CN107794275B - Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof - Google Patents
Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof Download PDFInfo
- Publication number
- CN107794275B CN107794275B CN201711077526.XA CN201711077526A CN107794275B CN 107794275 B CN107794275 B CN 107794275B CN 201711077526 A CN201711077526 A CN 201711077526A CN 107794275 B CN107794275 B CN 107794275B
- Authority
- CN
- China
- Prior art keywords
- pichia pastoris
- gamma
- lactamase
- recombinant
- fermentation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
- C12N9/86—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides, e.g. penicillinase (3.5.2)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides recombinant pichia pastoris for producing (+) gamma-lactamase and a construction method thereof, belonging to the technical field of genetic engineering. The invention provides a recombinant plasmid containing a (+) gamma-lactamase gene, wherein the (+) gamma-lactamase gene is subjected to codon preference adjustment at a 591 site and then added with an EcoRI restriction enzyme cutting site and a NotI restriction enzyme cutting site at two ends of a sequence, and a six-histidine tag is added at a 3' end. The recombinant pichia pastoris uses pichia pastoris as an expression host, and comprises the recombinant plasmid. The recombinant pichia pastoris for producing (+) gamma-lactamase is applied to fermentation production of (+) gamma-lactamase. Compared with prokaryotic expression vector, the enzyme production of (+) gamma-lactamase using yeast as expression vector is improved by 58%.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to recombinant pichia pastoris for producing (+) gamma-lactamase and a construction method and application thereof.
Background
(-) 2-azabicyclo [2,2,1] hept-5-ene-3-one (for short (-) gamma-lactam) is a key carbon ring functional group intermediate for synthesizing antiviral carbocyclic nucleoside medicament abacavir for treating HIV and herpes virus, anti-influenza carbocyclic nucleoside medicament peramivir and the like. The chemical synthesis of the optically active compound has multiple steps and high cost, and is not beneficial to the application of industrial production. Compared with a chemical synthesis method, the biological method has the advantages of high optical purity of the product chiral (-) gamma-lactam, easy acquisition of the gamma-amidase used as the catalyst, mild conditions, small pollution and the like. The enzyme capable of hydrolyzing and resolving racemic gamma lactam is called gamma lactamase, and belongs to amidase, wherein (+) gamma-lactamase can efficiently resolve racemic gamma-lactam to obtain chiral (-) gamma-lactam with high optical purity.
At present, the research on the induction expression of (+) gamma-lactamase in escherichia coli is more intensive, the research on the induction expression of (+) gamma-lactamase in pichia pastoris is less, and (+) gamma-lactamase exogenous gene sequences are mainly subjected to enzymolysis by restriction enzymes existing in eukaryotes and cannot be normally expressed in eukaryotic expression vectors.
Disclosure of Invention
In view of this, the present invention aims to provide a recombinant pichia pastoris for producing (+) gamma-lactamase and a construction method and an application thereof, so that the constructed recombinant pichia pastoris can be successfully expressed and has the characteristic of high expression level.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides a recombinant plasmid containing a (+) gamma-lactamase gene, wherein the (+) gamma-lactamase gene is connected with EcoRI and NotI restriction sites of a vector pMD; the 591 th base of the (+) gamma-lactamase gene is mutated from A to G and has a nucleotide sequence shown as SEQ ID No.1 in a sequence table.
The invention provides a recombinant Pichia pastoris for producing (+) gamma-lactamase, which takes Pichia pastoris as an expression host and comprises the recombinant plasmid.
The invention provides a construction method of the recombinant pichia pastoris, which comprises the following steps:
1) linearizing the recombinant plasmid of claim 1, and electrically transforming the linearized recombinant plasmid into pichia pastoris;
2) carrying out static culture on the electrically transformed Pichia pastoris in the step 1) in a liquid culture medium at the temperature of 28-32 ℃ for 2-6 h;
3) separating the pichia pastoris from the liquid culture medium in the step 2), and inoculating the pichia pastoris to a screening culture medium for screening culture to obtain the recombinant pichia pastoris.
Preferably, the linearization treatment in the step 1) is performed by an enzymatic hydrolysis method; the kind of the enzyme for linearization is SacI enzyme.
Preferably, the electrotransfer conditions in step 1): the voltage of the electric conversion is 1.5Kv, and the electric conversion time is 3-5 ms.
Preferably, the screening culture medium in the step 3) takes a liquid culture medium as a basic culture medium, and comprises geneticin with the mass concentration of 80-120 mug/mL and agar powder with the mass percentage concentration of 2% -3%;
the liquid culture medium comprises the following components in percentage by mass: 1% yeast extract, 2% tryptone, 2% glucose, 0.5% sorbitol.
The invention provides application of the recombinant pichia pastoris or the recombinant pichia pastoris constructed by the method in fermentation production of (+) gamma-lactamase.
Preferably, the culture medium for fermentation is yeast extract with the mass percentage concentration of 1%, peptone with the mass percentage concentration of 2%, casein hydrolysate with the mass percentage concentration of 0.5%, sorbitol with the mass percentage concentration of 0.5% and geneticin with the mass concentration of 100 mu g/mL.
Preferably, the fermentation temperature is 28-32 ℃; the fermentation time is preferably 60-96 hours; the fermentation is oscillation fermentation; the rotation speed of the oscillating fermentation is 200-250 rpm.
Preferably, the volume concentration of the methanol in the obtained fermentation liquor is 0.8-1.2% every 20-28 h during the fermentation production.
The invention provides a recombinant plasmid containing a (+) gamma-lactamase gene, wherein the (+) gamma-lactamase gene has a nucleotide sequence shown as SEQ ID No.1 in a sequence table. The (+) gamma-lactamase gene optimizes codon according to codon preference of pichia pastoris to mutate the 591 th base from A to G, so that the problem of enzymolysis by restriction endonuclease existing in eukaryotes is solved, and meanwhile, the 3' end is connected with 6 histidine-tagged nucleotide sequences, thereby facilitating the construction of subsequent recombinant vectors and the separation and purification of recombinant expression proteins.
The invention provides a recombinant Pichia pastoris for producing (+) gamma-lactamase, which takes Pichia pastoris as an expression host and comprises the recombinant plasmid. The pichia pastoris P.pastoris expresses a large amount of heterologous recombinant protein (+) gamma-lactamase under the action of a high-efficiency promoter AOX1, has a plurality of post-translational protein processing capacities like higher eukaryotes, and has higher expression preference for the expression, correct folding and later modification of the protein of the gene of the (+) gamma-lactamase such as SEQ ID No.1, so that the recombined expressed (+) gamma-lactamase is obtained. Compared with prokaryotic expression vector, the enzyme production of (+) gamma-lactamase using yeast as expression vector is improved by 58%.
Information on strain preservation
Pichia pastoris, is submitted to China general microbiological culture Collection center for preservation in 2017, 09.25.month, with the preservation number of CGMCC No.14663, the location of the preservation organization is at the institute of microbiology of China academy of sciences, No.3 of Xilu No.1 of Beijing, the rising area, the preservation organization is abbreviated as CGMCC.
Drawings
FIG. 1 shows the result of PCR amplification of the mutant primers of the present invention;
FIG. 2 shows the sequencing result of the point mutation in the present invention;
FIG. 3 is a DNA electrophoresis diagram obtained by amplifying a target gene with primers γ -L and γ -R according to the present invention;
FIG. 4 is a SDS-PAGE of expression and purification of the recombinant enzyme of the present invention;
FIG. 5 shows the protein content in yeast and E.coli of the present invention.
Detailed Description
The invention provides a recombinant plasmid containing a (+) gamma-lactamase gene, wherein the (+) gamma-lactamase gene is connected with EcoRI and NotI restriction sites of a vector pMD; the (+) gamma-lactamase gene has a nucleotide sequence shown as SEQ ID No.1 in a sequence table.
The (+) gamma-lactamase gene has a nucleotide sequence shown as SEQ ID No.1 in a sequence table, wherein an EcoRI restriction enzyme cutting site is added at the 5 'end of the nucleotide sequence, and a NotI restriction enzyme cutting site is added after six histidine tags are added at the 3' end. The (+) gamma-lactamase has an amino acid sequence shown as SEQ ID No.2 in a sequence table.
In the invention, the preparation method of the recombinant plasmid in the technical scheme comprises the following steps:
A. amplifying a gamma lactamase gene of (+) gamma-lactamase gene with accession number AE006641.1 in Genbank by using mutation primers T-L and T-R, and digesting a PCR product for 2h by using restriction enzyme Dpn I; the mutant primer T-L has a nucleotide sequence shown as SEQ ID No.3 in the sequence table, and the mutant primer T-R has a nucleotide sequence shown as SEQ ID No.4 in the sequence table;
B. the digested product was ligated to T vector, E.coli DH5 α was transformed, and the resulting transformed product was applied to LB plate containing 50. mu.g/ml kanamycin and cultured overnight at 37 ℃;
C. extracting plasmids of the selected single colony, and performing PCR amplification on the extracted plasmids by using primers gamma-L and gamma-R to obtain a PCR product; the gamma-L has a nucleotide sequence shown as SEQ ID No.5 in the sequence table, and the gamma-R has a nucleotide sequence shown as SEQ ID No.6 in the sequence table;
D. c, carrying out double enzyme digestion on the PCR product obtained in the step C and the expression vector pMD-AOX by using restriction enzymes EcoRI and Not I, recovering and purifying a target fragment and connecting the vector fragment;
E. and (3) converting the obtained connecting product into E.coli DH5 α again, coating the obtained conversion product on an LB plate containing the aminobenzyl, carrying out overnight culture at 37 ℃, selecting a single colony on the next day, inoculating the single colony into a liquid LB culture medium containing 100 mu g/ml of the aminobenzyl for culture, and extracting a plasmid for double enzyme digestion verification to obtain the constructed recombinant plasmid.
In the present invention, the Dpn I digestion system: 1 μ L of Dpn I, 1 μ L of 10 Xbuffer, 5 μ L of PCR reaction product, ddH2O3. mu.L. The digestion reaction temperature is preferably 37 ℃, and the digestion time is preferably 2 hours. The Dpn I is used for degrading template DNA and preventing the trouble of the non-mutated sequence on subsequent screening and verification.
In the invention, mutation primers T-L and T-R are utilized to amplify PCR reaction programs: 5min at 95 ℃; 30s at 95 ℃, 60s at 62 ℃, 10min at 72 ℃ and 18 cycles; 20min at 72 ℃; 10min at 16 ℃.
In the invention, a PCR reaction system is amplified by using mutation primers T-L and T-R:
in the present invention, the reaction procedure for PCR using the primers γ -L and γ -R is as follows:
5min at 95 ℃; 30s at 95 ℃, 60s at 62 ℃, 1min at 72 ℃ and 29 cycles; 72 ℃ for 10min and 16 ℃ for 10 min.
The reaction system for PCR using the primers γ -L and γ -R is as follows:
in the invention, the biological source of the (+) gamma-lactamase gene is sulfolobus solofossfataricus heat-resistant gamma-lactamase gene.
In the present invention, in the examples of the present invention, the primer synthesis was entrusted with Anhui general biology company.
In the invention, the pMD plasmid is obtained by enzyme digestion of pMD-AOX provided by the institute of microorganisms of Chinese academy of sciences; and cutting off the exogenous gene AOX by carrying out restriction enzyme digestion on the pMD plasmid through EcoRI and NotI to obtain a blank plasmid pMD. The method of the present invention is not particularly limited, and EcoRI and NotI restriction enzyme digestion protocols well known to those skilled in the art may be used. The pMD-AOX plasmid is reported in the clone of the glucose oxidase gene named Penicillium notatum issued by Gaoqinghua et al and the study of its enzymatic properties, see in particular the literature (Gaoqing, Humeirong, Wu Fangtong, Dougong, Wang Yunpeng, Rogosheng, Hu Hei Ying. Penicillium notatum glucose oxidase gene clone and the study of its enzymatic properties [ J/OL ] biotechnological bulletin, 2016,32(07): 152-. The sources of the EcoRI and NotI restriction enzymes are not particularly limited, and those known to those skilled in the art can be used. The temperature for the enzymatic hydrolysis may be the temperature of conventional restriction enzymes EcoRI and NotI.
The invention provides a recombinant Pichia pastoris for producing (+) gamma-lactamase, which takes Pichia pastoris as an expression host and comprises the recombinant plasmid in the technical scheme.
In the present invention, the source of Pichia pastoris is not particularly limited, and Pichia pastoris known to those skilled in the art can be used. In the embodiment of the invention, the Pichia pastoris X-33 is provided by the institute of microorganisms of the Chinese academy of sciences.
The invention provides a construction method of the recombinant pichia pastoris for producing (+) gamma-lactamase, which comprises the following steps:
1) carrying out linearization treatment on the recombinant plasmid in the scheme, and electrically converting the linearized recombinant plasmid into pichia pastoris;
2) carrying out static culture on the electrically transformed Pichia pastoris in the step 1) in a liquid culture medium at the temperature of 28-32 ℃ for 2-6 h;
3) and inoculating the pichia pastoris obtained by solid-liquid separation from the liquid culture medium to a screening culture medium for screening culture to obtain the recombinant pichia pastoris.
In the invention, the recombinant plasmid in the scheme is subjected to linearization treatment, and the linearized recombinant plasmid is electrically converted into pichia pastoris.
In the invention, the linearization treatment is preferably an enzymatic hydrolysis method; the kind of the enzyme for linearization is SacI enzyme. In the present invention, the method of linearization treatment is not particularly limited, and a linearization treatment method known to those skilled in the art may be used.
In the present invention, the electrotransformation conditions are preferably as follows: the voltage of the electric conversion is 1.5Kv, and the electric conversion time is 3-5 ms.
The device for the electric conversion is not particularly limited, and an electric conversion device known to those skilled in the art can be used.
After the electro-converted pichia pastoris is obtained, the pichia pastoris is subjected to static culture in a liquid culture medium for 2-6 hours at the temperature of 28-32 ℃.
In the present invention, the temperature of the static culture is preferably 30 ℃. The time of the static culture is preferably 3-5 h, and more preferably 4 h. In the invention, the static culture can be used for adaptively repairing the electrically transformed pichia pastoris.
In the invention, the liquid culture medium comprises yeast extract with the mass percentage concentration of 1%, tryptone with the mass percentage concentration of 2%, glucose with the mass percentage concentration of 2% and sorbitol with the mass percentage concentration of 0.5%.
After the cultured pichia pastoris is obtained, the cultured pichia pastoris is inoculated to a screening culture medium for screening culture after solid-liquid separation, and the recombinant pichia pastoris is obtained.
In the present invention, the solid-liquid separation is preferably centrifugation. The rotation speed of the centrifugation is preferably 4500-5500 rpm, and more preferably 5000 rpm. The time for centrifugation is preferably 1.5-3 min, and more preferably 2 min.
In the invention, the screening culture medium preferably takes a liquid culture medium as a basic culture medium, and contains the geneticin with the mass concentration of 80-120 mug/mL and the agar powder with the mass percentage concentration of 2% -3%. The mass concentration of the geneticin is preferably 100 mug/mL. The preferable mass percentage concentration of the agar powder is 2.5%. The source of the geneticin is not particularly limited in the present invention, and a commercially available product well known to those skilled in the art may be used. In the invention, the liquid culture medium comprises yeast extract with the mass percentage concentration of 1%, tryptone with the mass percentage concentration of 2%, glucose with the mass percentage concentration of 2% and sorbitol with the mass percentage concentration of 0.5%.
In the present invention, the screening culture method is not particularly limited, and the static culture conditions in the above technical scheme may be adopted.
The invention also provides application of the recombinant pichia pastoris in fermentation production of (+) gamma-lactamase.
In the invention, the fermentation medium comprises the following components in percentage by mass: 1% of yeast extract, 2% of peptone by mass, 0.5% of casein hydrolysate by mass, 0.5% of sorbitol by mass and 100 mug/mL of geneticin by mass.
In the invention, before fermentation production, the inoculation amount of the recombinant pichia pastoris of (+) gamma-lactamase is preferably 4-10%, and more preferably 5-8%. The present invention is not particularly limited with respect to the mode of inoculation for fermentation production, and may be carried out using an inoculation protocol known to those skilled in the art.
In the present invention, the conditions of the fermentation culture are preferably as follows: the culture temperature is 30 ℃; the time for culturing is preferably 3-5 days, and more preferably 4 days. In the invention, the fermentation temperature is preferably 28-32 ℃, and more preferably 30 ℃. The fermentation time is preferably 48-98 h, and more preferably 72 h.
In the present invention, the fermentation is preferably accompanied by shaking culture; the rotation speed of the shaking culture is preferably 200-250 rpm, and more preferably 220 rpm.
In the invention, during the fermentation period, a methanol solution with the volume percentage concentration of 1% is preferably added every 20-28 h. The interval time is more preferably 24 h. The methanol solution plays an inducing role. The volume concentration of methanol in the fermentation liquid after methanol is added is 0.8-1.2%, and the preferred volume concentration is 1%.
In the present invention, after the fermentation is completed, it is preferable to separate the solid from the liquid of the obtained fermentation material and collect the supernatant to obtain the recombinant protease. The solid-liquid separation is preferably centrifugation. The rotation speed of the centrifugation is preferably 12000rpm, and the time of the centrifugation is preferably 5-10 min. The expression condition of the target protein is detected by SDS-PAGE of the obtained recombinant protease.
The invention provides a recombinant pichia pastoris producing (+) gamma-lactamase and a construction method and application thereof, which are described in detail in the following with reference to the examples, but the invention is not to be construed as being limited by the scope of the invention.
Example 1
Cloning and point mutation of gamma-lactamase gene
Based on Sulfolobus solfataricus heat-resistant gamma-lactamase gene with accession number AE006641.1 on NCBI, codon optimization is carried out on enzyme cutting sites of endonuclease existing in the gene according to codon preference of pichia pastoris, and the optimized codon is added in designing a primer.
Specifically, the 591 th base of the gamma-lactamase gene is subjected to point mutation, the gamma-lactamase gene is amplified by using mutation primers T-L and T-R, a PCR product is digested for 2h by using restriction enzyme Dpn I, and is detected by using 1% agarose gel electrophoresis, and the result is shown in figure 1, wherein M represents 2K marker, and 1 and 2 represent the gamma-lactamase gene
And (3) PCR reaction system:
PCR reaction procedure: 5min at 95 ℃; 30s at 95 ℃, 60s at 62 ℃, 10min at 72 ℃ and 18 cycles; 20min at 72 ℃; 10min at 16 ℃.
Dpn I enzyme digestion system: dpn I1. mu.L, 10 Xbuffer1 μ L, PCR reaction product 5 μ L, ddH2O 3μL。37℃，2h。
The sequence table shows the nucleotide and amino acid sequence information of the invention:
(1) the sequence information of SEQ ID NO.1 is the nucleotide sequence of the (+) gamma-lactamase gene after point mutation;
(2) the sequence information of SEQ ID NO.2 is the amino acid sequence of the coded (+) gamma-lactamase gene after point mutation.
Example 2
The band in the electrophoresis in the example 1 is recovered, a target fragment is about 1500bp, the band is connected to a T carrier by T4 ligase to transform E.coli DH5 α, the specific steps are that competent cells DH5 α are placed in an ice bath, 5 mul of recovered enzyme digestion products are added into 50 mul of competent cell suspension, the mixture is flicked and mixed evenly, the ice bath is placed for 30min, a centrifuge tube is placed in a 42 ℃ water bath for 60-90 s, the centrifuge tube is rapidly transferred onto ice for 2-3 min without shaking the centrifuge tube in the process, 800 mul of sterile LB culture medium (without antibiotics) is added into each centrifuge tube, the centrifuge tube is placed in a 37 ℃ shaking table for shaking culture for 45min (180rpm) after being mixed evenly, the content of the centrifuge tube is mixed evenly, 100 mul of transformed competent cells are absorbed and added onto an LB plate containing 50 mul/ml of kanamycin, an inverted plate is uniformly coated by a sterile coater, the colony is cultured at 37 ℃ for single colony culture, the next day, PCR detection is carried out, the detection results of single mutation by using 1% gel, the agarose gel, the detection, the specific mutation results are extracted, the upstream mutation primers are respectively used for the upstream mutation sequences of the colony sequencing primer sequence extraction, the colony sequencing of the colony, the colony is respectively, the sequence detection is shown as the sequence of the first colony, the second day, the sequence detection, the second day, the sequence detection is shown as the.
Primer gamma-L:
GAATTCATGGGAATTAAGTTACCCACATTGG
underliningGAATTCIs a recognition site of a restriction enzyme EcoRI in an upstream primer.
Primer gamma-R
GCGGCCGCTCAGTGGTGGTGGTGGTGGT
UnderliningGCGGCCGCIs a recognition site of a restriction enzyme Not I in a downstream primer.
Extracting plasmid from the single colony which is sequenced successfully, taking the single colony as a template, amplifying a target gene by using primers gamma-L and gamma-R, and carrying out PCR reaction by using the primers gamma-L and gamma-R as follows: 5min at 95 ℃; 30s at 95 ℃, 60s at 62 ℃, 1min at 72 ℃ and 29 cycles; 72 ℃ for 10min and 16 ℃ for 10 min. The reaction system for PCR using the primers γ -L and γ -R is as follows:
after the PCR reaction, the detection was performed by 1% agarose gel electrophoresis, and the results are shown in FIG. 3.
Example 3
Construction of recombinant plasmid
EcoRI restriction enzyme sites and NotI restriction enzyme sites are respectively introduced at two ends of the amplified target gene fragment in the embodiment 2, a pMD-AOX plasmid provided by the institute of microbiology of the Chinese academy of sciences also has the two restriction enzyme sites, EcoRI enzyme and NotI enzyme are adopted for double restriction enzyme digestion, the restriction enzyme digestion products are connected by T4 ligase to recover products, the connected products are transformed into escherichia coli DH5 α, the transformed products are coated on an LB plate containing aminobenzyl, overnight culture is carried out at 37 ℃, a single colony is selected on the next day and inoculated into 5mL of liquid LB culture medium (containing aminobenzyl 100 mu g/mL) for culture, and plasmid is extracted for double restriction enzyme digestion verification, so that the constructed recombinant plasmid is obtained.
Example 4
Construction of bacterial strain for producing (+) gamma-lactamase by recombinant pichia pastoris
The expression vector constructed in example 3 was subjected to linearized digestion with Sac I, and the digestion product was recovered and purified. Adding 8 mu L of purified product into Pichia pastoris X33 competent cells, transferring into an electric rotating cup, selecting an electric shock program for 4ms (the voltage of electric shock is 1.5kv), quickly adding 1ml of YPDS liquid culture medium after electric shock is finished, transferring into a sterile centrifuge tube after uniform mixing, standing and culturing for 2-6h at 30 ℃, centrifuging for 2min at 5000rpm, washing with physiological saline for 3 times, taking a proper amount of the mixture, coating the mixture on a YPDS flat plate (YPDS formula: 1% yeast extract, 2% tryptone, 2% glucose, 0.5% sorbitol, 2% agar powder added to solid and containing 100 mu g/mLG418), and standing and culturing for 3d to obtain a transformant. The transformant was inoculated into a tube of YPCS liquid medium (1% yeast extract, 2% peptone, casein hydrolysate 0.5%, 0.5% sorbitol, 100. mu.g/mL G418) and cultured at 30 ℃ under shaking at 220rpm for 3d with 1% methanol added every 24 hours. After the fermentation was completed, the mixture was centrifuged at 12000rpm, and the supernatant was collected. Detecting the expression of the target protein by SDS-PAGE electrophoresis, the result is shown in FIG. 4, wherein 1 is blank before induction; 2-14 are post-induction proteins.
Example 5
The recombinant protein obtained by fermentation in example 4 was assayed for protein content
1. Reagent:
(1) the standard protein solution was prepared as a 1.0mg/ml standard protein solution using gamma-globulin or Bovine Serum Albumin (BSA).
(2) Coomassie brilliant blue G-250 dye reagent: 100mg of Coomassie brilliant blue G-250 was weighed out, dissolved in 50ml of 95% ethanol, and then 120ml of 85% phosphoric acid was added, diluted with water to 1 liter.
2. Equipment:
(1) visible light spectrophotometer
(2) Test tube
Drawing a protein content standard curve: 21 tubes were taken and 1.0mg/ml of the standard protein solution was added to each tube: 0. 12.5, 25, 50, 75, 100, 125ul, then made up to 0.5ml with deionized water. Finally, 5.0ml of Coomassie brilliant blue G-250 reagent is added into each test tube respectively, and after each tube is added, the mixture is mixed evenly and stands for 2 minutes. The absorbance A595 at 595nm of each sample was determined on a spectrophotometer with a blank test tube No.1, i.e. 0.5ml H2O plus 5.0ml of G-250 reagent. And (3) drawing by taking the mass (mu g) of the standard protein as an abscissa and the absorbance value A595 as an ordinate to obtain a standard curve.
And (3) sample determination: 0.5mL of the recombinant protein sample prepared in example 3 and 5.0mL of Coomassie Brilliant blue G-250 reagent were added to the tube, mixed well and left for 2 minutes after each tube addition.The absorbance A595 of the sample at 595nm is determined in a spectrophotometer with a blank test tube No.1, i.e. 0.5ml H2And adding 5.0ml G-250 reagent into the O, and calculating the protein content of each sample according to the measured absorbance value by using a standard curve. Protein content in yeast and E.coli expression systems, results are shown in FIG. 5.
As can be seen from FIG. 5, the concentration of the recombinant protease using Pichia pastoris as the expression vector was 98. mu.g/mL, and the concentration of the recombinant protease using Escherichia coli as the expression vector was 62. mu.g/mL. Compared with prokaryotic expression vector, the enzyme production of (+) gamma-lactamase using yeast as expression vector is improved by 58%.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> institute for microorganisms of Hebei province
<120> recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>1539
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgggaatta agttacccac attggaggat ttaagagaga tttctaagca atttaattta 60
gatctagagg atgaggagtt aaaatccttt ttgcaattac taaaactgca gttggaatcc 120
tatgagaggt tagactcctt gccagattat actccaagag ttaagtatca gagaacatta 180
ggtcgaccac ctatgaaaga ggagaatcct tatggtgctt tagtgtggat aacttcgata 240
aagggtaagg aagagggtaa gttaaaggga aaaaggattt gcattaagga caatgtgatg 300
atagcgggta tacctatgct taatggatct aaaatgttag aaggttttgt cccgcatatg 360
gatgctactg tagtttcaag gattctggat gaggctggag aaatcgtagc taagactacg 420
tgtgaggacc tatgcttctc aggaggtagt catacatctt atccttggcc agtactaaat 480
ccgagaaatc cagagtatat ggcaggagga tcatcaagcg gtagtgctgt agcagtagct 540
tctggctatt gtgatatggc tgttggagga gatcaaggag gttcaattag gattcccagt 600
tcgtgggttg gcatatacgg actaaaacca actcatggac tagttccata taccggcgct 660
ttttcctatg agcctacatt agatcatcta ggacctatgg ctaatacggt aaaggatgta 720
gcattacttt tagaggtaat agcagggagg gatgaattgg attcaagaca gccagatagc 780
ctacctccac ctccagtcaa accctattct aaacttattg atggcgacgt aaaagatatg 840
aaagttggca tagttaagga aggatttaat tggtccaatt ctgaaaagga tgttgatgag 900
ttagtattag attctgccaa gaaactagaa gattatggaa taaaagtaga ggatacctcc 960
atacctcttc ataggatggg attggatata tggactccaa tagctattga gggtgccaca 1020
gcaaccatga tattaggaag tggtgtagga tggggaagga agggcttatt tgagactcaa 1080
attgcagatt tctttgggaa ctccttaaaa tccagagcta gagatttacc aaacacggta 1140
aaaggtgtac taatgttagg ctacttaatg ataaagatgt ataacaatag atactacgca 1200
aaggcaagaa atttatcgat tgtgttaaaggaagcttacg acagtgcgtt aaggaaatac 1260
gacgctctaa taatgccaac aactcctatg aaagcaatga ggtataagag tgaaccaggc 1320
tttgatgaat attttataat ggcgctcgga atgataaata atacagctcc ttttgacgtt 1380
actggacacc ctgctatgaa tataccagtg ggatattcga atggtttacc agtcggtctg 1440
atgataatag gaaggcattt tgaagaagac aaggttctaa aattagctaa tgtatttgag 1500
agaatcaaaa aactcgagca ccaccaccac caccactga 1539
<210>2
<211>512
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>2
Met Gly Ile Lys Leu Pro Thr Leu Glu Asp Leu Arg Glu Ile Ser Lys
1 5 10 15
Gln Phe Asn Leu Asp Leu Glu Asp Glu Glu Leu Lys Ser Phe Leu Gln
20 25 30
Leu Leu Lys Leu Gln Leu Glu Ser Tyr Glu Arg Leu Asp Ser Leu Pro
35 40 45
Asp Tyr Thr Pro Arg Val Lys Tyr Gln Arg Thr Leu Gly Arg Pro Pro
50 55 60
Met Lys Glu Glu Asn Pro Tyr Gly Ala Leu Val Trp Ile Thr Ser Ile
65 70 75 80
Lys Gly Lys Glu Glu Gly Lys Leu Lys Gly Lys Arg Ile Cys Ile Lys
85 90 95
Asp Asn Val Met Ile Ala Gly Ile Pro Met Leu Asn Gly Ser Lys Met
100 105 110
Leu Glu Gly Phe Val Pro His Met Asp Ala Thr Val Val Ser Arg Ile
115 120 125
Leu Asp Glu Ala Gly Glu Ile Val Ala Lys Thr Thr Cys Glu Asp Leu
130 135 140
Cys Phe Ser Gly Gly Ser His Thr Ser Tyr Pro Trp Pro Val Leu Asn
145 150 155 160
Pro Arg Asn Pro Glu Tyr Met Ala Gly Gly Ser Ser Ser Gly Ser Ala
165 170 175
Val Ala Val Ala Ser Gly Tyr Cys Asp Met Ala Val Gly Gly Asp Gln
180 185 190
Gly Gly Ser Ile Arg Ile Pro Ser Ser Trp Val Gly Ile Tyr Gly Leu
195 200 205
Lys Pro Thr His Gly Leu Val Pro Tyr Thr Gly Ala Phe Ser Tyr Glu
210 215 220
Pro Thr Leu Asp His Leu Gly Pro Met Ala Asn Thr Val Lys Asp Val
225 230 235 240
Ala Leu Leu Leu Glu Val Ile Ala Gly Arg Asp Glu Leu Asp Ser Arg
245 250 255
Gln Pro Asp Ser Leu Pro Pro Pro Pro Val Lys Pro Tyr Ser Lys Leu
260 265 270
Ile Asp Gly Asp Val Lys Asp Met Lys Val Gly Ile Val Lys Glu Gly
275 280 285
Phe Asn Trp Ser Asn Ser Glu Lys Asp Val Asp Glu Leu Val Leu Asp
290 295 300
Ser Ala Lys Lys Leu Glu Asp Tyr Gly Ile Lys Val Glu Asp Thr Ser
305 310 315 320
Ile Pro Leu His Arg Met Gly Leu Asp Ile Trp Thr Pro Ile Ala Ile
325 330 335
Glu Gly Ala Thr Ala Thr Met Ile Leu Gly Ser Gly Val Gly Trp Gly
340 345 350
Arg Lys Gly Leu Phe Glu Thr Gln Ile Ala Asp Phe Phe Gly Asn Ser
355 360 365
Leu Lys Ser Arg Ala Arg Asp Leu Pro Asn Thr Val Lys Gly Val Leu
370 375 380
Met Leu Gly Tyr Leu Met Ile Lys Met Tyr Asn Asn Arg Tyr Tyr Ala
385 390 395 400
Lys Ala Arg Asn Leu Ser Ile Val Leu Lys Glu Ala Tyr Asp Ser Ala
405 410 415
Leu Arg Lys Tyr Asp Ala Leu Ile Met Pro Thr Thr Pro Met Lys Ala
420 425 430
Met Arg Tyr Lys Ser Glu Pro Gly Phe Asp Glu Tyr Phe Ile Met Ala
435 440 445
Leu Gly Met Ile Asn Asn Thr Ala Pro Phe Asp Val Thr Gly His Pro
450 455 460
Ala Met Asn Ile Pro Val Gly Tyr Ser Asn Gly Leu Pro Val Gly Leu
465 470 475 480
Met Ile Ile Gly Arg His Phe Glu Glu Asp Lys Val Leu Lys Leu Ala
485 490 495
Asn Val Phe Glu Arg Ile Lys Lys Leu Glu His His His His His His
500 505 510
<210>3
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tcaattagga ttcccagttc gtgggttggc a 31
<210>4
<211>29
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
gggaatccta attgaacctc cttgatctc 29
<210>5
<211>31
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
gaattcatgg gaattaagtt acccacattg g 31
<210>6
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gcggccgctc agtggtggtg gtggtggt 28
Claims (10)
1. A recombinant plasmid containing a (+) gamma-lactamase gene, wherein the (+) gamma-lactamase gene is ligated to the vector pMD at EcoRI and NotI restriction sites; the (+) gamma-lactamase gene is a nucleotide sequence shown as SEQ ID No.1 in a sequence table.
2. A recombinant Pichia pastoris producing (+) gamma-lactamase, wherein Pichia pastoris (Pichia pastoris) is used as an expression host, comprising the recombinant plasmid of claim 1.
3. The construction method of the recombinant pichia pastoris according to claim 2, comprising the following steps:
1) linearizing the recombinant plasmid of claim 1, and electrically transforming the linearized recombinant plasmid into pichia pastoris;
2) carrying out static culture on the electrically transformed Pichia pastoris in the step 1) in a liquid culture medium at the temperature of 28-32 ℃ for 2-6 h;
3) separating the pichia pastoris from the liquid culture medium in the step 2), and inoculating the pichia pastoris to a screening culture medium for screening culture to obtain the recombinant pichia pastoris.
4. The construction method according to claim 3, wherein the linearization process in step 1) is performed by an enzymatic hydrolysis method; the linearization enzyme is SacI enzyme.
5. The construction method according to claim 3, wherein the electrotransfer condition in step 1): the voltage of the electric conversion is 1.5Kv, and the electric conversion time is 3-5 ms.
6. The construction method according to any one of claims 3 to 5, wherein the screening medium in the step 3) takes a liquid culture medium as a basic medium, and comprises geneticin with a mass concentration of 80 to 120 μ g/mL and agar powder with a mass percentage concentration of 2% to 3%; the liquid culture medium comprises the following components in percentage by mass: 1% yeast extract, 2% tryptone, 2% glucose, 0.5% sorbitol.
7. The recombinant pichia pastoris of claim 2 or the recombinant pichia pastoris constructed by the method of any one of claims 3 to 6, and the application thereof in fermentation production of (+) gamma-lactamase.
8. The use according to claim 7, wherein the fermentation medium comprises 1% by mass of yeast extract, 2% by mass of peptone, 0.5% by mass of casein hydrolysate, 0.5% by mass of sorbitol and 100 μ g/mL of geneticin.
9. The use according to claim 7, wherein the temperature of the fermentation is 28-32 ℃; the fermentation time is 60-96 hours;
the fermentation is oscillation fermentation; the rotation speed of the oscillating fermentation is 180-230 rpm.
10. The use according to any one of claims 7 to 9, wherein methanol is added every 20 to 28 hours during the fermentation production period, and the volume concentration of the methanol in the obtained fermentation liquid is 0.8 to 1.2%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711077526.XA CN107794275B (en) | 2017-11-06 | 2017-11-06 | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711077526.XA CN107794275B (en) | 2017-11-06 | 2017-11-06 | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107794275A CN107794275A (en) | 2018-03-13 |
| CN107794275B true CN107794275B (en) | 2020-04-21 |
Family
ID=61549112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711077526.XA Active CN107794275B (en) | 2017-11-06 | 2017-11-06 | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107794275B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109295078B (en) * | 2018-11-08 | 2022-05-24 | 河北省微生物研究所有限公司 | Pyranose oxidase gene, preparation method thereof, pichia pastoris constructed by using pyranose oxidase gene and application of pichia pastoris |
| CN110506839A (en) * | 2019-09-27 | 2019-11-29 | 华中农业大学 | A kind of feather flour additive agent, preparation method and applications |
| CN111621492B (en) * | 2020-06-15 | 2021-10-26 | 安徽红杉生物医药科技有限公司 | Lactamase and application thereof, and method for preparing (1R,4S) -wenskolide by enzymatic resolution |
| CN112442474B (en) * | 2020-12-09 | 2022-08-23 | 江南大学 | Preparation method of (-) gamma-lactam |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921742A (en) * | 2010-06-23 | 2010-12-22 | 中国科学院微生物研究所 | (+) gamma-lactamase with activity on splitting racemate gamma-lactam as well as coded gene and application thereof |
| CN102648285A (en) * | 2009-08-06 | 2012-08-22 | Cmc依科斯生技制品公司 | Methods for improving recombinant protein expression |
| CN102796720A (en) * | 2012-08-16 | 2012-11-28 | 北京化工大学 | (+)gamma-lactamase with racemate gamma-lactam resolution activity and its application |
| CN104630194A (en) * | 2015-02-01 | 2015-05-20 | 北京化工大学 | (+)-gamma-lactamase from microbacterium as well as coding gene and application of (+)-gamma-lactamase |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2722446A1 (en) * | 2008-04-25 | 2009-10-29 | Bruce L. Grasberger | Protein engineering of monoacylglycerol lipase (mgll) |
| JP2018526969A (en) * | 2015-06-04 | 2018-09-20 | バイオアンバー インコーポレイテッドＢｉｏａｍｂｅｒ Ｉｎｃ． | Biobased production of functionalized alpha-substituted acrylates and C4 dicarboxylates |
-
2017
- 2017-11-06 CN CN201711077526.XA patent/CN107794275B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102648285A (en) * | 2009-08-06 | 2012-08-22 | Cmc依科斯生技制品公司 | Methods for improving recombinant protein expression |
| CN101921742A (en) * | 2010-06-23 | 2010-12-22 | 中国科学院微生物研究所 | (+) gamma-lactamase with activity on splitting racemate gamma-lactam as well as coded gene and application thereof |
| CN102796720A (en) * | 2012-08-16 | 2012-11-28 | 北京化工大学 | (+)gamma-lactamase with racemate gamma-lactam resolution activity and its application |
| CN104630194A (en) * | 2015-02-01 | 2015-05-20 | 北京化工大学 | (+)-gamma-lactamase from microbacterium as well as coding gene and application of (+)-gamma-lactamase |
Non-Patent Citations (6)
| Title |
|---|
| "(+) γ-内酰胺酶研究进展";王金昌等;《江西科学》;20151231;第33卷(第6期);第807-811页 * |
| "Amidases: versatile enzymes in nature";Sharma M et al.;《Reviews in Environmental Science and Biotechnology》;20091024;第8卷;第343-366页 * |
| "Discovery and characterization of a second extremely thermostable (+)-γ-lactamase from Sulfolobus solfataricus P2";Shaozhou Zhu et al.;《Journal of Bioscience and Bioengineering》;20151210;第121卷(第5期);第484-490页 * |
| "Molecular and biochemical characterization of the recombinant amidase from hyperthermophilic archaeon Sulfolobus solfataricus";Abusco A D et al.;《Extremophiles》;20010522;第5卷;第183-192页 * |
| "The use of a thermostable signature amidase in the resolution of the bicyclic synthon (rac)-γ-lactam";H. S. Toogood et al.;《Tetrahedron》;20041231;第60卷;第711-716页 * |
| "点青霉葡萄糖氧化酶基因的克隆及其酶学性质研究";高庆华等;《生物技术通报》;20161231;第32卷(第7期);第152-159页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107794275A (en) | 2018-03-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107794275B (en) | Recombinant pichia pastoris for producing (+) gamma-lactamase and construction method and application thereof | |
| US10865404B1 (en) | Aspartase mutant, recombinant expression vector and recombinant bacterium containing aspartase mutant, and use thereof | |
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| US20200255875A1 (en) | Method for preparing l-aspartic acid with maleic acid by whole-cell biocatalysis | |
| CN110358750B (en) | Novel sucrose phosphorylase mutant and application thereof in synthesis of glycerol glucoside | |
| CN108865962B (en) | Escherichia coli engineering bacterium capable of efficiently and soluble expressing 4-alpha-glycosyltransferase | |
| CN110938616A (en) | Mutant of nitrile hydratase derived from hot spring thermokalite bacillus | |
| CN112391372A (en) | Glutamic acid decarboxylase mutant, genetic engineering bacterium and application thereof | |
| CN113025542B (en) | Recombinant escherichia coli for producing L-glutamine and construction method and application thereof | |
| CN113637654B (en) | Recombinant phospholipase D mutant and application thereof in synthesis of phosphatidylserine | |
| CN111575265B (en) | Keratinase mutant with improved thermal stability | |
| CN110129305B (en) | Cephalosporin C acylase mutant for preparing 7-ACA | |
| CN110592119A (en) | Novel pullulanase derived from paenibacillus and gene and application thereof | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN112481320B (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| US20210238576A1 (en) | L-aspartate alpha-decarboxylase Mutant and Application thereof | |
| CN107201375B (en) | Construction method and application of genetic engineering strain for producing (R, R) -2, 3-butanediol | |
| CN112725315B (en) | Application of chitosanase and mutant thereof in preparation of chitosan oligosaccharide | |
| CN110804602B (en) | L-aspartic acid beta-decarboxylase mutant and application thereof | |
| CN111004794B (en) | Subtilisin E mutant with improved thermal stability and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN109943583B (en) | Method for preparing ribavirin by using genetically engineered bacteria | |
| CN113249352A (en) | N-glycosyltransferase mutant P1 and application thereof | |
| CN107119035B (en) | Phenylalanine mutase, coding gene, recombinant vector, host cell, multiple PCR primer and application thereof | |
| CN112442474B (en) | Preparation method of (-) gamma-lactam |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: No. 2089, Wusi Middle Road, Baoding City, Hebei Province 071051 Patentee after: Hebei Institute of Microbiology Co.,Ltd. Address before: 071000 No. 2089, Wusi Middle Road, Baoding City, Hebei Province Patentee before: HEBEI Research Institute OF MICROBIOLOGY |
|
| CP03 | Change of name, title or address |