CN108588026A - The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 - Google Patents
The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 Download PDFInfo
- Publication number
- CN108588026A CN108588026A CN201810289165.3A CN201810289165A CN108588026A CN 108588026 A CN108588026 A CN 108588026A CN 201810289165 A CN201810289165 A CN 201810289165A CN 108588026 A CN108588026 A CN 108588026A
- Authority
- CN
- China
- Prior art keywords
- stem cell
- mescenchymal stem
- clinical grade
- umbilical cord
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/54—Interleukins [IL]
- C07K14/5428—IL-10
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
- C12N5/0665—Blood-borne mesenchymal stem cells, e.g. from umbilical cord blood
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
- C12N2510/02—Cells for production
Abstract
The present invention provides a kind of preparation method and its usage of the clinical grade mescenchymal stem cell of high expression IL10, and described method includes following steps：1) primary separation, amplification umbilical cord mesenchymal stem cells, secondary culture from people's umbilical cord；2) for use after the recombinant vector of structure expression IL10, linearisation；3) it selected in step 1) for the 2nd~3 generation be in the umbilical cord mesenchymal stem cells of exponential phase and carries out electrotransformation with the recombinant vector of step 2) IL10；4) the clinical grade mescenchymal stem cell of IL10 will be expressed after mescenchymal stem cell culture, drug screening, passage obtained by step 3) up to height.The method of the present invention modifies mescenchymal stem cell by expressing the recombinant vector of people IL10, overcomes the feature that the primary mesenchymal stem cells time-to-live is short, aggregate concentration is low, realizes effectively treatment central lesion, new selection approach is provided for correlative study.
Description
Technical field
The present invention relates to biotechnologies, and in particular to stem-cell therapy technical field is related to a kind of high expression IL10
Clinical grade mescenchymal stem cell preparation method and its usage, expressed for the high of stem-cell therapy more particularly, to a kind of
The preparation method and its usage of the clinical grade mescenchymal stem cell of IL10.
Background technology
Central nervous system includes brain and spinal cord, is the center of all sensory perceptions and movement output.Central nervous system
The reparation of system and power of regeneration are very limited, because of the neuron and most of crosscutting nervous centralis axis of impaired/aixs cylinder cutting
It is prominent non-renewable.Central lesion includes traumatic brain injury and spinal cord injury, is clinically traumatic lethal and cause
The main reason for residual.
Traumatic brain injury (traumatic brain injury, TBI) and spinal cord injury (spinal cord
Injury, SCI) it is one of most common Severe acute disease of neurosurgery, the spy with high rate, high mortality and high disability rate
Point, and with the development of society, its incidence is in the trend risen year by year.Although nearly ten years its overall mortality rate under
Drop, but still there is patients with mild meeting legacy life in part to stay permanent neurological dysfunction, the disability rate of middle severe patient even high
Up to 66%~100%, great burden is brought for society and family.Why it has the very high death rate and disables
On the one hand rate is determined by the severity of primary sexual trauma, damaged with post-traumatic secondary nervous centralis
Hinder closely related, the secondary response of many making patients' nervous function damages can be caused, wherein most outstanding is " nerve
Inflammatory reaction ".
Neuroinflammation is that secondary venereal disease reason changes most prominent one of feature after central lesion, main
Change include brain tissue microglia activation, peripheral circulation inflammatory cell infiltration and inflammatory cytokine (such as chemotactic factor (CF), it is white carefully
Born of the same parents' interleukin, tumor necrosis factor) etc. media release.Once inflammatory reaction will seriously damage brain parenchym, lead by excessive activation
Blood-brain barrier permeability change, mitochondrial function exception and cellular energy metabolism obstacle etc. are caused, to cause brain edema, intracranial pressure
Raising and secondary cerebral hyoperfusion etc., ultimately cause nerve cell apoptosis and traumatic axonal injury (traumatic
Axonal injury, TAI) etc..
In recent years, with deepening continuously to stem-cell research, more and more evidences are supported to use mescenchymal stem cell
Alleviate the effect of central lesion serious consequence, especially secondary inflammatory reaction.Mescenchymal stem cell (MSCs)
As a kind of tissue repair seed cell of practicality, convenient material drawing, without apparent immunological rejection, without the danger of additional injury
The problems such as danger and ethics, the especially mescenchymal stem cell in umbilical cord source, have more advantages compared with marrow, increase
It grows differentiation capability and is better than bone marrow MSCs, and immunogenicity is lower than bone marrow MSCs, can be used for heteroplastic transplantation.In addition to by neuroprotection
The factor is delivered to except CNS, and MSC also participates in adjusting the activation of inflammation and endogenous cell to participate in tissue repair.Due to MSCs
The plasticity for the treatment of, adapts to the complicated performance of central lesion very well, this feature makes them become central nervous system
The strong candidate of system injury in treating.
The major pathologic features of central lesion are exactly to neuron, Deiter's cells, nerve fibre and blood
Brain barrier causes the primary response of physical damnification, and shows as the cascade of a variety of pathophysiological mechanisms, including cytotoxicity,
The secondary lesion of gene activation, oxidative damage, oedema and inflammation, especially Neuroinflammation.Lack in adult body and promotes
The microenvironment of injury regeneration：Compared with the puberty, growth factor in the brain tissue after damage, trophic factors and inflammation inhibiting factor
It is relatively deficient.Therefore, only leaning on endogenous progenitor cells/stem cell to support the regeneration of cycle brain tissue, there are limitations.Based on target spot
The mescenchymal stem cell of genetic modification carrys out new hope for the treatment zone of central lesion, and original MSC is implanted into host
After have a disadvantages such as the time-to-live is shorter, damage location aggregate concentration is low, and the MSC after modifying can overcome disadvantages described above.Pass through conjunction
Suitable modification enhances gene expression, so that the stem cell after transplanting is enriched in damaging conditions and survives more long, and secreting function
Albumen increases the organ specific target tropism and therapeutic efficiency of MSC transplanting, improves the effect of clinical treatment.
The cell therapy of genetic modification is a kind of strategy of enhancing therapeutic effect.It is existing that researches show that the MSC of genetic modification
To the treatment potentiality of neuronal cell survival.The human umbilical cord mesenchymal stem cells of IL10 genetic modifications there is no to treat maincenter god at present
Report through system injury.
Invention content
In view of the deficiencies of the prior art, the present invention provides a kind of preparation of the clinical grade mescenchymal stem cell of high expression IL10
Method and application thereof, the recombinant vector by expressing people IL10 modify mescenchymal stem cell, primary mesenchymal stem cells are overcome to deposit
The feature that live time is short, aggregate concentration is low realizes effectively treatment central lesion, new selection is provided for correlative study
Approach.
To achieve the above object, the present invention provides the following technical solutions：
The present invention provides a kind of preparation method of the clinical grade mescenchymal stem cell of high expression IL10, includes the following steps：
1) primary separation, amplification umbilical cord mesenchymal stem cells, secondary culture from people's umbilical cord；
2) for use after the recombinant vector of structure expression IL10, linearisation；
3) the 2nd~3 generation in step 1) is selected to be in the umbilical cord mesenchymal stem cells of exponential phase, with step 2) IL10's
Weight
Group carrier carries out electrotransformation；
4) clinical grade of IL10 will be expressed after mescenchymal stem cell culture, drug screening, passage obtained by step 3) up to height
Between
Mesenchymal stem cells.
Further, the primary separation of people's umbilical cord, amplification, culture carry out in GMP laboratory systems in the step 1),
(being equivalent to hundred grades) is carried out in Biohazard Safety Equipment in cleaning laboratory (ten thousand grades).
Further, the primary separation of people's umbilical cord, amplification detailed process are as follows in the step 1)：The cleaning of acquisition people's umbilical cord,
Reject blood vessel, shred, cultivate, digesting, centrifuging, being resuspended, be inoculated with after culture to 80~90% merge, evaluation quality safety；It comments
Valence by umbilical cord mesenchymal stem cells continue secondary culture, the umbilical cord mesenchymal stem cells that the 2nd~3 generation was in logarithmic phase wait for
With.
Further, the process of the recombinant vector of structure IL10 is in the step 2)：With the people of the database containing GenBank
The cDNA clone carrier of overall length IL-10 genes is template, clones IL10cDNA segments；It, will using one-step cloning method
IL10cDNA segments recombinate in the pCMV carriers to digestion, obtain the recombinant vector of the IL10 for electrotransformation.
Further preferably, the process of the recombinant vector of structure IL10 is in the step 2)：
A) the cDNA clone carrier of people's overall length IL10 genes of the database containing GenBank is template, and F1 and R1 are upstream and downstream
Primer, amplifies the cDNA full length sequences of IL10, and PCR fragment primer size is 612bp；Primer sequence is as follows：
F1:AAGCTGGCTAGGCCGCCACCAAGCTTGGTACCATGCACAGCTCAGC
R1:GAATTCGGCGGCCGCTCTAGACTCGAGTTTAAGAGCCTCCACCCCCGTTTC
B) pCMV2 carriers HindIII+XhoI double digestions, digestion products size are respectively 5429bp, 565bp, recycling
The segment (skeleton) of 5429bp；
C) segment of the 5429bp of recycling is mixed with the step a) PCR fragments obtained, the connection of one-step cloning method, picking list
Clone, sequence verification, sequencing primer sequence are：GACAATGCGATGCAATTTCC, it is to be used for that correct recombinant vector, which is sequenced,
The pCMV-IL10 plasmids of transfection.
Further, the encoding gene of recombinant vector IL10 containing someone of the IL10.Wherein, the nucleotides sequence of people IL10
Row are as shown in SEQUENCE LIST No.1.The nucleotide sequence of the recombinant vector of IL10 such as SEQUENCE LIST No.2 institutes
Show.The recombinant vector for the IL10 that the present invention is built can express people's IL10 albumen in eukaryocyte.The recombination of the IL10 of structure carries
The composition of the expression frame of body surface intelligent's IL10 albumen is：From 5 ' to 3 ' directions be followed successively by CMV promoter, CMV enhancer and
Encoding human IL10 genes.
Further, it is used in combination in restricted after the construction of recombinant vector of the IL10 using going endotoxin kit to extract
It is used for electrotransformation after enzyme cutting NruI linearisations.It is further preferred that the condition of the step 3) linearisation is：37 degree, use Typle
Digest 12h.
Further, it when the umbilical cord mesenchymal stem cells selected in the step 3) grow to 70~80% and converge, still needs to
It is for use after digesting, being resuspended.It is further preferred that the detailed process that mescenchymal stem cell is resuspended in the step 3) umbilical cord is such as
Under：Use Ca2-/Mg2-It is 6.75 × 10 that PBS, which is resuspended to cell concentration,6The unicellular of cells/ml.
Further, the condition of electrotransformation is in the step 3)：The super multiple-pulse live bodies of CUY21EDIT II/cell electricity
Conversion instrument, pulse voltage：150PpV, driving voltage：20PdV, burst length：10ms, cycle-index：20.
Further, the condition cultivated in the step 4) is 37 DEG C, 5%CO2, cultivate 14~20 days.
Further, the time of the drug screening is 7~14 days, and drug is 100ug/ml hygromycin.
The present invention also provides the clinical grade mescenchymal stem cells of the high expression IL10 prepared by present invention a kind of to be controlled in preparation
Treat the purposes in stem cell drugs.
The stem cell is stem cell after traumatic brain injury.
The traumatic brain injury is the open or closed property damage for destroying brain or central functions.
The nervous centralis includes brain and spinal cord.
The present invention also provides a kind of drugs of traumatic central nervous damage comprising height prepared by preparation method of the present invention
Express the clinical grade mescenchymal stem cell of IL10.
Source for mesenchymal stem cells of the present invention is in umbilical cord, and in GMP grades of clinical stem cell preparation rooms separation, cultures
And amplification, and the detection Jing Guo stringent mescenchymal stem cell quality control and safety assessment system, not only overcome cell
The few problem in the source of transplanting, and the dispute without ethics, new support is provided for the clinical Transformation Application of stem cell.
Advantageous effect
The present invention provides a kind of preparation method and its usage of the clinical grade mescenchymal stem cell of high expression IL10, passes through
The recombinant vector of structure expression IL10 modifies mescenchymal stem cell, using umbilical cord derived mesenchymal stem cell as cell carrier, efficiently
IL10 albumen is expressed, cell therapy and gene therapy are combined, the two generates synergistic effect, effectively overcomes original mesenchyma dry
The problem that the cell survival time is short, aggregate concentration is low, expression IL10 concentration is high, reduces inflammatory reaction, increases mescenchymal stem cell
Inflammation rejection ability, achieve the purpose that therapeutic effect enhance.
Preparation process uses electrotransformation method, realizes the preparation clinical grade mescenchymal stem cell of highly effective and safe.
Selected mescenchymal stem cell is by stringent mescenchymal stem cell quality control and safety assessment system
Detection, the mescenchymal stem cell of the genetic modification of preparation meet the production requirement of clinical grade, are the road of the conversion of stem-cell therapy
Provide new support.
The clinical grade mescenchymal stem cell of high expression IL10 prepared by the present invention has good in treating spinal cord injury
Application prospect provides a new selection for the treatment of central lesion.
Description of the drawings
The invention will be further described below in conjunction with the accompanying drawings.
The aspect graph of the mesenchymal stem cells of high expression IL10 between the 3rd generations of Fig. 1.
Fig. 2 Flow cytometry height expresses the result of the mescenchymal stem cell surface molecular label of IL10.
Fig. 3 high expresses the clinical grade umbilical cord mesenchymal stem cells oncogenicity evaluation result of IL10.
Fig. 4 ELISA method detection difference cell strain IL10 secretion levels.
The result figure of the main scorings of Fig. 5 BMS.
Fig. 6 spinal cord slices are observed as a result, GFAP is the marker of spongiocyte, and NF is the marker of nerve fibre,
Merged is the result after GFAP and NF luciferase expression image co-registrations.
The figure of the recombinant vector of the expression IL10 of Fig. 7 structures.
Specific implementation mode
The present invention is further explained in the light of specific embodiments.
The present invention establishes the heredity of the safely and effectively clinical grade mescenchymal stem cell of high expression IL-10 (IL10)
Method of modifying.
Genetic modification is carried out for MSCs and for the treatment of a variety of disease injuries, is had broad application prospects, but
Effective transfection efficiency of mesenchymal stem cells is low, so it is particularly significant to improve its transfection efficiency.Virus is imitated infected with higher transfection
Rate, but there is potential carcinogenicity [Molecular therapy:the journal of the American Society
of Gene Therapy 2002,5(1):16-24]；The method of non-viral transfection such as liposome method is difficult that MSCs transfection efficiencies is made to reach
To high-efficiency transfection, so electrotransfection technology gradually attracts people's attention.
The present invention is carried exogenous DNA into the method apparently more safety of cell and reliable using electrotransformation method, we
Using the super multiple-pulse live bodies of the CUY21EDIT II of BEX companies/cell electrotransformation instrument, establishes efficient multiple-pulse electricity and turn item
Part, do not need special transfection reagent can high-efficiency transfection umbilical cord mesenchymal stem cells, eliminate viral vectors base that may be present
Tumorigenesis sex chromosome mosaicism caused by integration ensures the safety that uses of clinical grade cell prepared and reliable.The new production of BEX companies
The super multiple-pulse live bodies of CUY21EDIT II/cell electrotransformation instrument can carry out multiple-pulse selection according to sample difference, not need spy
Different transfection reagent can high-efficiency transfection cell and live body, it is more efficient for the stable transfection of mescenchymal stem cell.
The present invention provides the human umbilical cord mesenchymal stem cells that can be applied to clinical genetic modification are more efficient and safe
Preparation method includes the following steps：The primary separation of umbilical cord mesenchymal stem cells, amplification are carried out in GMP grades of stem cell preparation rooms
And culture, and the detection Jing Guo stringent mescenchymal stem cell quality control and safety assessment system, select 2-3 generations to be in
The human umbilical cord mesenchymal stem cells of exponential phase, when cell growth to 70~80% is converged, with the expression vector built into
Row electrotransformation；37 DEG C, 5%CO2Under the conditions of, drug screening 7~14 days, that is, the mesenchyma for obtaining the genetic modification for stablizing expression is done
Cell.
Embodiment 1
Step 1：Establish the genetic modification method of mescenchymal stem cell：
1) screening meets the acquisition of puerpera's progress sample of biological sample donor health requirements, it is ensured that the safety of biological sample
Property, exclusion includes HIV, HBV, HCV, CMV, HIV-1＆2, EBV and other viruses that may be detected, and avoids propagating infectiousness disease
The risk of disease.In addition, also needing the other conditions of strictly screening donor, such as underlying disease.
2) umbilical cord source：Multipara's informed consent, experimental program are ratified through drum tower hospital stem-cell research Ethics Committee,
Acquisition is required to meet following two points：1. carrying out Apgar scorings after healthy natural labor youngster or caesarean birth, total score is 8~10
Point；2. nearly fetus end umbilical cord is taken to be about 10-20cm under aseptic condition.Both ends respectively cut off 2cm, and umbilical cord is soaked in containing 2% green chain
In the DPBS of mycin, Medical heat-preserving box is used in combination to transport, in being handled in 4h.
3) staff enters facility, and whole process is operated in Biohazard Safety Equipment.
4) umbilical cord is cut into the segment of 2cm or so, being washed till no blood with the DPBS containing 2% mycillin exists.
5) 3 blood vessels in umbilical cord, i.e. two radicular arteries, a radicular vein are rejected.The umbilical cord after blood vessel is rejected to be cut with eye scissors
It is broken into about 1mm3Fine tissue block.
6) tissue, which shreds, is directly labelled in T75 culture bottles, is inverted 4h, then just set culture bottle, and it is dry thin that 6ml human mesenchymes are added
Born of the same parents' complete medium (complete medium formula：10%MSC grades of fetal calf serum+DMEM low sugar culture mediums).
7) after 5 days, then the fresh human mesenchymal stem cell culture mediums of 6ml are supplemented into culture bottle.
8) 10-14 days or so cells climb out of, and can form colony CFU-F, gently pat culture bottle, tissue block is made to fall off, abandon
It, cell surface is gently washed with PBS, changes the fresh mescenchymal stem cell complete mediums of 10ml, is placed incubator and is continued to cultivate,
The when of merging is grown to 80%-90% when cell to pass on.
9) old culture solution is discarded, the DPBS being placed at room temperature for is added and washes one time, sucks DPBS CTS.Appropriate Tryple is added,
37 DEG C are incubated digestion 3min.
10) cell is softly blown and beaten, is collected in cell suspension to centrifuge tube, room temperature 1200r/min centrifuges 5min, abandons supernatant.
11) human mesenchymal stem cell culture medium cell culture fluid is added, cell is resuspended, soft piping and druming is uniform, and inoculum density is about
1.5×104/cm2。
12) 37 DEG C are placed in, 5%CO2Stationary culture is evaluated to 80~90% fusions for quality and safety in incubator.
13) it is to ensure that safety and the validity of stem-cell therapy, stem cell medicine must meet existing stem cell knowledge
Differentiate with comprehensive quality requirement under technical conditions, including stem cell, survival rate and growth activity, purity and homogeneity are sterile
Experiment and detection of mycoplasma, the detection of intracellular external source virulence factor and oncogenicity detection etc..It is referring in particular to standard：
Step 2 builds the clinical grade mescenchymal stem cell of high expression IL10
It is as follows：
1) vector amplification and verification：
From the people overall length IL-10 genes (sequence is as shown in SEQUENCE LIST NO1) from GenBank databases
In cDNA clone carrier, sense primer is used
F1(AAGCTGGCTAGGCCGCCACCAAGCTTGGTACCATGCACAGCTCAGC)
And downstream primer
R1 (GAATTCGGCGGCCGCTCTAGACTCGAGTTTAAGAGCCTCCACCCCCGTTTC), amplifies IL10's
CDNA full length sequences, PCR fragment primer size are 612bp.
PCMV2 carriers HindIII+XhoI double digestions, digestion products size are respectively 5429bp, 565bp, recycling
The segment (skeleton) of 5429bp.The segment of the 5429bp of recycling is mixed with the PCR fragment of acquisition, the connection of one-step cloning method is chosen
Take monoclonal, sequence verification, sequencing primer sequence：Correct carrier is sequenced i.e. for transfecting in GACAATGCGATGCAATTTCC
PCMV-IL10 plasmids.Gained recombinant vector collection of illustrative plates is shown in Fig. 7, and expression frame sequence is as shown in SEQUENCE LIST NO2.
SEQUENCE LIST NO1：
atgcacagctcagcactgctctgttgcctggtcctcctgactggggtgagggccagcccaggccagggcacccagtc
tgagaacagctgcacccacttcccaggcaacctgcctaacatgcttcgagatctccgagatgccttcagcagagtga
agactttctttcaaatgaaggatcagctggacaacttgttgttaaaggagtccttgctggaggactttaagggttac
ctgggttgccaagccttgtctgagatgatccagttttacctggaggaggtgatgccccaagctgagaaccaagaccc
agacatcaaggcgcatgtgaactccctgggggagaacctgaagaccctcaggctgaggctacggcgctgtcatcgat
ttcttccctgtgaaaacaagagcaaggccgtggagcaggtgaagaatgcctttaataagctccaagagaaaggcatc
tacaaagccatgagtgagtttgacatcttcatcaactacatagaagcctacatgacaatgaagatacgaaactaa
SEQUENCE LIST NO2
atagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcc
cgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaataggg
actttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc
aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggact
ttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatggg
cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacca
aaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtggg
aggtctatataagcagagctctctggctaactag agaacccactgcttactggcttatcgaaattaatacgactca
ctatagggagacccaagctggctaggccgccaccaagcttggtaccatgcacagctcagcactgctctgttgcctgg
tcctcctgactggggtgagggccagcccaggccagggcacccagtctgagaacagctgcacccacttcccaggcaac
ctgcctaacatgcttcgagatctccgagatgccttcagcagagtgaagactttctttcaaatgaaggatcagctgga
caacttgttgttaaaggagtccttgctggaggactttaagggttacctgggttgccaagccttgtctgagatgatcc
agttttacctggaggaggtgatgccccaagctgagaaccaagacccagacatcaaggcgcatgtgaactccctgggg
gagaacctgaagaccctcaggctgaggctacggcgctgtcatcgatttcttccctgtgaaaacaagagcaaggccgt
ggagcaggtgaagaatgcctttaataagctccaagagaaaggcatctacaaagccatgagtgagtttgacatcttca
tcaactacatagaagcctacatgacaatgaagatacgaaactaa
2) plasmid linearization:Endotoxin kit extraction plasmid is spent, (37 after being used in combination restriction enzyme NruI to linearize
Degree digests 12h with Typle) it is used for electrotransformation.The linearisation of circular vectors, can larger raising electrotransformation efficiency.
3) in selection 2-3 generations, are in the primary human umbilical cord mesenchymal stem cells of exponential phase, cell growth to 70-80%
When converging, cell that will be electric turn is digested using Tryple, 37 degree, is digested 3 minutes, and cell, which is resuspended, to be counted, and Ca is used2-/Mg2-PBS
It is 6.75 × 10 to be resuspended to cell concentration6The unicellular of cells/ml takes the cell suspension of 0.37ml, is added to 0.2cm wide
In the electric revolving cup of degree, then the plasmid of 13ug linearisations is added into electric revolving cup, II electroporation electricity of CUY21EDIT turns electricity and turn parameter
For：
Decay programs：
4) after electricity turns 24 hours, 100 μ g/ml hygromycin is added and carry out drug screening.
5) 37 DEG C, 5%CO2Under the conditions of, it cultivates 14~20 days, drug screening 7~14 days, waits for clonal growth, the dissection of body formula
Picked clones (each clone represents a cell strain) under mirror, transfer is set in 12 orifice plates, and the same terms continue to cultivate to 90% and melt
After conjunction, it is passaged in the hole of 3 12 orifice plates (3 multiple holes) with same density.Passage exponential phase cell is taken to be observed (shape
State is as shown in Figure 1), the mescenchymal stem cell inverted phase contrast microscope of high expression IL10, adherent growth are rendered into fiber finer in figure
Born of the same parents' form.
With flow cytomery cell surface molecule mark as a result, the results are shown in Figure 2, as a result show genetic modification
The mescenchymal stem cell surface marker of high expression IL10 afterwards meets clinical grade dry cell mass evaluation criterion, i.e. CD73,
CD90, CD105, CD29≤95%, CD34, CD45, HLA-DR≤2%；The mescenchymal stem cell of height expression IL10 is inoculated with nude mice
Subcutaneously, after March, each tissue does not observe the formation of tumour, illustrates the cell line without oncogenicity risk, securely and reliably, evaluation is tied
Fruit is as shown in Figure 3.
Different cell strain IL10 secretion levels detections：After different cell strains are passed on same density, wait for cell growth extremely
90% fusion takes supernatant ELISA method detection difference to clone (cell strain) IL10 secretion levels (Fig. 4), selection wherein growth conditions
Preferably, No. 25 cell strains (umbilical cord mesenchymal stem cells of height expression IL-10 (IL10)) of IL10 high expression carry out follow-up real
It tests.
Embodiment 2
To the female mice of 8 week old C57BL/6 cutting method cross-section spinal cord entirely, retain spinal cord abdomen, back of the body artery and dorsal vein,
After modeling for 24 hours, tail vein injection gives physiological saline (NS), umbilical cord derived mesenchymal stem cell (UC-MSCs) (1 × 106/
) and the high clinical grade mescenchymal stem cell (IL10-UC-MSCs) (1 × 10 for expressing IL106/ only) treatment, thereafter every two weeks
Tail vein injection saline (NS) or cell are primary, after continuing 12 weeks to damage, handle animal, feelings are repaired in observation
Condition.
Result of study shows：Hind limb motor function score, height expression are carried out by Basso-Mouse-Scale (BMS) method
The clinical grade mescenchymal stem cell of IL10 can improve hind limb motor function (concrete outcome such as Fig. 5, after transplanting of spinal cord injury mouse
The main scorings of 5 weeks~12 weeks IL10-UC-MSCs groups BMS improve, compared with UC-MSCs groups, * * P<0.01, compared with NS groups, ##P<
0.01, difference is statistically significant.).The 12nd week after cell therapy, spinal cord slice observation, compared with other groups, height expression
The lesion volume and length of lesion of the clinical grade mescenchymal stem cell treatment group site spinal cord injury of IL10 significantly reduce, while can
Effectively (result such as Fig. 6, compared with UC-MSCs groups, IL10-UC-MSCs group spinal cords damage the Neuroinflammation at inhibition loss position
The lesion volume and length of lesion of traumatic part position significantly reduce, and have good repairing effect.).Prior art majority is with single
Anti -inflammatory cytokine treated, or stem-cell therapy is applied alone, inhibit secondary lesion caused by Neuroinflammation
Curative effect is not notable, and the clinical grade mescenchymal stem cell of high expression IL10 prepared by the present invention can effectively inhibit neuroinflamation
Reaction, while playing paracrine action and promoting nerve cell regeneration, improve therapeutic effect.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, any made by repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
Claims (10)
1. a kind of preparation method of the clinical grade mescenchymal stem cell of high expression IL10, which is characterized in that include the following steps：
1) primary separation, amplification umbilical cord mesenchymal stem cells, secondary culture from people's umbilical cord；
2) for use after the recombinant vector of structure expression IL10, linearisation；
3) the 2nd~3 generation in step 1) is selected to be in the umbilical cord mesenchymal stem cells of exponential phase, with the recombination of step 2) IL10
Carrier carries out electrotransformation；
4) it will be filled up between the clinical grade of high expression IL10 after mescenchymal stem cell culture, drug screening, passage obtained by step 3)
Matter stem cell.
2. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 1, which is characterized in that
The primary separation of people's umbilical cord, amplification detailed process are as follows in the step 1)：The cleaning of acquisition people's umbilical cord rejects blood vessel, shreds, trains
Foster, digestion centrifugation, is resuspended, is cultivated after inoculation to 80~90% fusions, evaluation quality safety；It is filled between the umbilical cord that evaluation passes through
Matter stem cell continues secondary culture, and the umbilical cord mesenchymal stem cells that the 2nd~3 generation was in logarithmic phase are for use.
3. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 1, which is characterized in that
The process of the recombinant vector of structure IL10 is in the step 2)：With people's overall length IL-10 genes of the database containing GenBank
CDNA clone carrier is template, clones IL10cDNA segments；Using one-step cloning method, IL10cDNA segments are recombinated to digestion
In pCMV carriers afterwards, the recombinant vector of the IL10 for electrotransformation is obtained.
4. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 3, which is characterized in that
The encoding gene of recombinant vector IL10 containing someone of the IL10；The nucleotide sequence of people IL10 such as SEQUENCE LIST No.1
It is shown；The nucleotide sequence of the recombinant vector of the IL10 is as shown in SEQUENCE LIST No.2.
5. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 4, which is characterized in that
Using going endotoxin kit to extract after the construction of recombinant vector of the IL10, used after being used in combination restriction enzyme NruI to linearize
In electrotransformation.
6. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 1, which is characterized in that
It is for use after digesting, being resuspended when the umbilical cord mesenchymal stem cells selected in the step 3) grow to 70~80% and converge.
7. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 6, which is characterized in that
The condition of electrotransformation is in the step 3)：The super multiple-pulse live bodies of CUY21EDIT II/cell electrotransformation instrument, pulse voltage：
150PpV, driving voltage：20PdV, burst length：10ms, cycle-index：20.
8. the preparation method of the clinical grade mescenchymal stem cell of high expression IL10 according to claim 1, which is characterized in that
The condition cultivated in the step 4) is 37 DEG C, 5%CO2, cultivate 14~20 days；
The time of the drug screening is 7~14 days, and drug is 100ug/ml hygromycin.
9. prepared by the clinical grade mescenchymal stem cell of high expression IL10 prepared by any the method for claim 1~8 a kind of
Treat the purposes in stem cell drugs.
10. a kind of drug of traumatic central nervous damage comprising prepared by any preparation method of claim 1~8
The clinical grade mescenchymal stem cell of height expression IL10.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810289165.3A CN108588026A (en) | 2018-04-03 | 2018-04-03 | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810289165.3A CN108588026A (en) | 2018-04-03 | 2018-04-03 | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108588026A true CN108588026A (en) | 2018-09-28 |
Family
ID=63624281
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810289165.3A Pending CN108588026A (en) | 2018-04-03 | 2018-04-03 | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108588026A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109810947A (en) * | 2019-01-18 | 2019-05-28 | 北京贝来生物科技有限公司 | A kind of mescenchymal stem cell and its preparation method and application inhibiting Th17 cell activation |
| CN110055215A (en) * | 2019-05-06 | 2019-07-26 | 南京鼓楼医院 | A kind of high Osteoblast Differentiation ability human mesenchymal stem cell and preparation method thereof |
| CN111514166A (en) * | 2020-05-14 | 2020-08-11 | 天津医科大学眼科医院 | Application of mesenchymal stem cell-derived small extracellular vesicles overexpressing interleukin 10 in drugs for autoimmune diseases |
| CN114934070A (en) * | 2022-01-18 | 2022-08-23 | 生物岛实验室 | Mesenchymal stem cells and anti-inflammatory application thereof |
| CN114941011A (en) * | 2021-12-21 | 2022-08-26 | 生物岛实验室 | Lentiviral vectors and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671000A (en) * | 2016-03-02 | 2016-06-15 | 深圳爱生再生医学科技有限公司 | Recombinant mesenchymal stem cells, preparation method and application thereof |
| CN106282121A (en) * | 2016-09-09 | 2017-01-04 | 深圳市茵冠生物科技有限公司 | A kind of recombinant slow virus modified human umbilical cord mesenchymal stem cells carrying pigment epidermal derived factors gene and preparation method thereof |
-
2018
- 2018-04-03 CN CN201810289165.3A patent/CN108588026A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671000A (en) * | 2016-03-02 | 2016-06-15 | 深圳爱生再生医学科技有限公司 | Recombinant mesenchymal stem cells, preparation method and application thereof |
| CN106282121A (en) * | 2016-09-09 | 2017-01-04 | 深圳市茵冠生物科技有限公司 | A kind of recombinant slow virus modified human umbilical cord mesenchymal stem cells carrying pigment epidermal derived factors gene and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| HINES,L.: "Synthetic construct Homo sapiens clone FLH053493.01X interleukin 10 (IL10) mRNA,complete cds", 《GENBANK: AY893351.1》 * |
| VENKATA RAMESH DASARI: "Mesenchymal stem cells in the treatment of spinal cord injuries: A review", 《WORLD JOURNAL OF STEM CELLS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109810947A (en) * | 2019-01-18 | 2019-05-28 | 北京贝来生物科技有限公司 | A kind of mescenchymal stem cell and its preparation method and application inhibiting Th17 cell activation |
| CN110055215A (en) * | 2019-05-06 | 2019-07-26 | 南京鼓楼医院 | A kind of high Osteoblast Differentiation ability human mesenchymal stem cell and preparation method thereof |
| CN111514166A (en) * | 2020-05-14 | 2020-08-11 | 天津医科大学眼科医院 | Application of mesenchymal stem cell-derived small extracellular vesicles overexpressing interleukin 10 in drugs for autoimmune diseases |
| CN114941011A (en) * | 2021-12-21 | 2022-08-26 | 生物岛实验室 | Lentiviral vectors and uses thereof |
| CN114934070A (en) * | 2022-01-18 | 2022-08-23 | 生物岛实验室 | Mesenchymal stem cells and anti-inflammatory application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108588026A (en) | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 | |
| US20060247195A1 (en) | Method of altering cell properties by administering rna | |
| CN105985985A (en) | Preparation method of allogenic mesenchymal stem cells by CRISPR (clustered regularly interspaced short palindromic repeats) technique editing and IGF (insulin-like growth factor) optimization and application of allogenic mesenchymal stem cells in treating myocardial infarction | |
| CN104321426A (en) | Immortalized stem cells and medicinal composition and medicinal preparation comprising product thereof as active ingredient | |
| CN106636210B (en) | Transcription factor combines the method that induced fibroblast transdifferentiation is class interstitial glands | |
| CN107354127A (en) | Effects of the LncRNA TUG1 in regulation and control PDLSCs Osteoblast Differentiations and regeneration | |
| CN111944748A (en) | high-IL-10-expression human adipose-derived mesenchymal stem cell exosome for treating myocardial infarction and application thereof | |
| CN105384826A (en) | Cord blood nucleated cell for expressing chimeric antigen receptor and application of cord blood nucleated cell | |
| CN106167791B (en) | MSC-TNF alpha-AB stem cell and preparation method and application thereof | |
| CN108774633A (en) | It is a kind of for Cerebral Infarction Treatment simultaneously can be by the neural stem cell preparation of magnetic resonance and fluorescence imaging bimodal tracer | |
| CN107119020A (en) | A kind of hepatic injury targeting mescenchymal stem cell based on miR 9 and preparation method and application | |
| CN110656087B (en) | MANF gene modified umbilical cord mesenchymal stem cell and preparation method and application thereof | |
| WO2020125576A1 (en) | Method for delivering gene in cells | |
| CN109593725A (en) | A kind of recombination mescenchymal stem cell and its application | |
| CN112626031B (en) | Genetically modified dental pulp stem cell and preparation method and application thereof | |
| CN106497975A (en) | The preparation method of genetic recombination stem cell medicine and its application in skin injury reparation, scar suppress | |
| CN101182493A (en) | Transgenic mesenchyma stem cell for curing radiation enteritis and method of producing the same | |
| CN109439631B (en) | Mesenchymal stem cells overexpressing CCR2 for treating acute ischemic stroke and preparation method thereof | |
| CN111518774B (en) | Method and reagent for improving stress tolerance of synovial membrane mesenchymal stem cells | |
| CN104762318B (en) | In-situ immobilization plasmid, test kit and the method for No. 22 intron inversion type sudden changes of human blood coagulation factor VII I gene | |
| CN113388586A (en) | Oncolytic virus NDV-NRP1 and construction method and application thereof | |
| CN108795987A (en) | A kind of neural stem cell preparation method and application of FerritinH, Bcl2 and EGFP gene combined modification | |
| CN111925983A (en) | Preparation method of high-IL-10-expression human adipose-derived mesenchymal stem cell exosome for treating myocardial infarction | |
| CN111944747A (en) | Human adipose-derived mesenchymal stem cell exosome for treating myocardial infarction and application thereof | |
| CN112522216A (en) | Recombinant adeno-associated virus AAV-gas6 and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Wang Bin Inventor after: Gao Tianyun Inventor after: Wang Liudi Inventor after: Huang Feifei Inventor after: Xie Yuanyuan Inventor after: Liu Wei Inventor before: Wang Bin Inventor before: Gao Tianyun Inventor before: Wang Liudi Inventor before: Huang Feifei Inventor before: Xie Yuanyuan Inventor before: Liu Wei |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180928 |