CN1683541A - Method for constructing human neurenergen-3 receptor gene recombination adenovirus - Google Patents

Method for constructing human neurenergen-3 receptor gene recombination adenovirus Download PDF

Info

Publication number
CN1683541A
CN1683541A CN 200510033569 CN200510033569A CN1683541A CN 1683541 A CN1683541 A CN 1683541A CN 200510033569 CN200510033569 CN 200510033569 CN 200510033569 A CN200510033569 A CN 200510033569A CN 1683541 A CN1683541 A CN 1683541A
Authority
CN
China
Prior art keywords
trkc
cell
neurenergen
gene
stem cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 200510033569
Other languages
Chinese (zh)
Other versions
CN100402655C (en
Inventor
曾园山
王俊梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Zhongda Zhongshan Medical Technology Development Co.,Ltd.
Sun Yat Sen University
Original Assignee
Science And Technology Development Centre Of Zhongshan Medical College Of Zhongs
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Science And Technology Development Centre Of Zhongshan Medical College Of Zhongs filed Critical Science And Technology Development Centre Of Zhongshan Medical College Of Zhongs
Priority to CNB2005100335699A priority Critical patent/CN100402655C/en
Publication of CN1683541A publication Critical patent/CN1683541A/en
Application granted granted Critical
Publication of CN100402655C publication Critical patent/CN100402655C/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the construction method and application of one kind of human neurenergen-3 receptor gene (human TrkC gene) recombined adenovirus expressing vector. The basic scheme of the present invention includes: designing and synthesizing primer, RT-PCR process, construction and identification of cloned shuttle vector pShuttle-TrkC, construction and identification of recombined adenovirus vector pAdeno-TrkC, 293 cell packaging, identification of recombined adenovirus, bioactivity detection of human neurenergen-3 receptor gene recombined adenovirus expressing vector and other steps. The present invention is superior in that one kind gene recombined adenovirus expressing vector is selected to promote the survival of damaged central neure and the regeneration of axone, to promote nerve stem cell to differentiate into more neures to replace damaged or dead neures.

Description

Human neurenergen 3 receptor gene recombination ad virus construction process
Technical field
The present invention relates to a kind of construction process of recombinant adenoviral expressing vector, especially a kind of construction process and application thereof of using the adenovirus expression carrier of human neurenergen 3 acceptor gene (people TrkC gene) reorganization.
Background technology
Neurotrophic factor is to support the body neuronal survival, promotes its growth, differentiation, and keeps a class chemokines of its function.Neural neurotrophic factor plays its target cell before the cytology effect, at first will with the receptors bind on the target cell.Present known neurotrophic factor has two kinds of acceptors: tyrosine protein kinase acceptor (high-affinity receptor) and p75 acceptor (low-affinity receptor).The tyrosine protein kinase acceptor is by a kind of acceptor of proto-oncogene Trk coding, also is called the Trk acceptor.The Trk acceptor can be divided into 3 kinds of TrkA, TrkB and TrkC again.
Neurotrophic factor comprises nerve growth factor (NGF), Brain Derived Neurotrophic Factor (BDNF), neurenergen 3 (NT-3) and neurenergen-4/5 (NT-4/5) etc., they respectively with different neurotrophic factor acceptor combinations.Nerve growth factor combines with TrkA and can cause that the cytology reaction comprises the survival and the growth of intensifier target cell.Brain Derived Neurotrophic Factor, neurenergen-4/5 and neurenergen 3 all can in conjunction with and activate TrkB, but a little less than the effect of neurenergen 3.Main combination of neurenergen 3 and activation TrkC.So Trk acceptor (TrkA, TrkB and TrkC) is the functional receptor of neurotrophic factor.
Using neurotrophic factor treatment central nervous system injury is one of focus of research at present, and mostly employed be neurenergen 3, nerve growth factor and Brain Derived Neurotrophic Factor.Prove that now nerve growth factor mainly acts on Sensory neurone, not obvious to the motor neuron effect, and the neuron type scope of Brain Derived Neurotrophic Factor effect is narrower.Many researchs think, neurenergen 3 plays an important role to neuronic growth and differentiation and to the axoneuron survival and the axon regeneration thereof of damage.Studies confirm that in addition neurenergen 3 has obvious facilitation to the regeneration of Spinal injury place tractus corticospinalis nerve fiber.Known neurenergen 3 can specific combination and is activated it and be distributed in neurenergen 3 acceptor TrkC on the neuronal cell film, brings into play its biological effect effect.
Have result of study to show, neurenergen 3 also has effect to the differentiation of neural stem cell.(2002) such as Takahashi etc. (1999) and Castellanos discover that neurotrophic factor can make the neural stem cell that has TrkC be divided into neurone more.Therefore, we are transplanted to the Spinal injury place with the TrkC gene transfection at design after neural stem cell, allow neural stem cell have the neurenergen 3 acceptor; Transplant simultaneously the schwann cell of neurenergen 3 genetic modification together, allow the transgenosis schwann cell cross the expression neurenergen 3, the cell differentiation of nerve cord that promotes to have the neurenergen 3 acceptor better is a neurone, grow aixs cylinder, form neural network at the Spinal injury place, play uplink and downlink conduction nerve pathway function served as bridge, repair spinal cord autokinetic movement function.We think may more effectively promote the reparation of Spinal Cord 26S Proteasome Structure and Function by this therapeutic strategy, for clinical treatment spinal cord injuries receptor disease and even brain trauma provide novel method.
Summary of the invention
At present, do not see construction process and technology that documents and materials report human neurenergen 3 acceptor gene (people TrkC gene) recombinant adenoviral expressing vector is arranged at home and abroad as yet, the objective of the invention is to want to overcome the deficiency on the method for existing clinical treatment nervus centralis trauma, design a kind of construction process of adenovirus expression carrier of the TrkC gene recombination of choosing, for the nervus centralis 26S Proteasome Structure and Function reparation of clinical promotion damaged and new application of gene therapy medicament provide guidance.
General planning of the present invention comprises:
(1) design of primers is synthetic: from GenBank retrieval people TrkC gene, at full length gene design two ends primer.
(2) RT-PCR process: get human brain mRNA and carry out reverse transcription, reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing.
(3) structure and the evaluation of clone's shuttle vectors pShuttle-TrkC: get the RT-PCR reaction solution, behind 0.8% agarose gel electrophoresis, rubber tapping purifying goal gene (TrkC) segment.Connect purifying TrkC gene and linearizing pShuttlc, with product amplification and extraction plasmid, the sequence of goal gene in the plasmid is identified in order-checking again.
(4) structure of recombinant adenoviral vector pAdeno-TrkC and evaluation: pShuttle-TrkC is connected with the adenovirus skeleton plasmid, increases after ordinary method transforms and extract plasmid, and order-checking is identified.
(5) 293 cells packings: pAdeno-TrkC is with liposome-mediated transfection HEK293 cell, the 10th day appearance 293 cytopathies after the transfection.Collect sick cell and obtain the thick lysate of virus for 3 times in-80 ℃/37 ℃ multigelations, and repeated infection 293 cell amplification viruses.
(6) evaluation of recombinant adenovirus: 1. PCR identifies: the extracting viral DNA is a template, carries out PCR with the upstream and downstream primer of goal gene and identifies.2. RT-PCR identifies: Ad-TrkC infects harvested cell behind 293 cells, extracts total RNA with Trizol reagent and carries out reverse transcription.Reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing.3. immunocytochemical stain: above-mentioned thick cracked virus liquid inductance is dyed the neural stem cell ball of vitro culture, confirm whether Ad-TrkC transfection with immunocytochemical stain.4. Western blot: thick cracked Ad-TrkC virus liquid inductance dyed neural stem cell after 24 hours, and whether lysing cell is Western blot and is confirmed to have TrkC to express.
(7) biologic activity of human neurenergen 3 receptor gene recombination ad virus expression vector detects: vitro culture is taken from the neural stem cell of green fluorescence mouse hippocampus, observes neurenergen 3 and neurenergen 3 acceptor are induced differentiation to the neural stem cell of vitro culture influence.
Described neurenergen 3 acceptor can promote the axoneuron survival and the axon regeneration thereof of neuronic growth and differentiation and damaged with after the neurenergen 3 specificity combines; Can promote that also cell differentiation of nerve cord is a neurone.That neural stem cell is meant is undifferentiated relatively in the neural system, have the cell of propagation and differentiation potential.Under certain condition, it can neuralward unit and neurogliocyte differentiation.It can be separated from grow even in the nervus centralis of growing up.
Advantage of the present invention is remarkable.This research selects a kind of gene recombinant adenovirus expression vector to promote the axoneuron survival and the axon regeneration thereof of damaged, and promotes that neural stem cell is divided into neurone more, replaces the neurone or the dead neurone of damaged.Prevent and treat basic research to endangering bigger traumatic nervus centralis disease of people ' s health such as spinal cord injuries receptor etc., will effectively promote the development of whole traumatic nervus centralis diseases prevention and treatment research field.This research concentrates strength on carrying out the work of system, strengthens the research to aspects such as post-traumatic cell therapy of nervus centralis and cell replacements on molecule and cell levels.This improves and hinder patient's life quality prolonging human longevity, alleviates society and family burden, promotes the Chinese society Economic development, and is all significant.The present invention will make the traumatic nervus centralis diseases prevention and treatment level of China occupy the leading level in the world.
Embodiment
Below by specific embodiment the present invention used key instrument and reagent are done detailed description:
1. key instrument
PCR instrument (Gene Amp pcr system 9700), refrigerated centrifuge (Beckman), ultra-high speed whizzer (U.S. Beckman company), CO 2Incubator (NAPCO company), PRISM377DNA sequenator (American AB I company), high speed tabletop centrifuge 5415D (German eppendorf) and BeckmanDV640 type uv-spectrophotometric instrument (U.S. Beckman company product).
2. carrier and bacterial strain
Adeno-X TMExpressien System test kit is a Clontech company product, and HEK293 cell strain and bacillus coli DH 5 alpha are that be so kind as to give in treatment and prevention of tumour center Huang Wenlin professor laboratory.
3. the main agents of gene recombinant adenovirus expression vector
RT-PCR test kit, Trizol are Promege company product, restriction enzyme XbaI, KpnI, DNA MarkerDL2000, DNA Ligation Kit Ver.2 are Dalian Takara company product, DNA Marker 1 KB Ladder is that biotech firm's product can be widely collected in the Shen, human brain mRNA is Junxuan Biological Technology Co., Ltd., Shenzhen City's product, and plasmid extraction kit, QIAquick (R) Gel Extraction Kit are QIAGEN company product.Agarose Gel is a Biowest company product, Lipofectamine TM2000 available from Invitrogen company.The ELISA test kit is available from Wuhan doctor's moral company.
4. used zooblast and the main agents of biological activity assay
The hippocampal tissue of green fluorescence (GFP) mouse (being provided by neural professor Wang Yanhua of institute of unming Medical College) is provided neural stem cell, and bFGF, B27, RPMI 1640 and DMEM/F12 are available from Gibico company; The SABC-Cy3 test kit is available from Wuhan doctor's moral company; Mouse anti human TrkC monoclonal antibody is available from R﹠amp; D company.
The detailed concrete operations technical specification of the present invention is as follows:
1. design of primers is synthetic: from GenBank retrieval people TrkC gene, and at full length gene, design two ends primers (primer is synthetic by Shanghai Shen Gong Bioisystech Co., Ltd).Upstream primer: 5 ' TGTCTAGAA GCAGCGATCGGAGATG3 '; Downstream primer: 5 ' ACGGTACCACTAGCCAAGAATGTC 3 '.Primer 5 ' end in upstream and downstream comprises XbaI and KpnI restriction enzyme digestion sites respectively, and amplified production is 2500bp.
2.RT-PCR: get human brain mRNA and carry out reverse transcription, reaction system is with reference to the explanation of the Reverse trancriptionsystem of promege company test kit.42 ℃ of 60min reverse transcriptions, 95 ℃ of 5min deactivation ThermoScript II AMV; Be PCR:94 ℃ of 1min, 50 ℃ of 1min30s, 72 ℃ of 3min then, 35 circulations, last 72 ℃ of 7min.Other establishes a negative control, replaces cDNA with dH20, and is surplus identical.Reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing.
3. structure and the evaluation of clone's shuttle vectors pShuttle-TrkC: get the RT-PCR reaction solution, behind 0.8% agarose gel electrophoresis, with QLAquik (R) Gel Excraction Kity test kit, rubber tapping purifying goal gene segment.Cut glue with XbaI and KpnI double digestion goal gene and carrier pshuttle with Gel Extraction Kit test kit respectively, press DNA LigationKit Ver.2 test kit explanation preparation ligation system, 16 ℃ are incubated overnight.Connect purifying TrkC gene and linearizing pShuttle, product transforms the puzzled attitude that is subjected to of DH5 α bacterium according to a conventional method, and it is dull and stereotyped that transformed bacteria is coated the LB fine jade sugar that contains the 20mg/ml kantlex, 37 ℃ of overnight incubation.The bacterium colony of picking survival, amplification is also extracted plasmid, and after PCR evaluation and XbaI and KpnI double digestion were identified, the sequence of goal gene in the plasmid was identified in order-checking again.
4. the structure of recombinant adenoviral vector pAdeno-TrkC and evaluation: behind pShuttle-TrkC usefulness I-CeuI and PI-SceI double digestion, with Adeno-X TMAdenovirus skeleton plasmid in the Expression System test kit (cutting with PI-SceI with I-CeuI) is connected, and ordinary method is coated the LB agarose plate that contains 50mg/ml ammonia benzyl with transformed bacteria, 37 ℃ of incubated overnight after transforming.Picking colony, PCR are identified, select the positive colony amplification and extract plasmid, and I-CeuI and PI-SceI double digestion and HindIII and XhoI single endonuclease digestion are identified, and order-checking is identified.
5.293 cell packing: after pAdeno-TrkC is cut into linearity with the PacI enzyme, with liposome-mediated in 24 orifice plates transfection HEK293 cell, after cell covers with, change 25m over to 2Continue to cultivate the 10th day appearance 293 cytopathy CPE (cytopathic effect) after the transfection in the culturing bottle.Collect sick cell and obtain the thick lysate of virus for 3 times in-80 ℃/37 ℃ multigelations, and repeated infection 293 cell amplification viruses.
6. the evaluation of recombinant adenoviral vector Adeno-TrkC:
(1) PCR identifies: the extracting viral DNA is a template, carries out PCR with the upstream and downstream primer of goal gene and identifies.Reaction conditions is: 94 ℃ of 1min, 50 ℃ of 1min30s, 72 ℃ of 3s, 35 circulations, last 72 ℃ of 7min.Positive control is template with pAdeno-TrkC, and negative control is template with water, and is surplus identical.
(2) RT-PCR identifies: Adeno-TrkC infects 293 cells harvested cell after 48 hours, and Trizol reagent extracts total RNA and carries out reverse transcription, and reaction system is with reference to the Reverse trancription system of promege company test kit specification sheets.42 ℃ of 60min reverse transcriptions, 95 ℃ of 5min deactivation ThermoScript II AMV, reverse transcription obtains cDNA.With it as template, the intragenic one section 112bp sequence of pcr amplification TrkC.Design two ends primer (primer is synthetic by Shanghai Shen Gong Bioisystech Co., Ltd) are carried out PCR and are identified.Upstream primer is: 5 ' TTGGATCCTCACCACTGATGACAG3 '; Downstream primer is: 5 ' TTGCTGCTTTTGCCTGTGTCCTG 3 '.Reaction conditions is: 94 ℃ of 50s, 55 ℃ of 50s, 72 ℃ of 1min, 35 circulations, last 72 ℃ of 7min.Other establishes a negative control, and the cDNA that becomes with the RNA reverse transcription of 293 cells of untransfected virus is a template, and is surplus identical.Positive control is a template with plasmid pAdeno-TrkC.Reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing.
(3) vitro culture of mouse neural stem cell (NSC): the green fluorescence mouse sacrificed by decapitation in the 24h that will be born, in D-Hank ' s liquid, isolate hippocampus, shred, 0.25% tryptic digestion 10 minutes, serum stops, and adds DMEM/F12 (containing 20ng/mlbFGF, 20 μ l/mlB27) serum-free medium and makes 1 * 10 4/ ml single cell suspension is in 37 ℃, 5%CO 2Carry out suspension culture in the incubator, about about 3 days formation neural stem cell balls.
(4) immunocytochemical stain: the neural stem cell ball of above-mentioned vitro culture, 0.25% tryptic digestion becomes unicellular, be inoculated in 24 orifice plates that poly-lysine handled, the 24h adherent growth is after thick cracked virus liquid inductance dyes and cultivates 48h approximately, with 2.5% Paraformaldehyde 96 fixed cell, mouse-anti-human T rkC is an anti-immunocytochemical stain of doing, the DAB colour developing, the NSC transfection Ad-LacZ of negative control, the NSC of blank does not have Adenovirus Transfection.
(5) Western blot: thick cracked Adeno-TrkC virus liquid inductance dyes 25cm 2Neural stem cell (about 2 * 10 6Individual), transfection after 24 hours lysing cell be Western blot, one anti-is mouse-anti-human T rkC.The neural stem cell of setting up the neural stem cell of Ad-LacZ transfection simultaneously and not adding viral liquid in contrast.
7. the biologic activity of people TrkC gene recombinant adenovirus expression vector detects: vitro culture is taken from the neural stem cell of green fluorescence mouse hippocampus.Be made into 4 * 10 4Individual/the ml cell suspension, insert in 96 orifice plates and cultivate, every hole 50 μ l, nutrient solution changes the DMEM/F12 that contains 10%FBS into.Experiment divides 4 groups, Ad-TrkC+Ad-NT-3 group, Ad-NT-3 group, Ad-TrkC group and Ad-LacZ group, every group of 6 holes, one of them negative contrast, totally 24 holes.Ad-TrkC+Ad-NT-3 organizes every hole and adds the thick lytic virus liquid 100 μ l of Ad-TrkC and Ad-NT-3 simultaneously and infect excretory supernatant 100 μ l behind 293 cells, Ad-NT-3 group adds Ad-NT-3 and infects excretory supernatant 100 μ l behind 293 cells, the Ad-TrkC group adds the thick lytic virus liquid 100 μ l of Adeno-TrkC, and the Ad-LacZ group adds Adeno-LacZ virus liquid 100 μ l.Fix with 2.5% Paraformaldehyde 96 after cultivating 2d, do the SABC-Cy3 immunofluorescence cell chemical staining of MAP-2, GFAP and nestin, observe NT-3 and TrkC induce differentiation to the neural stem cell of vitro culture influence.Under the fluorescent microscope (200 times) with eyepiece test grid counting neural stem cell (green fluorescence) and the immune labeled positive cell (red fluorescence) of Cy3, and double-tagging (yellow) quantity, 3 visuals field are got in every hole at random, every group of totally 15 visuals field.Calculating cell differentiation of nerve cord is the percentage that dissimilar cell count account for total cell count, uses the SPSS10.0 statistical software and does the x2 check.
8. experimental result shows:
(1) RT-PCR: the RT-PCR product is carried out agarose gel electrophoresis, the specific band of a visible about 2500bp, (2500bp) is consistent with theoretical expected value, and negative control does not have segment and expands.
(2) cloning vector pShuttle-TrkC identifies: the picking colony amplification, behind the extraction plasmid, cut observations behind the agarose gel electrophoresis with XbaI+KpnI, KpnI, SacI and SalI enzyme.As seen 6.5kb, 6.2kb, 4.0kb, 2500bp and 320bp, band.Sequencing result shows that the people TrkC gene order of insertion is identical with the cDNA sequence of Genbank login.
(3) evaluation of recombinant adenoviral vector pAdeno-TrkC: after the penbritin screening, amplification survival bacterium colony extracts plasmid, and XhoI and HindIII enzyme are cut, observations behind the electrophoresis.As seen 14.5kb, 8.1kb, 8.0kb, 7.5kb, 5.9kb, 5.3kb, 4.6kb, 3.8kb, 3.1kb, 3.0kb, 2937bp, 2802bp, 2466bp, 2081bp, 1445bp, 595bp and 75bp.I-CeuI and PI-SceI double digestion, the result is the adenovirus skeleton of 32kb and the expression cassette of 3.8kb.
(4) cell packing: liposome transfection pAdeno-TrkC went into behind 293 cells 4-5 days, and pathological changes such as circle appear shrinking, become in 293 cells, and plaque appears in 9-10 days cells, and sick cell is original shape around the plaque, has the part cell to peel off on the 12nd day.
The Adeno-TrkC of (5) 293 cells identifies: 293 cells of transfection Adeno-TrkC and 293 cells of untransfected all have specific band, be sxemiquantitative RT-PCR, and specific band is done gray analysis.
(6) vitro culture neural stem cell: cultivated approximately 3 days, neural stem cell can form the neural stem cell ball.
(7) immunocytochemical stain: the neural stem cell of transfection Adeno-TrkC is the TrkC positive staining, the NT-3 of the neural stem cell of transfection Adeno-LacZ and the neural stem cell dyeing that is negative own.
(8) Western blot: the neural stem cell of transfection Adeno-TrkC has specificity T rkC band, and the molecular weight size is about 145KD.Negative control and blank all do not have this specific band.
The comparison that 4 groups of cell differentiation of nerve cord of subordinate list are MAP-2, GFAP and nestin positive percentage
Group ????????????MAP-2 ?????????????GFAP ????????????nestin
Positive cell number Total cellular score Positive percentage (%) Positive cell number Total cellular score Positive percentage (%) Positive cell number Total cellular score Positive percentage (%)
?Ad-TrkC+ ?Ad-NT-3 ?Ad-NT-3 ?Ad-TrkC ?Ad-LacZ ??91? ? ??70? ??61? ??87 ??165? ? ??164? ??147? ??292 ??55.2? ? ??42.7? ??41.5? ??29.8 ??68? ? ??86? ??69? ??97 ??218? ? ??212? ??167? ??185 ??31.2? ? ??40.6? ??41.3? ??52.4 ??52? ? ??66? ??68? ??77 ??214? ? ??196? ??186? ??163 ????24.3? ? ????33.7? ????36.6? ????47.2
Annotate: Ad-TrkC+Ad-NT-3 VS Ad-NT-3, Ad-TrkC+Ad-NT-3 VS Ad-TrkC, Ad-TrkC+Ad-NT-3 d-TrkC VSAd-LacZ, Ad-NT3 VS Ad-LacZ, Ad-TrkC VS Ad-LacZ, P<0.05; Ad-NT-3 VS Ad-TrkC, P>0.05
(9) activity of Adeno-TrkC detects: behind the vitro culture 2d, most neural stem cell are adherent basically and grow projection gradually and be differentiation state.Show all have the part cell to be divided into MAP-2, GFAP and nestin positive cell in 4 groups the neural stem cell according to the immunofluorescence chemical staining.Through observing and counting is found (subordinate list), the MAP2 positive percentage of Ad-TrkC+Ad-NT-3 group is apparently higher than other each group, and GFAP, nestin positive percentage are starkly lower than other each group, and significant difference (P<0.05) is arranged; The MAP-2 positive percentage of Ad-NT-3 group and Ad-TrkC group is organized apparently higher than Ad-LacZ, and GFAP, nestin positive percentage are starkly lower than Ad-LacZ and organize, and significant difference (P<0.05) is arranged; Indifference (P>0.05) between Ad-NT-3 group and Ad-TrkC group.
9. experimental result shows: use external connection method and made up people TrkC gene recombinant adenovirus expression vector (Adeno-TrkC), this recombinant adenoviral vector can be expressed in neural stem cell, and have and promote that cell differentiation of nerve cord is the active effect of neuron cell, this unites and carries out the research of gene therapy central nervous system injury and lay a good foundation for further using NT-3 and TrkC.

Claims (1)

1. a human neurenergen 3 receptor gene recombination ad virus construction process is characterized in that this method comprises
(1) design of primers is synthetic: from GenBank retrieval people TrkC gene, at full length gene design two ends primer;
(2) RT-PCR process: get human brain mRNA and carry out reverse transcription, reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing;
(3) structure and the evaluation of clone's shuttle vectors pShuttle-TrkC: get the RT-PCR reaction solution, behind 0.8% agarose gel electrophoresis, rubber tapping purifying goal gene (TrkC) segment; Connect purifying TrkC gene and linearizing pShuttle, with product amplification and extraction plasmid, the sequence of goal gene in the plasmid is identified in order-checking again;
(4) structure of recombinant adenoviral vector pAdeno-TrkC and evaluation: pShuttle-TrkC is connected with the adenovirus skeleton plasmid, increases after ordinary method transforms and extract plasmid, and order-checking is identified;
(5) 293 cells packings: pAdeno-TrkC is with liposome-mediated transfection HEK293 cell, the 10th day appearance 293 cytopathies after the transfection; Collect sick cell and obtain the thick lysate of virus for 3 times in-80 ℃/37 ℃ multigelations, and repeated infection 293 cell amplification viruses;
(6) evaluation of recombinant adenovirus: 1. PCR identifies: the extracting viral DNA is a template, carries out PCR with the upstream and downstream primer of goal gene and identifies; 2. RT-PCR identifies: Ad-TrkC infects harvested cell behind 293 cells, extracts total RNA with Trizol reagent and carries out reverse transcription; Reaction extracts reaction solution 5ml in 1% agarose gel electrophoresis, the gel imaging system observations after finishing; 3. immunocytochemical stain: above-mentioned thick cracked virus liquid inductance is dyed the neural stem cell ball of vitro culture, confirm whether Ad-TrkC transfection with immunocytochemical stain; 4. Western blot: thick cracked Ad-TrkC virus liquid inductance dyed neural stem cell after 24 hours, and whether lysing cell is Western blot and is confirmed to have TrkC to express;
(7) biologic activity of human neurenergen 3 receptor gene recombination ad virus expression vector detects: vitro culture is taken from the neural stem cell of green fluorescence mouse hippocampus, observes neurenergen 3 and neurenergen 3 acceptor are induced differentiation to the neural stem cell of vitro culture influence.
CNB2005100335699A 2005-03-17 2005-03-17 Method for constructing human neurenergen-3 receptor gene recombination adenovirus Expired - Fee Related CN100402655C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNB2005100335699A CN100402655C (en) 2005-03-17 2005-03-17 Method for constructing human neurenergen-3 receptor gene recombination adenovirus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2005100335699A CN100402655C (en) 2005-03-17 2005-03-17 Method for constructing human neurenergen-3 receptor gene recombination adenovirus

Publications (2)

Publication Number Publication Date
CN1683541A true CN1683541A (en) 2005-10-19
CN100402655C CN100402655C (en) 2008-07-16

Family

ID=35263041

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2005100335699A Expired - Fee Related CN100402655C (en) 2005-03-17 2005-03-17 Method for constructing human neurenergen-3 receptor gene recombination adenovirus

Country Status (1)

Country Link
CN (1) CN100402655C (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101709292A (en) * 2009-11-04 2010-05-19 徐州医学院 Recombinant adenovirus, and preparation method and application thereof
CN1958788B (en) * 2006-04-13 2011-05-18 黄文林 Gene recombined virus of human neurenergen 3
CN101680002B (en) * 2007-04-23 2011-11-23 核力康健生物医药技术(天津)有限公司 A series of recombinant adeno-associated viral vectors, construction methods and uses thereof
CN110812532A (en) * 2019-08-20 2020-02-21 中山大学 Construction method of tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003071872A1 (en) * 2002-02-22 2003-09-04 University Of Maryland, Baltimore Novel treatment of neurodegenerative diseases by altering levels of trkb isoforms and/or trkc isoforms

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1958788B (en) * 2006-04-13 2011-05-18 黄文林 Gene recombined virus of human neurenergen 3
CN101680002B (en) * 2007-04-23 2011-11-23 核力康健生物医药技术(天津)有限公司 A series of recombinant adeno-associated viral vectors, construction methods and uses thereof
CN101709292A (en) * 2009-11-04 2010-05-19 徐州医学院 Recombinant adenovirus, and preparation method and application thereof
CN110812532A (en) * 2019-08-20 2020-02-21 中山大学 Construction method of tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection

Also Published As

Publication number Publication date
CN100402655C (en) 2008-07-16

Similar Documents

Publication Publication Date Title
Sun et al. Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease
CN1934243B (en) Immortalized avian cell lines for virus production
CN104797593A (en) AAV vectors targeted to oligodendrocytes
CN102741405A (en) System for increasing gene expression, and vector supporting said system
JP3953399B2 (en) Immortalized bone marrow mesenchymal stem cells
US20220401518A1 (en) Mesenchymal stem cell expressing hepatocyte growth factor, and use thereof
CN104910278B (en) A kind of slow virus with high-efficiency transfection ability and biological activity for being used to prepare CART cells
CN100402655C (en) Method for constructing human neurenergen-3 receptor gene recombination adenovirus
CN108913813A (en) For identifying the primer sets of DAdV-2 and DAdV-3
CN108588026A (en) The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10
CN1289682C (en) Expression of genes in modified vaccinia virus ankara by using the cowpox ATI promoter
CN104892770B (en) It is a kind of that there is efficient infection to T cell and candidate stem cell and promote the slow virus carrier of multiplication capacity
CN110079553B (en) Biological agent for enhancing disease resistance and epidemic disease resistance of pigs
CN113684184A (en) Method for preparing chimeric antigen receptor NK (natural killer) cells of targeted CD19 from human pluripotent stem cells and application of method
CN113201508A (en) Recombinant Newcastle disease oncolytic virus and preparation method and application thereof
CN110272480B (en) Duck alpha interferon and mutant thereof, preparation method and application
US20050186181A1 (en) Selective precipitation of viruses
CN113151171B (en) Pig alveolar macrophage healthy cell line, construction method and application
CN108842000A (en) For identifying the primer sets of DAdV-3 and DAdV-A
CN110317256B (en) Duck gamma interferon mutant and preparation method and application thereof
CN113789333A (en) Application of Chi3l1 in regulating and controlling hUC-MSCs to inhibit Th17 differentiation-mediated immunoregulation effect
KR101677231B1 (en) Enhanced Production of Megalocytivirus Using Serum Free Medium
CN116251129A (en) Use of Phellinus linteus GKPl mycelium for preparing composition for improving obesity and obesity related metabolic diseases
CN109609553B (en) Method for improving NK cell targeting effect and application of CCR5 gene
CN102533859A (en) Adenovirus vector carrying inducible co-stimulater gene, and construction method and application of adenovirus vector

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
ASS Succession or assignment of patent right

Owner name: ZHONGSHAN UNIV.

Free format text: FORMER OWNER: GUANGZHOU ZHONGDA ZHONGSHAN MEDICINE SCIENCE DEVELOPMENT CO., LTD.

Effective date: 20081031

C41 Transfer of patent application or patent right or utility model
C56 Change in the name or address of the patentee

Owner name: GUANGZHOU ZHONGDA ZHONGSHAN MEDICINE SCIENCE DEVEL

Free format text: FORMER NAME OR ADDRESS: SCIENCE AND TECHNOLOGY DEVELOPMENT CENTRE OF ZHONGSHAN MEDICAL COLLEGE OF ZHONGS

CP01 Change in the name or title of a patent holder

Address after: No. two, No. 74, Zhongshan Road, Guangzhou, Guangdong

Patentee after: Guangzhou Zhongda Zhongshan Medical Technology Development Co.,Ltd.

Address before: No. two, No. 74, Zhongshan Road, Guangzhou, Guangdong

Patentee before: Science and technology development center, Zhongshan Medical College, Zhongshan University

TR01 Transfer of patent right

Effective date of registration: 20081031

Address after: No. two, No. 74, Zhongshan Road, Guangzhou, Guangdong

Patentee after: SUN YAT-SEN University

Address before: No. two, No. 74, Zhongshan Road, Guangzhou, Guangdong

Patentee before: Guangzhou Zhongda Zhongshan Medical Technology Development Co.,Ltd.

CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20080716

Termination date: 20190317

CF01 Termination of patent right due to non-payment of annual fee