CN109439631B - Mesenchymal stem cells overexpressing CCR2 for treating acute ischemic stroke and preparation method thereof - Google Patents

Abstract

The invention discloses an mesenchymal stem cell over-expressing CCR2 and a preparation method thereof, and also discloses an application of the mesenchymal stem cell over-expressing CCR2 in a medicament for treating Acute Ischemic Stroke (AIS). The invention optimizes the treatment method of acute ischemic stroke, and the MSC modified by the CCR2 gene has better targeting property and effectiveness in treatment, and can improve the treatment effect of the MSC more obviously. The preparation method of the mesenchymal stem cell for over-expressing CCR2 can enable the MSC to over-express the receptor CCR2 by constructing a plasmid for expressing CCR2 and utilizing an mRNA transfection method, and meanwhile, the method does not influence the phenotype, the differentiation capability and the immunoregulation capability of the MSC; has low genotoxicity and makes MSC^CCR2Can directionally migrate to the focus position in vivo, and more effectively play the aim of targeted therapy.

Description

Mesenchymal stem cells overexpressing CCR2 for treating acute ischemic stroke and preparation method thereof

Technical Field

The invention relates to the technical field of stem cell therapy, in particular to Mesenchymal Stem Cells (MSC) for over-expressing CCR2, a preparation method and application thereof.

Background

Acute Ischemic Stroke (AIS) is a sudden local cerebral function impairment disease caused by cerebral blood circulation disorder, is clinically manifested as symptoms and signs of transient or permanent cerebral dysfunction, is a common disease and frequently encountered disease in neurology, and accounts for about 60-80% of all cerebral strokes. AIS mainly includes both thrombotic and embolic types, and is occasionally seen as vasospasm or brain tumor compressing the blood vessel. Thrombosis is the condition that the blood vessel cavity is smaller and smaller due to atherosclerosis and even completely blocked by the wall of the cerebral blood vessel; the embolus is a sudden embolus in a blood vessel, and the embolus is stuck in the blood vessel with a smaller caliber along with blood flow to block the blood circulation. After the brain tissue is lack of blood flow perfusion, the brain tissue will lose its function rapidly, and central neurological symptoms are generated, such as hemiplegia, facial distortion, language handicap, even sudden coma and unconsciousness are taken as main symptoms during the onset of diseases. The Chinese disease prevention and control center carries out epidemiological investigation on AIS, and data show that: in 2011, the incidence rate of AIS of people over 40 years old in China is about 230/10 ten thousands, and the number of new people is about 133.4 ten thousands; the proportion of people under 65 years is about 50%, and the people show a trend of youthfulness.

At present, the clinical common treatment method for AIS is intravenous injection of thrombolytic drug recombinant tissue plasminogen activator (tPA), and the cerebral blood circulation is reconstructed by thrombolysis, thereby playing the role of treatment and prognosis improvement. However, there are more limiting factors in the efficacy of tPA therapy: firstly, treating narrow time window; secondly, under the condition that treatment and slight blood pressure reduction of the antihypertensive drug do not exist, the blood pressure of a patient needs to be less than or equal to 185/110mmHG when the patient is treated; before treatment, the patient needs to be ensured to have no bleeding in the brain through Computed Tomography (CT); fourthly, the patient cannot have the constitution of easy bleeding; patients who have not been confirmed to be stroke cannot be treated with tPA; sixthly, the tPA treatment has more side effects, such as intracranial hemorrhage symptom and the like. In recent years, the implementation of intravenous injection plays a positive role in expanding the time window of tPA treatment, the time can be expanded to 12 hours after AIS occurs, the clinical application of tPA is promoted, and the disability rate after the successful rescue treatment by using tPA is still high. Statistics show that about 3/4 lost labor to varying degrees in surviving AIS patients, with about 40% of severely disabled.

Because of the above-mentioned drawbacks, the clinical use of tPA is probably not the best means for treating AIS, and therefore, there is an urgent need to explore a new approach for treating AIS.

Mesenchymal Stem Cells (MSCs), a non-hematopoietic stem cell that was first discovered from bone marrow, are widely distributed in various tissues and organs throughout the body, and are present in tissues such as gingiva, skeletal muscle, fat, etc., in addition to bone marrow, and are involved in tissue injury repair and homeostasis maintenance. The MSC lacks specific markers, mainly expresses mesenchymal markers such as CD29, CD44, CD73, CD90, CD105, CD166 and the like, and does not express hematopoietic related markers such as CD11b, CD14, CD19, CD34, CD45 and the like; no or low expression of HLA class I molecules and no expression of HLA class II molecules. MSCs have multipotent differentiation potential. In vitro experiments prove that the MSC can be differentiated into neurons and glial cells, and in vivo experiments also prove that the MSC transplanted after AIS can express markers of the neurons and the glial cells in the central nervous system, so that a foundation is provided for directly repairing damaged areas by the MSC; the MSC transplanted after AIS can possibly mobilize endogenous neuron precursors to proliferate, promote the survival of neurons and the proliferation of glial cells by secreting proliferation promoting factors and anti-apoptosis factors, reduce the apoptosis phenomenon in AIS, activate astrocytes and generate certain neuroprotective molecules to promote repair and recovery, such as brain-derived neurotrophic factors and the like; MSCs have an immune-regulatory function, and cause a strong inflammatory response after AIS, while MSCs are capable of negative regulation. The MSC can inhibit the functions of T cells by inhibiting the proliferation of the T cells, promoting the generation of T regulatory cells, inhibiting CD4+ and CD8+ T cells, and also can regulate B cells and other antigen presenting cells; in addition, MSC expresses low-level HLA molecules, so that transplant rejection is avoided; MSCs can secrete pro-angiogenic factors, and angiogenesis plays an important role in the survival and regeneration of neurons in AIS. Thanks to the above-mentioned advantages of mesenchymal stem cells, a number of different preclinical experiments have consistently demonstrated the effectiveness of MSCs in improving post-AIS neural and behavioral functions.

In animal models of experimental mid-cerebral artery occlusion used to mimic human AIS, studies found that only a small fraction of intravenously injected MSCs migrated through the defective blood-brain barrier to the injured area, with the majority of MSCs being occluded in organs such as the lung (Paul lin et al, 2013). The accumulation of a large number of stem cells in non-target tissues can bring about potential safety hazards; meanwhile, the stock quantity of MSC in the bone marrow only accounts for 0.001-0.01 percent of the total amount of the cells, and the source is rare; therefore, improving targeting of MSCs to diseased tissues is a key issue for clinical switch of MSC therapy. Chemokine-chemotactic receptor axis is considered as an important mechanism for mediating the chemotaxis of MSCs to lesion tissues, and the chemokine receptors expressed on the surface of MSCs include CCR1, CCR4, CCR6, CCR7, CCR9, CCR10, CXCR4, CXCR5, CXCR6, CX3CR1 and the like, but these receptors are expressed in low amounts, and the expression amount of the receptors gradually decreases during in vitro culture (Sarkar, d., et al., 2011).

Many researchers are currently looking at improving targeting of MSC therapy as a research direction, and many scholars aim to gene therapy, such as overexpression of CXCR5 by viral transfection, to promote migration of MSCs to sites of contact hypersensitivity inflammation (Xiaoran, z., et al., 2017). Overexpression of chemokine receptors plays a central role in improving the targeted chemotactic process of cells, however, viral vectors currently used for gene therapy all have potential safety risks; on the other hand, the transfection efficiency of non-viral vectors is relatively low, which allows a safer and more efficient delivery vector to be used.

Recent studies have shown that there are specific chemokine expression profiles in AIS patient brain tissues, of which 3 chemotactic axes play a major role, SDF1-CXCR4 chemotactic axis, CX3CL1-CX3CR1 chemotactic axis, CCL2-CCR2 chemotactic axis (Bonaventura a., et al.,2016), respectively.

AIS patients produce a large amount of reactive oxygen species in lesion tissues, induce apoptosis to destroy the blood brain barrier, thereby causing inflammatory cells to infiltrate into brain tissues, release inflammatory factors and further exacerbate the production of reactive oxygen species (Obermeier b., et al., 2013). The blood-brain barrier refers to the barrier between the blood plasma formed by the walls of the brain capillaries and the glial cells and the barrier between the blood plasma formed by the choroid plexus and the cerebrospinal fluid, which are capable of preventing the entry of harmful substances from the blood into the brain tissue, and the destruction of the blood-brain barrier is one of the important indicators of a poor prognosis of AIS (Khatri r., et al., 2012).

Disclosure of Invention

Based on the above, the invention constructs a plasmid for expressing CCR2, and utilizes an mRNA transfection method to ensure that the MSC transiently overexpresses the receptor CCR2, thereby improving the capability of the MSC to target AIS lesion tissues and effectively improving the treatment effect of the MSC.

In one aspect, the invention provides a mesenchymal stem cell that overexpresses CCR 2.

In another aspect, the invention also provides the use of the mesenchymal stem cells overexpressing CCR2 in the preparation of a medicament for treating ischemic stroke.

In still another aspect, the present invention provides a medicament for treating ischemic stroke, comprising the above-described mesenchymal stem cell overexpressing CCR 2.

In still another aspect, the present invention provides a method for preparing the above-described mesenchymal stem cell overexpressing CCR2, comprising the steps of:

(1) constructing a plasmid expressing CCR 2;

(2) synthesizing CCR2mRNA by using the plasmid constructed in the step (1);

(3) and (3) transfecting the CCR2mRNA synthesized in the step (2) into the mesenchymal stem cells to obtain the mesenchymal stem cells over-expressing CCR 2.

Through experimental observation, the MSC which overexpresses CCR2 and is transfected by mRNA is safe and effective, can directionally migrate to a lesion part in vivo, and further mechanistically discovers that the MSC which overexpresses CCR2 can secrete antioxidant protein PRDX4 with higher level to reduce the active oxygen level, so that the blood brain barrier structure is repaired, and the AIS (acute respiratory syndrome) curative effect is better achieved.

As a further improvement on the technical scheme, in the step (1), the vector used for constructing the plasmid for expressing CCR2 is pcDNA3.1 vector.

As a further improvement of the above technical solution, the step (1) specifically includes: extracting peripheral blood mononuclear cell RNA, performing reverse transcription to obtain cDNA, amplifying full-length CCR2cDNA by using a CCR2 specific PCR primer, performing double enzyme digestion on a PCR product and a plasmid pcDNA3.1 by Kpn I and Sfu I, purifying, and connecting a CCR2 target gene fragment to a pcDNA3.1 plasmid to obtain a plasmid for expressing CCR 2.

As a further improvement to the technical scheme, the CCR2 specific PCR primer is as follows:

the upstream primer is 5 '-TTGGTACCTACGGTGCTCCCTGTCATAAA-3',

downstream primer 5 '-TTTTTCGAATAAGATGAGGACGACCAGCAT-3'.

As a further improvement on the technical scheme, in the step (2), the CCR2mRNA has a 5 'end cap structure and a 3' end poly A tail.

As a further improvement of the above technical solution, the step (2) specifically includes:

(21) linearizing the plasmid constructed in the step (1) to obtain linear plasmid DNA;

(22) synthesizing CCR2mRNA with a 5' end cap structure by taking the linear plasmid DNA obtained in the step (21) as a template;

(23) and (5) tailing the CCR2mRNA synthesized in the step (22) and provided with the 5' end cap structure to obtain the CCR2 mRNA.

mRNA serves as an intermediate bridge for connecting DNA and protein through messenger, and the toxic effect of virus on cells and the safety risk brought by DNA integration into genome can be eliminated by using the mRNA as a carrier. However, mRNA is less stable, severely inhibiting its transfection efficiency and feasibility as a vector. Research results show that Anti-reverse cap analogues (ARCA), additional non-transcribed region and poly (A) tail can improve the translation efficiency of mRNA in cells and realize the transient expression of protein in cells; and the mRNA has the advantages of low immunogenicity, safe pharmacology and the like, and can be used as an effective tool for protein overexpression. Although mRNA transfection can only transiently over-express a target protein, since the intravenous infusion of MSC only needs 1-2 h to reach a lesion site, short-term expression of chemokine receptor is enough to improve the targeting property of MSC.

In yet another aspect, the present invention also provides a PCR primer sequence specific for CCR2, comprising:

the upstream primer is 5 '-TTGGTACCTACGGTGCTCCCTGTCATAAA-3',

downstream primer 5 '-TTTTTCGAATAAGATGAGGACGACCAGCAT-3'.

Compared with the prior art, the invention has the following beneficial effects:

the treatment method of acute ischemic stroke is optimized, the MSC modified by the CCR2 gene has better targeting and effectiveness in treatment, and the treatment effect of the MSC can be improved obviously;

the preparation method of the mesenchymal stem cell for over-expressing CCR2 can enable the MSC to over-express the receptor CCR2 by constructing a plasmid for expressing CCR2 and utilizing an mRNA transfection method, and meanwhile, the method does not influence the phenotype, the differentiation capability and the immunoregulation capability of the MSC;

MSC prepared by the method for preparing mesenchymal stem cells overexpressing CCR2 of the present invention^CCR2Has low genotoxicity, and can not only improve MSC^CCR2Ability to home to ischemic brain tissue in vivo, MSC^CCR2Can directionally migrate to the focus site in vivo, and the obtained MSC has higher safety. The mesenchymal stem cells have more targeting and effectiveness in treating ischemic stroke (AIS), and can effectively improve the treatment effect of MSC.

Drawings

FIG. 1 is an MSC^CCR2And MSC expression CCR2 map;

FIG. 2 is a MSC^CCR2The self phenotype and differentiation capability detection result graph;

FIG. 3 is a graph of the in vitro and in vivo assay results of the migration ability of hBMSCs over-expressing CCR2 towards CCL 2;

FIG. 4 shows an MSC^CCR2Expression of antioxidant genes and their antioxidant capacity;

FIG. 5 shows intravenous MSCs^CCR2And (3) a test result chart for alleviating cerebral ischemic injury and promoting nervous system function recovery.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

Example 1 ^CCR2Establishment of Mesenchymal Stem Cells (MSC) overexpressing CCR2

MSC culture and phenotypic identification:

taking 20ml of bone marrow of healthy volunteers, diluting with 1 × PBS at a ratio of 1:1, separating mononuclear cells from bone marrow by density gradient centrifugation (2000rpm, 30min) with Ficoll-Paque lymph separating medium, collecting mononuclear cells at a ratio of 1 × 10⁵The culture was carried out in 75cm2 flasks at a density of/cm 2. After culturing in L-DMEM medium at 37 deg.C and 5% CO2 for 3 days, suspension cells were removed and the culture was continued by changing the medium. After the cells grew to 80% density, the medium was aspirated, washed 2 times with PBS, and digested with 0.125% pancreatin for 1-ni72min with a passage ratio of 1: 3. The MSC is separated from bone marrow donated by a healthy donor, and the clinical MSC is separated, amplified, frozen, restored and the like under the condition of meeting the GMP (good manufacturing practice) standard. The growth and morphological characteristics of the primary and passaged cells were observed daily under an inverted microscope and photographed for recording. In vitro cultured MSCs were digested into single cell suspensions, washed once with PBS (pH 7.4) containing 0.1% BSA + 0.05% NaN3, the supernatant was discarded, and the cell density was adjusted to 10⁶Marking MSCs by flow antibodies CD29, CD34, CD44, CD45, CD73, CD90, CD105 and CD166 in a flow tube, fully shaking and uniformly mixing, incubating for 30min at 4 ℃ in a dark place, and washing twice by PBS (pH 7.4) containing 0.1% BSA and 0.05% NaN3 to remove redundant antibodies; discard the supernatant, resuspend the cells with 200ul 1% PFA, flow assay MSCs cell phenotype (CD29+, CD34-, CD44+, CD45-, CD73+, CD90+, CD105+, CD166+), demonstrating that in vitro culture had no effect on MSC cell phenotype.

And transferring the P2 generation cells to a six-well plate until the length reaches about 60% for standby.

2. Acquisition of peripheral blood mononuclear cells:

20ml of fresh peripheral blood of healthy volunteers is taken, diluted by 1:1 with 1 XPBS, separated by density gradient centrifugation with Ficoll-Paque lymph separation fluid, and all white membranous mononuclear cells are collected and diluted by 1:4 with sterile PBS. Centrifuge at 2000rpm for 10min and discard the supernatant. Sufficient PBS was added and washed twice. The cells were suspended in RPMI-1640 complete medium, i.e.human Peripheral Blood Mononuclear Cells (PBMC) were obtained.

Extracting peripheral blood mononuclear cell RNA by a Trizol method:

adding the obtained human Peripheral Blood Mononuclear Cells (PBMC) into 1ml of Trizol solution, blowing, uniformly mixing to fully crack the cells, and standing for 5 min; adding 200 μ l chloroform, shaking vigorously and mixing for 20s to make the water phase and organic phase contact sufficiently, standing at room temperature for 15 min; centrifuging at 12000rpm at 4 deg.C for 15min to obtain three layers, wherein RNA is in the upper water phase, and carefully transferring to another new RNase free EP tube; adding 0.5ml isopropanol, gently mixing well, standing at room temperature for 10min, and precipitating RNA; centrifuging at 12000g for 10min at 4 deg.C, collecting RNA precipitate, and removing supernatant; washing the tube wall twice with 75% ethanol, and air-drying on an ultra-clean bench; the precipitate was dissolved in 50. mu.l of DEPC water and the concentration was measured with a NanoDrop ultramicro spectrophotometer.

4. Reverse transcription:

removal of genomic DNA: RNA (1. mu.g) + DNase I (1. mu.l) + Buffer DNase I with MgCl2 (1. mu.l) + DEPC water, 10. mu.l system, incubated at 37 ℃ for 30 min; EDTA (1. mu.l) was added and incubated at 65 ℃ for 10 min; oligo (dT) (1. mu.l) was added and incubated at 65 ℃ for 10 min; finally, 5 × Reaction Buffer (5 μ l), RNase-Ribonucleae Inhibitor (1 μ l), 10mM dNTP Mix (2 μ l), M-MLV RT (1 μ l), RNase Free Water 25 μ l system was added, and the mixture was incubated at 42 ℃ for 60min to collect the cDNA product.

PCR reaction and recovery of CCR2cDNA fragments:

and (3) PCR reaction: 2 XStar mix (containing Taq DNApolymerase, dNTPs, Mg2+, reaction buffer, stabilizer, etc.) 10. mu.l, DEPC water 7. mu.l, upstream primer 1. mu.l, downstream primer 1. mu.l, cDNA 1. mu.l, total 20. mu.l; the fragment size of CXCR5 is 1119 bp. And (3) glue recovery: the band of the target fragment is cut by a sharp scalpel, and the agarose gel DNA recovery kit is used for cutting gel to recover the fragment of the PCR target gene CCR 2.

Wherein, the target gene CCR2 fragment is obtained through PCR reaction, and the adopted primer sequences are as follows:

upstream primer TTTGGTACCTACGGTGCTCCCTGTCATAAA(SEQ ID NO:1)，

Downstream primer TTTTTCGAATAAGATGAGGACGACCAGCAT(SEQ ID NO:2)。

Wherein, the underlined parts of the upstream primer sequence and the downstream primer sequence respectively show the restriction enzyme sites Kpn I and Sfu I.

Construction of pcDNA3.1/CCR2 plasmid

The PCR product was digested with Kpn I and Sfu I, and purified and recovered with a Tiangen general-purpose DNA purification and recovery kit. The double digestion was carried out with Kpn I and Sfu I at the same time, and the product was purified and recovered with the above-mentioned kit. The gene fragment of interest was ligated with pcDNA3.1 linearized plasmid using T4DNA ligase overnight at 16 ℃. After the ligation product is transfected into competent T1 bacteria, the ligation product is spread on a culture plate containing Kanamycin and cultured for 12h at 37 ℃, and then a single colony is picked for PCR identification. After the primary identification is successful, extracting the plasmid by using a Tiangen plasmid miniprep kit, and sending the plasmid to a company Limited in the biological engineering (Shanghai) for sequencing identification.

In vitro Synthesis of CCR2mRNA

Linearization of plasmid, using enzyme cutting site of Pme I at downstream of CCR2 gene in plasmid, and linearizing pcDNA3.1/CCR2 plasmid by Pme I digestion. The plasmid digested liquid is treated by proteinase K and SDS, and then is subjected to phenol/chloroform extraction and ethanol precipitation to obtain purified pcDNA3.1/CCR2 linear plasmid DNA.

② in vitro synthesis of cap structure mRNA, synthesizing the cap structure-containing mRNA by using mMESSAGE RNA transcription kit. The main steps are that linear DNA is used as a template, 4 NTP and cap analogues are used as raw materials, and mRNA with a 5' end cap structure is synthesized under the catalysis of T7RNA polymerase. The above synthesis reaction solution was digested with DNase I (to remove template DNA), and then mRNA was isolated and purified by LiC l precipitation.

③ poly-A tailing of mRNA, namely, the tail of CCR2mRNA with a 5 ' end cap structure is tailing under the catalysis of yeast poly (A) polymerase by taking ATP as a raw material to generate mRNA with a complete structure, namely CCR2mRNA with a 5 ' end cap structure and a3 ' end poly-A tail. Finally the size of the mRNA was checked by denaturing agarose gel electrophoresis. The concentration of mRNA was estimated by measuring the value of absorbance (A) at a wavelength of 260 nm.

CCR2mRNA in vitro transfection of MSCs

The synthesized CCR2mRNA was transfected using the TransIT-mRNA kit. The specific operation is as follows:

after digesting MSC grown to 3-4 generations, it was resuspended to a density of 1X 10 with fresh complete medium⁵And seeded into 12-well plates, 1mL per well.

And secondly, replacing fresh complete culture solution 1h before transfection after the cells adhere to the wall.

③ 1. mu.g of CCR2mRNA was added to 100. mu.L of Opti-MEM culture medium and gently pipetted and mixed.

Fourthly, adding 1 mu L of BOOSTreagent and 1 mu L of TransIT-mRNA into the mixture in the previous step.

Fifthly, slowly and uniformly adding the mixture into the MSC culture solution, slowly shaking to uniformly distribute the mRNA, and controlling the temperature to be 37 ℃ and 5 percent CO₂Culturing in an incubator.

9. Detection of expression of CCR2mRNA and protein

Collecting cells after mRNA transfection in a 12-hole plate after 72 hours, sorting and purifying by a flow cytometer to obtain a transgenic cell line and amplifying;

detecting the content of the CCR2mRNA expressed by the transfected MSC by Real-time Quantitative PCR (RT-PCR):

firstly, RNA extraction and reverse transcription: step reference steps 3, 4 in example 1;

a PCR amplification reaction system:

total 20. mu.l;

reaction conditions are as follows: 10min at 95 ℃; 3 steps of method, 40 cycles: 95 ℃ for 15s, 60 ℃ for 30s, and 72 ℃ for 15 s; melting curve: read 1 time per minute at 55-95 ℃.

The primers used in the PCR amplification reaction system are as follows:

GAPDH：

an upstream primer: GAAGGTGAAGGTCGGAGTC (SEQ ID NO:3)

A downstream primer: GAAGATGGTGATGGGATTTC (SEQ ID NO:4)

CCR2：

An upstream primer: TACGGTGCTCCCTGTCATAAA (SEQ ID NO:5)

A downstream primer: TAAGATGAGGACGACCAGCAT (SEQ ID NO:6)

Western Blot detection of protein levels of CCR2 expressed by MSC after infection:

extracting protein: taking the MSCs (MSCs) that overexpress CCR2 in culture^CCR2) And a control group of MSCs, which were placed on ice, the culture solution was removed, washed twice with precooled PBS, and then 1 XSDS loading buffer (62.5mM Tris-HCl (pH6.8), 2% (w/v) SDS, 10% glycerol, 50mM DTT, 0.1% (w/v) bromophenol blue) containing 5% DTT was added, and the cells were lysed sufficiently by rapidly pipetting back and forth (about 10 times) with a 1ml pipette gun. Sucking liquid after blowing, putting the liquid into a 1.5mL Eppendorf centrifugal tube, and ultrasonically crushing the liquid for 3 times at 4 ℃ for 1 second each time; boiling at 100 deg.C for 5min, cooling at 4 deg.C, and centrifuging at 15000g for 5min at 4 deg.C, and preparing for electrophoresis or storing at-80 deg.C for use.

Gel electrophoresis separation of samples: denatured polyacrylamide gel (condensed polyacrylamide gel, SDS-PAGE): adding 4.1mL of separation glue, sealing with deionized water, pouring off the water seal after an obvious interface appears, and adding the prepared concentrated glue to the top end of the short glass block. And inserting the comb, wherein when the glue surface has an irregular shape, the glue is well polymerized, and the comb can be pulled out and loaded.

In this order, 15. mu.L of a sample boiled at 100 ℃ for 5 minutes was added to each lane, and electrophoresed at constant pressure of 120V for about 45 minutes in SDS electrophoresis buffer.

③ transferring the film: materials required for membrane transfer, such as sponge, filter paper, PVDF membrane, etc., were soaked in membrane transfer buffer (25mM Tris base, 0.2M glycine, 20% methanol pH8.5) while electrophoresis was performed. After electrophoresis, the gel was removed and the concentrated gel portion was removed. And (3) placing the glue in the film transfer liquid for balancing for 15-30 minutes to remove SDS attached to the surface of the glue. Then, a membrane sandwich box is arranged from the negative electrode to the positive electrode, the sandwich box is arranged according to the sequence of sponge, a layer of filter paper, gel, a PVDF membrane, a layer of filter paper and sponge, the sandwich box is placed in a transfer tank after being fixed, and the PVDF membrane faces to the direction of the positive electrode. The sandwich cassette and ice cassette were placed in a transfer chamber and 600mL of transfer buffer was injected under a constant current of 200mA2 h.

Antigen-antibody reaction:

after the transfer, the PVDF membrane was removed, washed in 25mL of TBS (50mM Tris-HCl pH7.4, 150mM NaCl) for 10 minutes, transferred to 20mL of blocking solution [ 1 XTSST containing 5% skim milk (0.05% Tween-20in TBS) ] and blocked by shaking at room temperature for 1 hour, and the corresponding primary antibody diluted with 5% (w/v) skim milk was added. Gently shake overnight at 4 ℃. The next day, the membrane was washed 3 times with 1 × TBST for 5 minutes each, and then 15mL of a secondary antibody (1:2000) labeled with horseradish peroxidase (HRP) diluted with a blocking solution was added, followed by shaking at room temperature for 1 hour. The membrane was then washed 3 times with 1 XTSST for 10 minutes each and developed using a bio-rad chemiluminescence apparatus.

The results are shown in FIG. 1, which shows: the efficiency of over-expressing CCR2 is up to 83.3 percent by flow counting detection; the level of CCR2 gene in MSC is obviously increased by fluorescent quantitative PCR detection; western blotting experiments prove that the overexpression of the CCR2 protein in the MSC is successful.

Example 2Characterization of the biological Properties of MSCs

Characterization of MSC phenotypes

Digesting the in vitro cultured MSC into a single cell suspension, washing once with PBS (pH 7.4) containing 0.1% BSA + 0.05% NaN3, discarding the supernatant, adjusting the cell density to 106/ml in a flow tube, adopting flow antibodies CD29, CD34, CD44, CD45, CD73, CD90, CD105 and CD166 to mark MSCs, fully shaking and uniformly mixing, incubating for 30min in a dark place at 4 ℃, and then washing twice with PBS (pH 7.4) containing 0.1% BSA + 0.05% NaN3 to remove redundant antibodies; the supernatant was discarded, the cells were resuspended with 200ul 1% PFA, and the MSCs cell phenotype (CD29+, CD34-, CD44+, CD45-, CD73+, CD90+, CD105+, CD166+) was flow-tested, demonstrating that in vitro culture had no effect on the MSC cell phenotype, with the results shown in fig. 2A. Identification of the multidirectional differentiation Capacity of MSC

(1) Osteogenic differentiation: inducing osteogenic differentiation of modified MSCs at 4X 10³/cm²Inoculating the cells in a 6-pore plate at a density, and changing into an osteoinduction culture solution for induction after the cells reach 50% confluence, wherein the induction solution is prepared by adding 100ml/L fetal calf serum, 50mg/L ascorbic acid, 0.1 mu mol/L dexamethasone and 0.5mmol/L beta-sodium glycerophosphate into DMEM. The cells of 5 th, 8 th and 10 th generations were sampled and stained 6 th, 9 th, 12 th and 15 th days after the addition of the inducing liquid, and the osteogenic capacity thereof was quantitatively analyzed. And simultaneously performing induction for 14 th and 21 th days, sucking osteogenesis induction liquid, washing for 3 times by using PBS (phosphate buffer solution), adding a proper amount of alizarin red S staining liquid, dropping and staining for 3-5 minutes, and observing a calcium nodule staining result under a mirror.

(2) Adipogenic differentiation: inducing adipogenic differentiation of the modified MSCs at 4X 10³/cm²Inoculating the density of cells into a 6-hole plate, changing into a fat induction culture solution for induction after the cells are completely converged, adding a fat induction solution A (L-DMEM basic culture solution contains 10% fetal calf serum, 1 mu mol/L dexamethasone, 0.5mmol/L IBMX, 10 mu g/mL bovine insulin and 0.2mmol/L indomethacin), and inducing for 3 days; then, the cells were treated with adipogenic induction solution B (HDMEM basal medium containing 10% fetal bovine serum, 10. mu.g/ml bovine insulin) for 1 day. The above cycle is repeated 3 times, and the control group is added with 10mg/L bovine insulin and 10% FCSL-DMEM, and the solution is changed 1 time every 3-4 days. The change of cell morphology and growth condition were observed under microscope. The induced cells were washed 3 times with PBS, fixed with 10% paraformaldehyde for 10 minutes, stained with oil red O for 5-10 minutes, slightly washed with 60% isopropanol to remove excess stain, washed with distilled water, and the results of staining with oil red O were observed under an optical microscope. The results of the characterization of the multipotentiality of MSCs are shown in fig. 2B-2C, which show: both MSCs before and after modification had normal osteogenic and adipogenic differentiation capacity.

Example 3MCAO model construction

(1) MCAO model construction

Rats were fasted for 12h before surgery and had free access to water. Injecting 10% chloral hydrate 350mg/kg into abdominal cavity to induce anesthesia, fixing in supine position, taking a median cervical incision, separating right common carotid artery, external jugular vein and internal jugular vein, electrically coagulating and burning off the branches of external carotid artery, ligating and dissociating the trunk of external carotid artery, cutting a small opening on the dissociated section, placing 4-0 nylon thread with the tail end burnt into a round head into the external carotid artery, and branching from the common carotid artery such as the internal carotid artery, wherein the depth is about 18-20 mm from the branching position of the common carotid artery until slight resistance is felt. The line bolt is withdrawn to the external carotid artery stump when the cerebral ischemia of the rat is 1.5h, and reperfusion is formed.

② the Sham group only about 10mm of plug wire insertion, does not block the blood supply to the middle cerebral artery.

(2) Animals were divided into 5 groups of 8 animals each:

group of Sham operations (Sham);

PBS treatment (PBS) group;

③ MSC treatment (MSC) group;

④MSC^CCR2treatment (MSC)^dTomato) And (4) grouping.

Example 4 migration of MSCs that overexpress CCR2

In vitro experiments were performed in 48-well micrometastasis plates with built-in 8 μm-pore polycarbonate membranes, and blank control, recombinant human CCL2, recombinant rat CCL2, and MSC were added to the lower chamber of the transfer plate^CCR2And MSC^dtomatoThe cells were added to the upper chamber, and the cell migration index was calculated by observing the cell migration. The results are shown in FIG. 3, where FIG. 3A shows the MSC^CCR2The group had a stronger migratory function than the control group, and fig. 3B shows that both rat and human-derived CCL2 ligands were effective in attracting MSCs^CCR2Cell migration. Figure 3C shows that MSCs overexpressing CCR2 were able to more efficiently localize to the site of brain stroke injury (white arrows indicate MSC cells). FIG. 3D shows that the number of MSC localization to brain injury sites increases with increasing days post-modeling.

Example 5Detection of antioxidant gene expression condition and antioxidant capacity of MSC (mesenchymal Stem cell) overexpressing CCR2

1. Resistance to expression of oxidative genes

MSCs after mRNA transcription processing are added with Trizol for heavy suspension, and are transferred to-80 ℃ for storage after being quickly frozen by liquid nitrogen for RNA-seq.

RNA-seq was made by Shanghai Ouyi biomedical science and technology, Inc., and the brief steps were as follows: the DNA is digested by DNase, RNA is enriched, mRNA is broken into short segments by using a breaking reagent, cDNA is synthesized by using the short segments as a template, double-stranded cDNA is purified by using a kit, end repair and A tail addition are carried out, a proper segment size is selected for PCR amplification after connection of a joint, and the constructed library is qualified by Agilent 2100Bioanalyzer quality and then sequenced by using an Illumina HiSeqTM 2500 sequencer.

After the alignment results were passed through QC, the genes were analyzed for expression, and the gene expression amounts were calculated and analyzed using the FPKM (fragments per kb per Million reads) method.

2. Detection of antioxidant capacity

Mouse brain endothelial cells are inoculated in a 24-well plate, and the density ensures that the fusion degree reaches about 80% on the next day. Sugar oxygen deprivation was followed (OGD model, a model for studying endothelial injury that mimics MCAO in vivo in vitro). The medium before detection is replaced by fresh medium containing 5 mu mol/L

Culturing complete culture medium of oxidative stress agents (Life Technologies) in a 37 ℃ cell culture box for 30min, then removing the culture medium, washing cells for 5min multiplied by 3 times by PBS, and removing residual dye; digesting the cells with pancreatin for 1min, discarding, terminating digestion with FBS, blowing to obtain single cell suspension, collecting the cells into a 1.5mL EP tube, centrifuging to remove FBS, adding 300. mu.L PBS to resuspend the cells, and detecting on a machine. The detection result is expressed by fluorescence intensity, and the whole operation process needs to be carried out by avoiding strong light from directly irradiating the cells.

MSC^CCR2The results of the expression of antioxidant genes and the detection of their antioxidant capacity are shown in FIG. 4, in which FIG. 4 shows: endothelial cells of the OGD group produce large amounts of reactive oxygen species, while co-culturing MSCs^CCR2And MSC^dtomatoEndothelial cells (i.e., MSC)^CCR2Group and MSC^dtomatoGroup), its reactive oxygen species level decreased significantly, suggesting that MSC has strong antioxidant capacity. Further, the expression of all antioxidant-related secretory proteins in the MSCs is analyzed through RNA-seq, and the result shows that the expression of PRDX4 is highest, which indicates that the antioxidant effect can be generated by secreting the protein.

Example 6Evaluation of migration after MSC vein transplantation and curative effect on acute ischemic stroke lesion tissue

1. Health careAdult male SD rats were divided into four groups: a false operation group; ② 24h postoperation tail vein injection PBS group of MCAO; ③ injecting MSC group into tail vein 24h after MCAO operation; fourthly, 24h tail vein injection MSC after MCAO operation^CCR2And (4) grouping.

Measuring the area of the dead area of the brain stem after TTC staining

Taking brain tissue 4 days after operation, performing coronary section of 1mm from back to front in a refrigerator at-20 ℃ for 20min, placing in 2% TTC staining solution, incubating at 37 ℃ in the dark for 30min, fixing with 4% paraformaldehyde for 6h, observing staining condition of cerebral infarction focus, and determining cerebral infarction volume by ImageJ.

3. Detection of changes in neurological function (Menzies) scores in groups of rats

Rats MCAO were scored for neurological deficit by an unsupervised group of individuals 1, 4, and 7 days post-surgery using the Menzies scoring criteria: no nerve function damage, and the two forelimbs symmetrically extend to the ground (0 min); continued adduction of the contralateral forelimb (1 point); the grip strength of the contralateral forelimb is reduced (2 min); slightly stimulate the rat stomach, and turn to the contralateral side (3 min); autonomous sustained revolutions (4 min).

4. Testing Blood Brain Barrier (BBB) integrity

(1) Detecting the extent of cerebral edema

The moisture content of brain tissue is measured by dry-wet weight method. Performing intraperitoneal injection anesthesia on 10% chloral hydrate, rapidly cutting head to obtain brain, taking ischemic lateral brain tissue, sucking off surface water of brain by using filter paper, measuring dry weight of brain tissue, dehydrating at 95 ℃ for 24h, and measuring dry weight after dehydration. Brain tissue water content (wet weight-dry weight)/wet weight 100%.

(2) Detecting the amount of EB dye bleeding

The rats were injected with 2% EB physiological saline solution (6ml/kg) via femoral vein 3h before death, and the bulbar conjunctiva, limbs, etc. of the rats all showed blue color after a few seconds. The brain tissue was taken and homogenized in 1ml of 5% trichloroacetic acid solution, and the homogenate was centrifuged (15000g, 15min) to obtain the supernatant, which was diluted 4-fold in absolute ethanol. Fluorescence values were measured using a fluorescence spectrophotometer (excitation wavelength 620nm, emission wavelength 680nm, bandwidth 10 nm). A standard curve (linear) was drawn between EB and fluorescence values according to the external standard of the EB solution. And calculating the sample concentration according to the standard curve by the measured fluorescence value, solving the EB content in the brain tissue extract, and comparing the EB content with the mass of the brain tissue to obtain the EB content in the brain tissue per gram wet weight.

Intravenous MSC^CCR2The results of the tests for reducing cerebral ischemic injury and promoting recovery of nervous system function are shown in fig. 5, which shows: MSC for intravenous injection after MCAO molding^CCR2Collecting samples for detection on the following 1, 4 and 7 days, and testing by nerve function scoring and Ewent blue dye detection experiments to prove that MSC^CCR2Can be used for promoting recovery of nervous system function caused by cerebral ischemic stroke.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Zhongshan university

<120> mesenchymal stem cells overexpressing CCR2 for treating acute ischemic stroke and preparation method thereof

<130> 2018

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

tttggtacct acggtgctcc ctgtcataaa 30

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

tttttcgaat aagatgagga cgaccagcat 30

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

gaaggtgaag gtcggagtc 19

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

gaagatggtg atgggatttc 20

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

tacggtgctc cctgtcataa a 21

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

taagatgagg acgaccagca t 21

Claims (3)

1. The application of mesenchymal stem cells over expressing CCR2 in the preparation of the medicine for treating cerebral ischemic stroke is characterized in that: the mesenchymal stem cells have the ability to home and colonize ischemic brain tissue and secrete high-level antioxidant protein PRDX4 for reducing reactive oxygen species levels;

the preparation method of the mesenchymal stem cells over expressing CCR2 comprises the following steps:

(1) constructing a plasmid expressing CCR 2;

(2) synthesizing CCR2mRNA by using the plasmid constructed in the step (1);

(3) and (3) transfecting the CCR2mRNA synthesized in the step (2) into the mesenchymal stem cells to obtain the mesenchymal stem cells over-expressing CCR 2.

2. The use according to claim 1, wherein the mesenchymal stem cells overexpressing CCR2 are prepared by a method comprising the steps of:

(1) constructing a plasmid expressing CCR 2; the method specifically comprises the following steps: extracting peripheral blood mononuclear cell RNA, performing reverse transcription to obtain cDNA, amplifying full-length CCR2cDNA by using a CCR2 specific PCR primer, performing double enzyme digestion on a PCR product and plasmid pcDNA3.1 by Kpn I and Sfu I, purifying, and connecting a CCR2 target gene fragment to pcDNA3.1 plasmid to obtain a plasmid for expressing CCR 2; the CCR2 specific PCR primer is an upstream primer 5'-TTGGTACCTACGGTGCTCCCTGTCATAAA-3' and a downstream primer 5'-TTTTTCGAATAAGATGAGGACGACCAGCAT-3';

(2) synthesizing CCR2mRNA by using the plasmid constructed in the step (1); the method specifically comprises the following steps:

(2.1) linearizing the plasmid constructed in the step (1) to obtain linear plasmid DNA;

(2.2) synthesizing CCR2mRNA with a 5' end cap structure by using the linear plasmid DNA obtained in the step (2.1) as a template;

(2.3) tailing the CCR2mRNA synthesized in the step (2.2) and provided with a 5' end cap structure to obtain CCR2 mRNA;

(3) and (3) transfecting the CCR2mRNA synthesized in the step (2) into the mesenchymal stem cells to obtain the mesenchymal stem cells over-expressing CCR 2.

3. Use according to claim 1 or 2, wherein the mesenchymal stem cells overexpressing CCR2 are used for the preparation of a medicament for the treatment of ischemic stroke.

Images