affine adsorptive power of maltose binding protein (MBP), can be easy to realize the directed immobilization of Heparinase I, make the use repeatedly of enzyme become possibility, thereby improve enzyme reaction efficient, reduce the use cost of enzyme; Thereby reduce the production cost of low molecular weight heparin.The present invention has obtained the narrow low molecular weight heparin (molecular-weight average is at 5000-6000) of range of molecular weight distributions by the control enzyme digestion reaction time.Because production, separation and purification and the use cost of MBP-HepA can significantly reduce, the method for therefore utilizing this fusion rotein production to have the narrow low molecular weight heparin of ideal average molecular weight and range of molecular weight distributions has huge industrial application value.
Description of drawings
Fig. 1 is the building process synoptic diagram of expression vector pMal-hepA
Fig. 2 is the Heparinase I gene electrophoretogram that pcr amplification obtains from the heparin Flavobacterium
Fig. 3 is molecular weight and the canonical plotting of the residence time in the gel chromatography
Fig. 4 is the gel chromatography figure of 6 hours gained Heparin Oligosaccharides of MBP-HepA degraded heparin
Fig. 5 is the gel chromatography figure of 9 hours gained Heparin Oligosaccharides of MBP-HepA degraded heparin
Fig. 6 is the gel chromatography figure of 0.5 hour gained Heparin Oligosaccharides of MBP-HepA degraded heparin
Embodiment
Experimental technique among the following embodiment if no special instructions, is ordinary method.Percentage composition among the following embodiment if no special instructions, is the quality percentage composition.
The acquisition of embodiment 1, maltose binding protein-Heparinase I fusion rotein (MBP-HepA)
1, contain the Heparinase I encoding gene expression vector pMal-hepA construction of expression vector pMal-hepA building process as shown in Figure 1, detailed process is as follows: amplification Heparinase I gene from the genome DNA of heparin Flavobacterium Favabacterium heparinum (buying from IAM), used upstream and downstream primer is respectively 5 ' GCCT GGATCCCAGCAAAAAAAATCCGGTAAC 3 ' (base of band underscore is the enzyme recognition site of BamHI), 5 ' GCTT CTGCAGTCTGGCAGTTTCGCTGTAC 3 ' (base of band underscore is the PstI enzyme recognition site), introduce BamHI and PstI enzyme recognition site respectively, 50 μ L amplification reaction systems are: the 50ng template DNA, every kind of primer of 100pmol, 1 * amplification buffer (sky, Beijing is a Bioisystech Co., Ltd), every kind of dNTP of 200 μ mol/L, the high Pfu enzyme of protecting of 1 unit; Amplification program is: 95 degrees centigrade of sex change 5 minutes, and 50-60 degree centigrade of primer annealing 45 seconds, 72 degrees centigrade of primer extensions 90 seconds, after 30 circulations, 72 degrees centigrade are extended and finished reaction in 5 minutes.This PCR result shows that amplification obtains the Heparinase I gene fragment of 1.1kb as shown in Figure 2.Among Fig. 2, it is 50,51,53,55,58 or 59 ℃ of amplifications that 1-6 is respectively the primer annealing temperature, and 7 is molecular weight marker 15kb, and arrow indication place is a 1.1kb target segment.
With pMal-p2x or pMal-c2x carrier (available from NEB company)) and the PCR product use BamHI and PstI double digestion respectively, connect with the T4DNA ligase enzyme, transform JM109, with 5 ' GCCTGGATCCCAGCAAAAAAAATCCGGTAAC3 ' and 5 ' GCTTCTGCAGTCTGGCAGTTTCGCTGTAC 3 ' is primer, by bacterium colony PCR screening transformant, extraction can obtain plasmid in the transformant of 1.1kb PCR product by BamHI and the checking of PstI double digestion.To obtain the segmental plasmid of 1.1kb by BamHI and PstI double digestion and check order, will contain the plasmid called after pMal-hepA of the Heparinase I fusion rotein encoding gene MBP-HepA of nucleotide sequence with sequence 2 in the sequence table.
With pMal-hepA transformed into escherichia coli TB1, obtain the recombinant plasmid vector bacterial strain that two strains contain correct connection, wherein a strain called after recombination bacillus coli TB1 (pMal-hepA).
2, the expression of Heparinase I fusion rotein MBP-HepA
Recombination bacillus coli TB1 (pMal-hepA) was cultivated 3 hours for 37 ℃ at LB substratum (containing 100 μ g/ml Amp), add 1mM IPTG, in 15 ℃, 200rpm carried out inducing culture 21 hours, the nutrient solution that obtains is at 4 ℃, the centrifugal 10min of 10000rpm, collect thalline, with pH is that 7.0 concentration are the Tris damping fluid washing thalline 2 times that 0.017M (0.017mol/L) contains 0.2M NaCl, the ratio that adds the 1mlTris damping fluid in the centrifugal thalline that obtains of every 2ml bacterium liquid, thalline is suspended in the identical damping fluid ultrasonication in ice bath (output rating is 300W, each ultrasonic 3 seconds and intermittently 3 seconds processing 99 times).Cytoclasis liquid is at 4 ℃, and the centrifugal 30min of 13000rpm gets supernatant liquor and gets the acellular enzyme liquid of slightly carrying.Measure the enzyme activity of slightly carrying enzyme liquid, the optical absorption method of 232nm is adopted in the detection that enzyme is lived, and the enzyme of 1IU is lived and is defined as 30 ℃ of needed protein contents of 1mg substrate heparin of per hour degrading.The result shows that than vigor be the 10.69IU/mg nutrient solution.
3, the single step purification of Heparinase I fusion rotein MBP-HepA: with pH is that 7.0 concentration are the affine separator column of amylose starch (amylose) that 0.017M contains the Tris damping fluid balance 2ml of 0.2MNaCl, supernatant liquor passes through affinity column with the speed of 0.5ml/min, use the Tris buffer solution elution of the 10mM that contains 10mM maltose again, collection has the enzymic activity part, gets 2ml enzyme liquid.
4, the measurement of Heparinase I fusion rotein MBP-HepA vigor: the optical absorption method of 232nm is adopted in the detection that enzyme is lived, and the enzyme of 1IU is lived and is defined as 30 ℃ of needed protein contents of 1mg substrate heparin of per hour degrading.Taking heparin substrate solution 0.5ml, the enzyme liquid of purifying in the adding step 3, other volume replenishes with the Tris damping fluid, and final reaction solution volume is 1.5ml, surveys the absorbancy changes delta A of inherent 232nm of unit time 232Extinction coefficient epsilon=3800M -1Measurement result shows that maltose binding protein-Heparinase I fusion rotein that purifying obtains is the 15.57IU/mg nutrient solution than vigor.Obtaining purity through the single step purification of step 3 is 95% MBP-HepA.
The preparation of embodiment 2, low-molecular-weight heparin oligose
1, the making of typical curve
The measuring method of low-molecular-weight heparin oligose molecular-weight average is as follows: with dextran standard (sigma), by gel permeation chromatography (TSK-GEL G2000SW, TOSOH company, Japan), obtain the typical curve of the molecular weight and the residence time, as Fig. 3, (standard substance are dextran standard, and molecular weight is respectively 1000Da, 5000Da, 12000Da, 25000Da).Wherein, used damping fluid is that to contain the quality percentage composition be 0.05% NaN in this gel permeation chromatography 3, pH is that 7.0 concentration are the NH of 0.1M 4COOCH 3Damping fluid; The flow velocity of this damping fluid is 0.5ml/min.
The calculation formula of molecular-weight average is
Mr = Σ i ( M w i A i ) Σ i A i - - - ( 1 )
Wherein, Mr is a molecular-weight average, and Mwi is the molecular weight of each peak tie substance, and Ai is each peak area.
2, produce low molecular weight heparin
With commodity heparin (Beijing ancient cooking vessel state, 150U/mg tires) is raw material, and used heparin solution contains 3.5mM Ca (CH for the commodity heparin is joined 3COO) 2, 0.05%NaN 3, the concentration of pH7.0 is the NH of 0.1M 4COOCH 3In the damping fluid, the concentration that makes heparin is 25g/l.Get 495 μ l heparin solutions, add the MBP-HepA enzyme liquid (18.6IU/ml) of 5 μ l single step purifications, reaction solution after reacting 6 hours and 9 hours respectively on 15 ℃ of shaking tables, this moment absorbance A 232Be respectively 0.638 and 0.908,3-5min stops enzyme reaction in 100 ℃ metal bath.Every 0.5h, get 15 μ l reaction solutions in the reaction process, add the HCl termination reaction of 1485 μ l 30mM, measure A 232With monitoring reaction course.Reaction solution is after 10000 ultra-filtration membrane filters macromole heparin and zymoprotein, to utilize gel permeation chromatography (TSK-GEL G2000SW, TOSOH company, Japan) to analyze its molecular weight distribution through molecular weight cut-off.Used damping fluid is that to contain the quality percentage composition be 0.05% NaN in this gel permeation chromatography 3, pH is that 7.0 concentration are the NH of 0.1M 4COOCH 3Damping fluid, the flow velocity of this damping fluid are 0.5ml/min.Measure A with UV-detector 232, having obtained the color atlas of 6h reaction solution and 9h reaction solution respectively, three main peaks have appearred in the color atlas (Fig. 4) of the Heparin Oligosaccharides mixture that reaction 6h obtains, according to the typical curve of the molecular weight and the residence time, draw each peak corresponding molecular weight (as table 1).As can be seen from Table 1, in mixture, molecular weight mainly contains two less than 8000 peak, shared peak area per-cent 18.13% and 31.15%, and both summations account for half of total peak area.According to formula (1), the molecular-weight average that draws the Heparin Oligosaccharides that obtains of reaction 6h is 6176.7.
The significant parameter of each peak correspondence in the Heparin Oligosaccharides color atlas of Fig. 4 behind the table 1 reaction 6h
Retention time (min) Molecular weight (Da) Peak area %
Peak 1 ??17.85 ??9609.1 ??18.13
Peak 2 ??18.45 ??7470.1 ??31.15
Peak 3 ??19.42 ??4022.6 ??47.60
Molecular-weight average is 6176.7
Two main peaks occurred in the color atlas (Fig. 5) of the Heparin Oligosaccharides mixture that reaction 9h obtains, each peak corresponding molecular weight is as shown in table 2.As can be seen from Table 2, the molecular weight at these two peaks is respectively 7202.7,3933.5 all less than 8000, and shared peak area is respectively 37.51% and 61.11%.According to formula (1), the molecular-weight average that draws the Heparin Oligosaccharides that obtains of reaction 9h is about 5176.8.
Each peak corresponding parameters in Fig. 5 Heparin Oligosaccharides color atlas behind the table 2 reaction 9h
The residence time (min) Molecular weight (D) Peak area %
Peak 1 ??18.53 ??7202.7 ??37.51
Peak 2 ??19.44 ??3933.5 ??61.11
Molecular-weight average is 5176.8
And for the color atlas (Fig. 6) of the Heparin Oligosaccharides mixture that obtains of reaction 0.5h, four main peaks have appearred, and appearance time all wants Zao than Fig. 4,5, shows that DeR is insufficient, and the Heparin Oligosaccharides that number molecular weight is bigger is not degraded into the lower Heparin Oligosaccharides of molecular weight.So control is to obtain one of principal element of the Heparin Oligosaccharides mixture of ideal average molecular weight the enzyme reaction time.
The same effective degraded heparin with the commodity heparinase of present embodiment explanation MBP-HepA energy by the control enzyme liberating reaction times, can access the low-molecular-weight heparin oligose with ideal average molecular weight.
Sequence table
<160>2
<210>1
<211>756
<212>PRT
<213〉artificial sequence
<220>
<223>
<400>1
Met?Lys?Ile?Glu?Glu?Gly?Lys?Leu?Val?Ile?Trp?Ile?Asn?Gly?Asp?Lys
1???????????????5???????????????????10??????????????????15
Gly?Tyr?Asn?Gly?Leu?Ala?Glu?Val?Gly?Lys?Lys?Phe?Glu?Lys?Asp?Thr
20??????????????????25??????????????????30
Gly?Ile?Lys?Val?Thr?Val?Glu?His?Pro?Asp?Lys?Leu?Glu?Glu?Lys?Phe
35??????????????????40??????????????????45
Pro?Gln?Val?Ala?Ala?Thr?Gly?Asp?Gly?Pro?Asp?Ile?Ile?Phe?Trp?Ala
50??????????????????55??????????????????60
His?Asp?Arg?Phe?Gly?Gly?Tyr?Ala?Gln?Ser?Gly?Leu?Leu?Ala?Glu?Ile
65??????????????????70??????????????????75??????????????????80
Thr?Pro?Asp?Lys?Ala?Phe?Gln?Asp?Lys?Leu?Tyr?Pro?Phe?Thr?Trp?Asp
85??????????????????90??????????????????95
Ala?Val?Arg?Tyr?Asn?Gly?Lys?Leu?Ile?Ala?Tyr?Pro?Ile?Ala?Val?Glu
100?????????????????105?????????????????110
Ala?Leu?Ser?Leu?Ile?Tyr?Asn?Lys?Asp?Leu?Leu?Pro?Asn?Pro?Pro?Lys
115?????????????????120?????????????????125
Thr?Trp?Glu?Glu?Ile?Pro?Ala?Leu?Asp?Lys?Glu?Leu?Lys?Ala?Lys?Gly
130?????????????????135?????????????????140
Lys?Ser?Ala?Leu?Met?Phe?Asn?Leu?Gln?Glu?Pro?Tyr?Phe?Thr?Trp?Pro
145?????????????????150?????????????????155?????????????????160
Leu?Ile?Ala?Ala?Asp?Gly?Gly?Tyr?Ala?Phe?Lys?Tyr?Glu?Asn?Gly?Lys
165?????????????????170?????????????????175
Tyr?Asp?Ile?Lys?Asp?Val?Gly?Val?Asp?Asn?Ala?Gly?Ala?Lys?Ala?Gly
180?????????????????185?????????????????190
Leu?Thr?Phe?Leu?Val?Asp?Leu?Ile?Lys?Asn?Lys?His?Met?Asn?Ala?Asp
195?????????????????200?????????????????205
Thr?Asp?Tyr?Ser?Ile?Ala?Glu?Ala?Ala?Phe?Asn?Lys?Gly?Glu?Thr?Ala
210?????????????????215?????????????????220
Met?Thr?Ile?Asn?Gly?Pro?Trp?Ala?Trp?Ser?Asn?Ile?Asp?Thr?Ser?Lys
225?????????????????230?????????????????235?????????????????240
Val?Asn?Tyr?Gly?Val?Thr?Val?Leu?Pro?Thr?Phe?Lys?Gly?Gln?Pro?Ser
245?????????????????250?????????????????255
Lys?Pro?Phe?Val?Gly?Val?Leu?Ser?Ala?Gly?Ile?Asn?Ala?Ala?Ser?Pro
260?????????????????265?????????????????270
Asn?Lys?Glu?Leu?Ala?Lys?Glu?Phe?Leu?Glu?Asn?Tyr?Leu?Leu?Thr?Asp
275?????????????????280?????????????????285
Glu?Gly?Leu?Glu?Ala?Val?Asn?Lys?Asp?Lys?Pro?Leu?Gly?Ala?Val?Ala
290?????????????????295?????????????????300
Leu?Lys?Ser?Tyr?Glu?Glu?Glu?Leu?Ala?Lys?Asp?Pro?Arg?Ile?Ala?Ala
305?????????????????310?????????????????315?????????????????320
Thr?Met?Glu?Asn?Ala?Gln?Lys?Gly?Glu?Ile?Met?Pro?Asn?Ile?Pro?Gln
325?????????????????330?????????????????335
Met?Ser?Ala?Phe?Trp?Tyr?Ala?Val?Arg?Thr?Ala?Val?Ile?Asn?Ala?Ala
340?????????????????345?????????????????350
Ser?Gly?Arg?Gln?Thr?Val?Asp?Glu?Ala?Leu?Lys?Asp?Ala?Gln?Thr?Asn
355?????????????????360?????????????????365
Ser?Ser?Ser?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Asn?Leu?Gly?Ile
370?????????????????375?????????????????380
Glu?Gly?Arg?Ile?Ser?Glu?Phe?Gly?Ser?Gln?Gln?Lys?Lys?Ser?Gly?Asn
385?????????????????390?????????????????395?????????????????400
lle?Pro?Tyr?Arg?Val?Asn?Val?Gln?Ala?Asp?Ser?Ala?Lys?Gln?Lys?Ala
405?????????????????410?????????????????415
Ile?Ile?Asp?Asn?Lys?Trp?Val?Ala?Val?Gly?Ile?Asn?Lys?Pro?Tyr?Ala
420?????????????????425?????????????????430
Leu?Gln?Tyr?Asp?Asp?Lys?Leu?Arg?Phe?Asn?Gly?Lys?Pro?Ser?Tyr?Arg
435?????????????????440?????????????????445
Phe?Glu?Leu?Lys?Ala?Glu?Asp?Asn?Ser?Leu?Glu?Gly?Tyr?Ala?Ala?Gly
450?????????????????455?????????????????460
Glu?Thr?Lys?Gly?Arg?Thr?Glu?Leu?Ser?Tyr?Ser?Tyr?Ala?Thr?Thr?Asn
465?????????????????470?????????????????475?????????????????480
Asp?Phe?Lys?Lys?Phe?Pro?Pro?Ser?Val?Tyr?Gln?Asn?Ala?Gln?Lys?Leu
485?????????????????490?????????????????495
Lys?Thr?Val?Tyr?His?Tyr?Gly?Lys?Gly?Ile?Cys?Glu?Gln?Gly?Ser?Ser
500?????????????505?????????????????510
Arg?Ser?Tyr?Thr?Phe?Ser?Val?Tyr?Ile?Pro?Ser?Ser?Phe?Pro?Asp?Asn
515?????????????????520?????????????????525
Ala?Thr?Thr?Ile?Phe?Ala?Gln?Trp?His?Gly?Ala?Pro?Ser?Arg?Thr?Leu
530?????????????????535?????????????????540
Val?Ala?Thr?Pro?Glu?Gly?Glu?Ile?Lys?Thr?Leu?Ser?Ile?Glu?Glu?Phe
545?????????????????550?????????????????555?????????????????560
Leu?Ala?Leu?Tyr?Asp?Arg?Met?Ile?Phe?Lys?Lys?Asn?Ile?Ala?His?Asp
565?????????????????570?????????????????575
Lys?Val?Glu?Lys?Lys?Asp?Lys?Asp?Gly?Lys?Ile?Thr?Tyr?Val?Ala?Gly
580?????????????????585?????????????????590
Lys?Pro?Asn?Gly?Trp?Lys?Val?Glu?Gln?Gly?Gly?Tyr?Pro?Thr?Leu?Ala
595?????????????????600?????????????????605
Phe?Gly?Phe?Ser?Lys?Gly?Tyr?Phe?Tyr?Ile?Lys?Ala?Asn?Ser?Asp?Arg
610?????????????????615?????????????????620
Gln?Trp?Leu?Thr?Asp?Lys?Ala?Asp?Arg?Asn?Asn?Ala?Asn?Pro?Glu?Asn
625?????????????????630?????????????????635?????????????????640
Ser?Glu?Val?Met?Lys?Pro?Tyr?Ser?Ser?Glu?Tyr?Lys?Thr?Ser?Thr?Ile
645?????????????????650?????????????????655
Ala?Tyr?Lys?Met?Pro?Phe?Ala?Gln?Phe?Pro?Lys?Asp?Cys?Trp?Ile?Thr
660?????????????????665?????????????????670
Phe?Asp?Val?Ala?Ile?Asp?Trp?Thr?Lys?Tyr?Gly?Lys?Glu?Ala?Asn?Thr
675?????????????????680?????????????????685
Ile?Leu?Lys?Pro?Gly?Lys?Leu?Asp?Val?Met?Met?Thr?Tyr?Thr?Lys?Asn
690?????????????????695?????????????????700
Lys?Lys?Pro?Gln?Lys?Ala?His?Ile?Val?Asn?Gln?Gln?Glu?Ile?Leu?Ile
705?????????????????710?????????????????715?????????????????720
Gly?Arg?Asn?Asp?Asp?Asp?Gly?Tyr?Tyr?Phe?Lys?Phe?Gly?Ile?Tyr?Arg
725?????????????????730?????????????????735
Val?Gly?Asn?Ser?Thr?Val?Pro?Val?Thr?Tyr?Asn?Leu?Ser?Gly?Tyr?Ser
740?????????????????745?????????????????750
Glu?Thr?Ala?Arg
755
<210>2
<211>2271
<212>DNA
<213〉artificial sequence
<220>
<223>
<400>2
atgaaaatcg?aagaaggtaa?actggtaatc?tggattaacg?gcgataaagg?ctataacggt?????60
ctcgctgaag?tcggtaagaa?attcgagaaa?gataccggaa?ttaaagtcac?cgttgagcat????120
ccggataaac?tggaagagaa?attcccacag?gttgcggcaa?ctggcgatgg?ccctgacatt????180
atcttctggg?cacacgaccg?ctttggtggc?tacgctcaat?ctggcctgtt?ggctgaaatc????240
accccggaca?aagcgttcca?ggacaagctg?tatccgttta?cctgggatgc?cgtacgttac????300
aacggcaagc?tgattgctta?cccgatcgct?gttgaagcgt?tatcgctgat?ttataacaaa????360
gatctgctgc?cgaacccgcc?aaaaacctgg?gaagagatcc?cggcgctgga?taaagaactg????420
aaagcgaaag?gtaagagcgc?gctgatgttc?aacctgcaag?aaccgtactt?cacctggccg????480
ctgattgctg?ctgacggggg?ttatgcgttc?aagtatgaaa?acggcaagta?cgacattaaa????540
gacgtgggcg?tggataacgc?tggcgcgaaa?gcgggtctga?ccttcctggt?tgacctgatt????600
aaaaacaaac?acatgaatgc?agacaccgat?tactccatcg?cagaagctgc?ctttaataaa????660
ggcgaaacag?cgatgaccat?caacggcccg?tgggcatggt?ccaacatcga?caccagcaaa????720
gtgaattatg?gtgtaacggt?actgccgacc?ttcaagggtc?aaccatccaa?accgttcgtt????780
ggcgtgctga?gcgcaggtat?taacgccgcc?agtccgaaca?aagagctggc?aaaagagttc????840
ctcgaaaact?atctgctgac?tgatgaaggt?ctggaagcgg?ttaataaaga?caaaccgctg????900
ggtgccgtag?cgctgaagtc?ttacgaggaa?gagttggcga?aagatccacg?tattgccgcc????960
actatggaaa?acgcccagaa?aggtgaaatc?atgccgaaca?tcccgcagat?gtccgctttc???1020
tggtatgccg?tgcgtactgc?ggtgatcaac?gccgccagcg?gtcgtcagac?tgtcgatgaa???1080
gccctgaaag?acgcgcagac?taattcgagc?tcgaacaaca?acaacaataa?caataacaac???1140
aacctcggga?tcgagggaag?gatttcagaa?ttcggatccc?agcaaaaaaa?atccggtaac???1200
atcccttacc?gggtaaatgt?gcaggccgac?agtgctaagc?agaaggcgat?tattgacaac???1260
aaatgggtgg?cagtaggcat?caataaacct?tatgcattac?aatatgacga?taaactgcgc???1320
tttaatggaa?aaccatccta?tcgctttgag?cttaaagccg?aagacaattc?gcttgaaggt???1380
tatgctgcag?gagaaacaaa?gggccgtaca?gaattgtcgt?acagctatgc?aaccaccaat???1440
gattttaaga?aatttccccc?aagcgtatac?caaaatgcgc?aaaagctaaa?aaccgtttat???1500
cattacggca?aagggatttg?tgaacagggg?agctcccgca?gctatacctt?ttcagtgtac???1560
ataccctcct?ccttccccga?caatgcgact?actatttttg?cccaatggca?tggtgcaccc???1620
agcagaacgc?ttgtagctac?accagaggga?gaaattaaaa?cactgagcat?agaagagttt???1680
ttggccttat?acgaccgcat?gatcttcaaa?aaaaatatcg?cccatgataa?agttgaaaaa???1740
aaagataagg?acggaaaaat?tacttatgta?gccggaaagc?caaatggctg?gaaggtagaa???1800
caaggtggtt?atcccacgct?ggcctttggt?ttttctaaag?ggtattttta?catcaaggca???1860
aactccgacc?ggcagtggct?taccgacaaa?gccgaccgta?acaatgccaa?tcccgagaat???1920
agtgaagtaa?tgaagcccta?ttcctcggaa?tacaaaactt?caaccattgc?ctataaaatg???1980
ccctttgccc?agttccctaa?agattgctgg?attacttttg?atgtcgccat?agactggacg???2040
aaatatggaa?aagaggccaa?tacaattttg?aaacccggta?agctggatgt?gatgatgact???2100
tataccaaga?ataagaaacc?acaaaaagcg?catatcgtaa?accagcagga?aatcctgatc???2160
ggacgtaacg?atgacgatgg?ctattacttc?aaatttggaa?tttacagggt?cggtaacagc???2220
acggtcccgg?ttacttataa?cctgagcggg?tacagcgaaa?ctgccagatg?a????????????2271

Claims (9)

1, a kind of method for preparing low molecular weight heparin is to be substrate with the heparin, with maltose binding protein-Heparinase I fusion rotein degraded heparin, obtains low molecular weight heparin; Described maltose binding protein-Heparinase I fusion rotein is the SEQ ID № that has in the sequence table: the protein of 1 amino acid residue sequence.
2, method according to claim 1, it is characterized in that: described maltose binding protein-Heparinase I fusion rotein prepares in accordance with the following methods: with plasmid pMal-hepA transformed into escherichia coli TB1, obtain containing the recombination bacillus coli TB1 (pMal-hepA) of pMal-hepA, cultivate recombination bacillus coli TB1 (pMal-hepA), abduction delivering obtains maltose binding protein-Heparinase I fusion rotein;
Described pMal-hepA will have SEQ ID № in the sequence table: the recombinant vectors that obtains between the BamHI of the described maltose binding protein of 2 dna sequence dna-Heparinase I fusion rotein encoding gene insertion pMal-p2x or pMal-c2x carrier and PstI recognition site.
3, method according to claim 1 and 2 is characterized in that: the starting point concentration of described heparin is 1-100g/l; Be preferably 25g/l.
4, method according to claim 3 is characterized in that: describedly be used to dissolve the solvent of heparin for containing 3.5mMCa (CH 3COO) 2With 0.05% NaN 3PH be the NH of 0.1M for 6.5-8.0 concentration 4COOCH 3Damping fluid.
5, method according to claim 1 and 2 is characterized in that: the consumption of described maltose binding protein-Heparinase I fusion rotein is the 1.875-187.5IU/g substrate; Be preferably the 7.5IU/g substrate.
6, method according to claim 1 and 2 is characterized in that: in the described method, temperature of reaction is 10-45 ℃, is preferably 15-20 ℃.
7, method according to claim 1 and 2 is characterized in that: in the described method, the reaction times is 6-12 hour.
8, method according to claim 7 is characterized in that: the described reaction times is 9-12 hour; Be preferably 9 hours.
9, method according to claim 1 and 2, it is characterized in that: in the described method, purifying low molecular weight heparin in accordance with the following methods: after the termination reaction mixture carried out the ultrafiltration that molecular weight cut-off is 10000Da, utilize TSK-GEL G2000SW post to carry out gel permeation chromatography the filtrate that obtains, the collection retention time is 18-20 minute a elution peak, obtains low molecular weight heparin; Used damping fluid is that to contain the quality percentage composition be 0.05% NaN in the described gel permeation chromatography 3, pH is that 7.0 concentration are the NH of 0.1M 4COOCH 3Damping fluid, the flow velocity of described damping fluid are 0.5ml/min.
CNB2005100889702A 2005-08-04 2005-08-04 Production of low-molecular heparin Expired - Fee Related CN100344769C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100889702A CN100344769C (en) 2005-08-04 2005-08-04 Production of low-molecular heparin

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100889702A CN100344769C (en) 2005-08-04 2005-08-04 Production of low-molecular heparin

Publications (2)

Publication Number Publication Date
CN1712418A true CN1712418A (en) 2005-12-28
CN100344769C CN100344769C (en) 2007-10-24

Family

ID=35718233

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100889702A Expired - Fee Related CN100344769C (en) 2005-08-04 2005-08-04 Production of low-molecular heparin

Country Status (1)

Country Link
CN (1) CN100344769C (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7691612B2 (en) 2005-11-03 2010-04-06 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
US7691613B2 (en) 2006-11-03 2010-04-06 Momenta Pharmaceuticals, Inc. Glycosaminoglycan lyase IV and uses thereof
US7767420B2 (en) 2005-11-03 2010-08-03 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
CN101294177B (en) * 2008-05-26 2012-07-18 清华大学 Method for preparing low molecular weight heparin
CN108117614A (en) * 2016-11-29 2018-06-05 北京碧澄生物科技有限公司 Low molecular weight heparin
CN109402134A (en) * 2018-11-29 2019-03-01 湖南百尔泰克生物科技有限公司 A kind of preparation method and applications of the engineering bacteria of high efficient expression growth hormone
WO2023097925A1 (en) * 2021-11-30 2023-06-08 清华大学 Oral polysaccharide for treating inflammatory bowel disease and preparation method therefor

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2233343A1 (en) * 1995-09-29 1997-04-03 Ibex Technologies Inc. Use of heparinases to decrease inflammatory responses
CN1315458A (en) * 2000-03-31 2001-10-03 上海惠海生化制品厂 Low-molecular heparin and its preparing process
CN1111171C (en) * 2000-09-07 2003-06-11 上海惠海生化制品厂 Heparin and its preparing process
CN1421464A (en) * 2002-11-29 2003-06-04 上海惠海生化制品厂 Low molecular weight heparine sodium (calcium) and its prepn

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7691612B2 (en) 2005-11-03 2010-04-06 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
US7767420B2 (en) 2005-11-03 2010-08-03 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
US7888072B2 (en) 2005-11-03 2011-02-15 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
US8198050B2 (en) 2005-11-03 2012-06-12 Momenta Pharmaceuticals, Inc. Heparan sulfate glycosaminoglycan lyase and uses thereof
US7691613B2 (en) 2006-11-03 2010-04-06 Momenta Pharmaceuticals, Inc. Glycosaminoglycan lyase IV and uses thereof
CN101294177B (en) * 2008-05-26 2012-07-18 清华大学 Method for preparing low molecular weight heparin
CN108117614A (en) * 2016-11-29 2018-06-05 北京碧澄生物科技有限公司 Low molecular weight heparin
CN108117614B (en) * 2016-11-29 2020-09-04 北京碧澄生物科技有限公司 Low molecular weight heparins
CN109402134A (en) * 2018-11-29 2019-03-01 湖南百尔泰克生物科技有限公司 A kind of preparation method and applications of the engineering bacteria of high efficient expression growth hormone
WO2023097925A1 (en) * 2021-11-30 2023-06-08 清华大学 Oral polysaccharide for treating inflammatory bowel disease and preparation method therefor

Also Published As

Publication number Publication date
CN100344769C (en) 2007-10-24

Similar Documents

Publication Publication Date Title
CN100344769C (en) Production of low-molecular heparin
CN1900290A (en) Method for E, coli to express lysostaphin in high efficiency via external secretion
CN1311076C (en) Method for producing recombinaton urokinase
CN107267471B (en) Bifunctional glutathione synthetase mutant, nucleotide sequence, preparation method and application thereof
CN1279171C (en) Use of fusion proteins whose N-terminal part is a hirudin derivative for the production of recombinant proteins via secretion by yeasts
CN1746301A (en) Acid-proof and high-temperature resistant alpha-amylase and production thereof
CN111893125A (en) Chitosan enzyme gene, chitosanase, preparation method and application thereof
CN101054569A (en) Gene engineering bacterium, preparation and use thereof
CN107794275B (en) Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof
CN108118036A (en) Novel grape carbohydrate oxidase mutant
Elmi et al. Stereoselective esterase from Pseudomonas putida IFO12996 reveals α/β hydrolase folds for D-β-acetylthioisobutyric acid synthesis
CN113462678A (en) Glutamic acid decarboxylase mutant
CN1075148A (en) New megalokaryocyte amplification gene
CN87104540A (en) The production of human lysozyme
EP3536780A1 (en) Proline hydroxylase and application thereof
CN1786170A (en) High efficiency transglyco beta galactoside gene
CN1814746A (en) Nattokinase and its coding gene and clone and expressing method
CN1757739A (en) Method of expressing heparinase and its special expression carrier
CN1786165A (en) Preparation method of recombination staphylococcus aureus enterotoxin C2
CN113564151B (en) Method for improving structural isomerism catalytic activity of CE enzyme and mutant thereof
CN109161556A (en) M1PDH gene, its protein and purposes in one main laminaria
CN113122525B (en) Formaldehyde conversion protein and application thereof
CN1916171A (en) Method for producing xylobiose, and dedicated immobilized enzyme
CN107653257A (en) A kind of encoding gene, recombinant expression carrier and the application of nicotinamide mononucleotide adenylyl transferase
CN100340656C (en) High-efficiency expression in Pichia yeast, fermentation and purification of human gamma-interferon

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20071024

Termination date: 20170804