CN113684184A

CN113684184A - Method for preparing chimeric antigen receptor NK (natural killer) cells of targeted CD19 from human pluripotent stem cells and application of method

Info

Publication number: CN113684184A
Application number: CN202110683914.2A
Authority: CN
Inventors: 李扬; 周士新
Original assignee: Peking University
Current assignee: Rui Zhen Zhen Regenerative Medicine Technology Co ltd
Priority date: 2021-06-21
Filing date: 2021-06-21
Publication date: 2021-11-23

Abstract

The invention discloses a method for preparing chimeric antigen receptor NK cells targeting CD19 from human pluripotent stem cells and application of the chimeric antigen receptor NK cells. Specifically discloses a method for preparing CD19-CAR-NK cells, which utilizes a CRISPR/CAS9 system of a targeting AAVS1 site to directionally knock a CD19-CAR gene and an EF1 alpha promoter into an AAVS1 region of a genome of a human pluripotent stem cell to obtain a recombinant geneGrouping human pluripotent stem cells (CD19-CAR-hPSC), inducing cultured CD19-CAR-hPSC to differentiate into embryoid-like bodies, sorting CD34 from hematopoietic precursor cells differentiated from the embryoid-like bodies⁺Hematopoietic precursor cells, then directionally differentiating into NK cells, and finally differentiating into CD19-CAR-NK cells. The CD19-CAR-NK cell has higher proliferation capacity, higher purity and stronger anti-tumor capacity, and can be safely and effectively used for tumor immunotherapy.

Description

Method for preparing chimeric antigen receptor NK (natural killer) cells of targeted CD19 from human pluripotent stem cells and application of method

Technical Field

The invention belongs to the field of cellular immunotherapy, and particularly relates to a method for preparing chimeric antigen receptor NK cells targeting CD19 by human pluripotent stem cells and application of the chimeric antigen receptor NK cells.

Background

The Chimeric Antigen Receptor (CAR) technology is to modify immune cells by adopting a genetic engineering technology to express an exogenous anti-tumor gene (CAR gene), so that the immune cells such as lymphocytes and the like have the capacity of recognizing tumor cell surface antigens and specifically recognize and kill the tumor cells without the limitation of a histocompatibility complex (MHC), the CAR structure mainly comprises a structural domain for recognizing the tumor cell surface antigens from the outside and a signal transduction structural domain in cells, the structural domain from the outside is used for specifically recognizing tumor surface specific proteins (antigens), and the structural domain from the inside contains a costimulatory molecule structural domain, which is used for initiating the immune response of the lymphocytes after recognizing the tumor surface specific proteins (antigens) and plays a cytotoxic role aiming at the specific target cells, thereby killing the target cells (tumor cells). At present, CAR-T technology can be applied to clinical medicine, and a plurality of successful clinical cases are obtained all over the world, but the Cytokine Release Syndrome (CRS) caused by Car-T cells is the most important adverse reaction of the current treatment method, can cause serious consequences such as acute respiratory distress syndrome and multi-organ failure, and has not yet achieved remarkable curative effect on solid tumors.

Natural killer cells (NK) are the prime force of the Natural immunity (nature immunity) system and are considered the first Natural defense line of the body against infection and tumor. NK cells are derived from bone marrow lymphoid stem cells, are mainly distributed in bone marrow, peripheral blood, liver, spleen, lung and lymph nodes, are important immune cells of an organism, and are closely related to tumor resistance, virus infection resistance and immune regulation. NK cell surface inherently expresses a variety of activating and inhibitory receptors, serving to protect self tissues and monitor diseased cells. Depends on the recognition mode of NK cell inherent expression receptor, can recognize pathological change or malignant transformation cell without the restriction of MHC, has the functions of fast response and killing pathological change cell, and plays the role of immune monitoring. T cells also have direct killing, but require antigen presentation by Antigen Presenting Cells (APCs), as well as MHC limitations. T cells are diverse in types and strong in amplification capability in vivo, can generate long-term immune response, but also have the risk of cytokine storm. NK cells have distinct advantages over T cells in tumor immunotherapy: the NK cell subgroup is few, the survival time in vivo is short, side effects such as cytokine storm and the like are avoided, and the unexpected risk is low; in addition, due to immune rejection mechanism, autologous cells are mostly used for treating T cells at present, and it has been reported that the tumor immunotherapy based on allogeneic NK cells has no serious uncontrolled Graft rejection host reaction (GVHR), so that the tumor immunotherapy can be provided for a receiver from a donor without matching, which shows the feasibility of allogeneic NK cell therapy, and a plurality of doses of CAR-NK cells can be prepared from one donor to treat a plurality of patients, so that the tumor immunotherapy is a natural 'universal' (i.e. 'one source' is applicable to a large number of people) source of immune cell therapy, and is easier to popularize and apply clinically.

There are several key problems with current NK cell therapies: 1) the source is insufficient, the number of NK cells directly collected from peripheral blood lymphocytes of healthy volunteers is small, the amplification capacity is poor, the amplification time is long, and the number of cells required by treatment is generally difficult to achieve; 2) the tumor patients have low self immunity, and the obtained autologous NK cell activity and amplification capacity are poorer than those of healthy volunteers, so that the method is difficult to be suitable for large-scale treatment and meet the requirements of the majority of cancer patients. In order to solve the problem of NK cell origin, researchers have utilized the in vitro expansion capacity of human Pluripotent Stem Cells (PSC) including human Embryonic Stem Cells (ESC) and human Induced Pluripotent stem Cells (iPSC) (Themeli M, Kloss CC, Ciriello G, Fedorov VD, Perna F, Gonen M, Sadelain M. Generation of moved-targeted human T lymphocyte cell for thermal therapy. Nat Biotechnology.2013; 31 (31) (10) Med 2012-33. doi: 10.1038/nbt.2678; Knorr TM DA, Ni Z, mangneson D, Hexum 283, Bendi J.M. Cooperi.20184. Miq. M. Miq. Lloy K.3. Furi. Miq. Lloy.3. Fulvin K.4. Level-cell.M.8. Miq. Fulvia-3. Fulvin cell, Lentic. Miq. Fulvin cell, Lflor et al. Miq. Lflor et al., Lnorr. Miq. Lnorshows < 6. Lnordic. Lflor et al., Lnordic. Miq. mu. Miq. mu. Miq. It et al., Lnorbard. Miq. mu. Miq. mu. It et al., Lnorbard. Miq. mu. Miq. It et al., Lnorbard. mu. Miq. It et al., Lnorbard. Miq. mu. Miq. It et al., Lnorbard. It et al., Lnov et al., Lnorbard. It et al., Lflor et al., Lloy et al., Lnov et al., Lloy et al., Miq. Mi., Lloy et al., Mi et al., Mitsu et al., Mi et al., Lloy et al., Mitsu et al., Lloy et al., Mitsu et al. The PSC can be propagated indefinitely in an undifferentiated state in vitro, and in combination with an in vitro cell differentiation technology, the PSC can be used as an unlimited stem cell source bank for NK cell treatment of a patient theoretically, so that the problem of cell source is fundamentally solved. However, the differentiation process of the human pluripotent stem cells into NK cells, which is reported at present, has the problems of complicated process, long period, feeder layer cell dependence, unclear culture medium components, low purity and activity and the like, and the residual undifferentiated cells are easy to cause cancer risks. Therefore, optimizing the NK cell differentiation method, improving the purity of the obtained NK cells, removing the influence of undifferentiated cells, and improving the proliferation capacity and killing capacity of the NK cells, so as to ensure the safety and effectiveness of clinical application of NK cell therapy, remains a direction in which exploration and research are urgently needed, and researches and develops new effector cells with strong anti-tumor effect, which have important theoretical significance and application value for immune cell therapy of tumors.

Disclosure of Invention

The technical problem to be solved by the invention is how to prepare a safer and more efficient chimeric antigen receptor targeting CD19 for tumor immune cell therapy and/or a CD19-CAR-NK cell expressing the chimeric antigen receptor. The technical problem to be solved is not limited to the technical subject as described, and other technical subject not mentioned herein may be clearly understood by those skilled in the art through the following description.

To solve the above technical problem, the present invention firstly provides a method for preparing recombinant NK cells (named CD19-CAR-NK cells) expressing CAR, comprising the steps of: differentiating the recombinant pluripotent stem cell expressing the CD19-CAR gene into a natural killer cell, wherein the natural killer cell is a recombinant NK cell expressing CAR; the CD19-CAR is a protein comprising an extracellular domain, a transmembrane domain, and an intracellular domain; the extracellular domain comprises an scFv against CD19 (CD19 scFv), and the intracellular domain comprises the intracellular region of 2B4(CD244) and the intracellular region of DAP 10.

The recombinant pluripotent stem cell may be a human recombinant pluripotent stem cell. Among the intracellular domains, the intracellular domain of 2B4 and the intracellular domain of DAP10 constitute co-stimulatory domains.

The CD19-CAR is a chimeric antigen receptor against CD 19; the CD19-CAR gene is a chimeric antigen receptor gene against CD 19; the CD19-CAR-NK cell is a recombinant NK cell expressing a CD19-CAR gene.

The CD19-CAR of the present invention is also referred to herein and in the drawings as NK-19CAR or 19 CAR.

In the above method, the CD19-CAR is any one of the following proteins:

p1, the transmembrane domain is the transmembrane region of 2B 4;

p2, the intracellular domain of said CD19-CAR further comprises CD3 ζ, and/or said CD19-CAR further comprises a CD8 hinge region, and/or said CD19-CAR further comprises a signal peptide;

p3, the transmembrane domain is the transmembrane region of 2B4, and the intracellular domain of the CD19-CAR further comprises CD3 ζ, and the CD19-CAR further comprises a CD8 hinge region, and the CD19-CAR further comprises a signal peptide;

p4, the transmembrane domain is the transmembrane region of 2B4, and the intracellular domain of the CD19-CAR further comprises CD3 ζ, and the CD19-CAR further comprises a CD8 hinge region.

In the above method, the intracellular domain of 2B4 is any one of the following proteins:

C1) the protein of which the amino acid sequence is 333-446 of SEQ ID No. 2;

C2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the 333-446 th position of the SEQ ID No.2, has more than 80 percent of identity with the protein shown in the C1) and has the same function;

C3) a fusion protein having the same function obtained by attaching a protein tag to the N-terminus and/or C-terminus of C1) or C2);

the intracellular region of DAP10 is any one of the following proteins:

D1) the protein of which the amino acid sequence is position 447 and 470 of SEQ ID No. 2;

D2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the 447-470 position of the SEQ ID No.2, has more than 80 percent of identity with the protein shown in D1) and has the same function;

D3) fusion proteins having the same function obtained by attaching protein tags to the N-terminus and/or C-terminus of D1) or D2);

the transmembrane region of 2B4 is any one of the following proteins:

E1) the protein of which the amino acid sequence is 309-332 of SEQ ID No. 2;

E2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the 309-332 position of the SEQ ID No.2, has more than 80 percent of identity with the protein shown in E1) and has the same function;

E3) fusion proteins having the same function obtained by attaching protein tags to the N-terminus and/or C-terminus of E1) or E2);

the CD3zeta is any one of the following proteins:

F1) the protein with the amino acid sequence of 471-582 of SEQ ID No. 2;

F2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the 471-582 position of the SEQ ID No.2, has more than 80 percent of identity with the protein shown in F1) and has a signal transduction function;

F3) a fusion protein having a signal transduction function obtained by attaching a protein tag to the N-terminus and/or C-terminus of F1) or F2);

the CD8 hinge region is any one of the following proteins:

G1) the protein with the amino acid sequence of the 264-308 th position of SEQ ID No. 2;

G2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues in the amino acid sequence shown in the 264-308 th position of the SEQ ID No.2, has more than 80 percent of identity with the protein shown in G1) and has the same function;

G3) fusion proteins having the same function obtained by attaching protein tags to the N-terminus and/or C-terminus of G1) or G2);

the scFv against CD19 is any one of the following proteins:

H1) protein with amino acid sequence of 22-263 of SEQ ID No. 2;

H2) protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in 22-263 th position of SEQ ID No.2, has more than 80% of identity with the protein shown in H1), and has the same function;

H3) fusion proteins having the same function obtained by attaching protein tags to the N-terminus and/or C-terminus of H1) or H2);

the signal peptide is any one of the following proteins:

I1) a protein having an amino acid sequence of positions 1-21 of SEQ ID No. 2;

I2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues of the amino acid sequence shown in the 1 st to 21 st positions of SEQ ID No.2, has more than 80 percent of identity with the protein shown in I1), and has the same function;

I3) the fusion protein with the same function is obtained by connecting protein labels at the N terminal and/or the C terminal of I1) or I2).

In the above method, the CD19-CAR is any one of the following proteins:

K1) a protein having the amino acid sequence of SEQ ID No. 2;

K2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence of SEQ ID No.2, has more than 80% of identity with the protein shown by K1), and has the same function;

K3) a fusion protein having the same function obtained by attaching a protein tag to the N-terminus and/or C-terminus of K1) or K2).

Herein, the protein tag is shown in table 1:

table 1: sequence of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

In the above method, the method for differentiating the recombinant pluripotent stem cell expressing the CD19-CAR gene into a natural killer cell comprises the step of constructing the recombinant pluripotent stem cell expressing the CD19-CAR gene, and the step of constructing the recombinant pluripotent stem cell expressing the CD19-CAR gene comprises knocking in the CD19-CAR gene and the EF1 α promoter at the AAVS1 site of the pluripotent stem cell.

The nucleotide sequence of the EF1 alpha promoter is shown as SEQ ID No. 3.

The pluripotent stem cells may be human pluripotent stem cells.

The human Pluripotent Stem Cell (hPSC) can be human Embryonic Stem Cell (ESC) and/or human Induced Pluripotent Stem Cell (iPSC). The AAVS1 site is located on chromosome 19 of the human genome, is an open chromosome structure, can ensure the normal transcription of the transferred target gene, and has no known side effect on cells.

Further, in the above method, the method of knocking in the CD19-CAR gene at the AAVS1 site of the human pluripotent stem cell comprises: homologous recombination between the AAVS1 site and a donor clone carrying a CD19-CAR gene is induced by using a CRISPR/CAS9 system targeting the AAVS1 site, so that the CD19-CAR gene on the donor clone is integrated into the AAVS1 site of the pluripotent stem cell.

In the above method, the differentiating into the natural killer cell comprises differentiating the recombinant pluripotent stem cell expressing the CD19-CAR gene into an Embryoid Body (EB), differentiating the Embryoid body into a hematopoietic precursor cell, and isolating CD34 from the hematopoietic precursor cell⁺The hematopoietic precursor cell of (a), so that the CD34 is present⁺The hematopoietic precursor cells of (a) are differentiated into natural killer cells, i.e., recombinant NK cells expressing the CAR.

In the above method, the method may further comprise a step of expanding in vitro the recombinant NK cells expressing the CAR as feeder cells using antigen presenting cells expressing membrane-bound IL21, wherein the membrane-bound IL21 is any one of the following proteins:

l1) the amino acid sequence is the protein of SEQ ID No. 4;

l2) is obtained by substituting and/or deleting and/or adding amino acid residues of the amino acid sequence of SEQ ID No.4, and the protein has the identity of more than 80 percent and the same function with the protein shown by L1);

l3) at the N-terminus and/or C-terminus of L1) or L2) to obtain a fusion protein having the same function.

The membrane-bound IL21 described above and the following biomaterials related thereto are also within the scope of the present invention:

m1) a DNA molecule encoding the membrane-bound IL 21;

m2) the coding sequence is the DNA molecule of SEQ ID No. 5;

m3) the nucleotide sequence is a DNA molecule shown as SEQ ID No. 5;

m4) has 75% or more than 75% identity with the nucleotide sequence defined by M2) or M3) and encodes the DNA molecule of the membrane-bound IL 21;

m5) a recombinant vector containing any one of the DNA molecules M1) -M4);

m6) contains M1) -M4) any one of the DNA molecules.

The DNA molecule shown in SEQ ID No.5 encodes the membrane-bound IL21 shown in SEQ ID No. 4.

The nucleotide sequence encoding membrane-bound IL21 of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence of the isolated membrane-bound IL21 of the present invention are derived from and identical to the nucleotide sequence of the present invention as long as they encode membrane-bound IL21 and have the same function as the CD 19-CAR.

The invention also provides a protein which is a CD19-CAR described herein, or a recombinant cell which is a CAR-expressing recombinant NK cell prepared by the method described herein or a recombinant pluripotent stem cell expressing a CD19-CAR gene in the method described herein, or a medicament for treating a tumor, the active ingredient of which is a CAR-expressing recombinant NK cell prepared by the method described herein.

The invention also provides a biomaterial, which can be any one of the following:

B1) a nucleic acid molecule encoding a CD19-CAR as described herein;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a recombinant cell containing B1) the nucleic acid molecule, or a recombinant cell containing B2) the expression cassette, or a recombinant cell containing B3) the recombinant vector.

In the above biological material, the nucleic acid molecule may be any one of:

C1) the coding sequence is a DNA molecule of SEQ ID No. 1;

C2) the nucleotide sequence is a DNA molecule shown in SEQ ID No. 1;

C3) a DNA molecule having 75% or more 75% identity to a nucleotide sequence defined by C1) or C2) and encoding the CD 19-CAR.

The DNA molecule shown in SEQ ID No.1 encodes the CD19-CAR shown in SEQ ID No. 2.

In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be derived from Escherichia (Escherichia), Erwinia (Erwinia), Agrobacterium (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), Pseudomonas (Pseudomonas), Bacillus (Bacillus), etc.

In the above biological material, the cell may be an NK cell or a T cell or a stem cell.

The recombinant vector can be specifically p19CAR-Donor, wherein the p19CAR-Donor is obtained by replacing a fragment between 2856 th site and 2870 th site of an AAVS1-Donor vector with a DNA fragment of SEQ ID No.1 in a sequence table, keeping other sequences of the AAVS1-Donor vector unchanged, and taking EF1 alpha (SEQ ID No.3) as a promoter. The recombinant cell can be specifically a recombinant human pluripotent stem cell (CD19-CAR-hPSC), and the recombinant human pluripotent stem cell (CD19-CAR-hPSC) can be a human Induced Pluripotent Stem Cell (iPSC) expressing the CD19-CAR gene.

The recombinant vector can be a lentivirus vector Lenti-EF1 alpha-WPRE carrying a membrane-bound IL-21 gene (SEQ ID No.5) and an EF1 alpha long promoter (SEQ ID No. 6).

The recombinant cell can be specifically a CD19-CAR-NK cell, and the CD19-CAR-NK cell is a human Induced Pluripotent Stem Cell (iPSC) which is prepared by the method and knockin a CD19-CAR gene.

The recombinant cell may specifically be an antigen presenting cell expressing CD19 and membrane bound IL21 (IL21-CD19-K562 cells).

The nucleotide sequence encoding a CD19-CAR of the present invention can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution or point mutation. Those nucleotides that have been artificially modified to have 75% or greater identity to the nucleotide sequence of the isolated CD19-CAR of the invention are derived from and identical to the nucleotide sequence of the invention so long as they encode a CD19-CAR and have the same function as the CD 19-CAR.

The 75% or greater than 75% identity described herein can be 80%, 85%, 90% or greater than 95% identity.

Herein, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

Herein, the 80% or greater identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

The invention also provides the application of the nucleic acid molecule and/or the biological material and/or the protein or the recombinant cell in preparing a medicament or a product for treating tumors.

Further, the tumor may be a B cell malignancy.

Further, the B cell malignancy includes, but is not limited to, chronic, acute lymphocytic leukemia, B cell lymphoma.

In one embodiment of the present invention, the method for preparing CD19-CAR-NK cells according to the present invention may specifically comprise the following steps:

1. constructing and synthesizing a CD19-CAR gene (SEQ ID No. 1);

2. the method comprises the following steps of directionally knocking a CD19-CAR gene (SEQ ID No.1) into a genome AAVS1 region of a human pluripotent stem cell by using a CRISPR/CAS9 system targeting an AAVS1 site to obtain the recombinant human pluripotent stem cell (CD19-CAR-hPSC), wherein the method comprises the following specific steps:

(1) constructing a CD19-CAR gene (SEQ ID No.1) on an AAVS1-Donor vector, wherein the AAVS1-Donor vector contains an EF1 alpha promoter (SEQ ID No.3), so as to obtain a recombinant vector p19CAR-Donor carrying the CD19-CAR gene;

(2) transfecting human pluripotent stem cells with a recombinant vector p19CAR-Donor and a vector AAVS1-Cas9n by using a lipofection method (or by using a technology well known in the art and including but not limited to conjugation, electroporation, chemical transformation, transduction, transfection or ultrasonic transformation), integrating a CD19-CAR gene (SEQ ID No.1) and an EF1 alpha promoter (SEQ ID No.3) into the genome of human PSC cells at an AAVS1 site, screening by using puromycin (puromycin), and verifying by PCR to obtain the recombinant human pluripotent stem cells (CD 19-CAR-hPSC);

3. the three-step method is used for differentiating the recombinant human pluripotent stem cells (CD19-CAR-hPSC) into CD19-CAR-NK cells, and comprises the following specific steps:

(1) inducing human pluripotent stem cells (CD19-CAR-hPSC) to differentiate into embryoid-like bodies (EBs), differentiating said embryoid-like bodies into hematopoietic precursor cells, and isolating CD34 from said hematopoietic precursor cells⁺Hematopoietic precursor cells;

(2) induction of CD34⁺The hematopoietic precursor cells are directionally differentiated into NK cells and are differentiated into CD19-CAR-NK cells;

(3) lentivirus (Lenti-EF 1. alpha. -WPRE) carrying a membrane-bound IL-21 gene (SEQ ID No.5) and a long promoter of EF 1. alpha. (SEQ ID No.6) was prepared and transfected into CD19-K562 cells to obtain antigen-presenting cells (IL21-CD19-K562 cells) as feeder cells, CD19-CAR-NK cells and feeder cells in the following ratio of 1:2, and performing activation and expansion of CD19-CAR-NK cells.

Experiments prove that the CD19-CAR gene with a novel structure and beneficial to later-stage CAR-NK cell activation and proliferation is optimally designed, the method for preparing the CD19-CAR-NK cell by using the CD19-CAR gene is provided, the CD19-CAR gene is knocked into a specific AAVS1 site of a genome of a human pluripotent stem cell, and the human pluripotent stem cell is differentiated into a Natural Killer (NK) cell by in vitro cells, so that the CD19-CAR-NK cell prepared by the method has higher proliferation capacity, higher purity and stronger anti-tumor capacity, can be safely and effectively used for tumor immunotherapy, and has a wide application prospect.

Drawings

FIG. 1 is a schematic diagram of the structure composition of CD19-CAR-NK, the intracellular domain of 2B4(CD244) and the intracellular domain of DAP10 are costimulatory molecules of NK cells, and CD3 ζ is CD3 zeta.

Figure 2 is a schematic diagram of site-specific knock-in of 19CAR at the AAVS1 location in the genome of human PSC cells.

FIG. 3 is a nucleic acid electrophoresis diagram of PCR method for detecting 19CAR by spot knock-in on human PSC cell genome: column 1 is PSC cell AAVS1 fixed-point knock-in NK-19CAR, column 2 is DNA molecular weight ladders, column 3 is PSC (T-iPS) without fixed-point knock-in. CD19-CAR-T-iPS in FIG. 3 represents CD 19-CAR-hPSC.

FIG. 4 is a photograph of RT-PCR agarose gel electrophoresis of RT-PCR method to detect 19CAR expression in human PSC cells: columns 1 and 2 are the expression of housekeeping gene GAPDH in PSC (T-iPS) without site-specific knockin and CD19-CAR-hPSC cells with site-specific knockin, column 3 is the molecular weight ladders, and

columns

4 and 5 are the expression of CD19-CAR gene in PSC cells without site-specific knockin and CD19-CAR-hPSC cells with site-specific knockin, respectively. CD19-CAR-T-iPS in FIG. 4 represents CD19-CAR-hPSC (site-specific knock-in).

FIG. 5 is a schematic diagram of a method for differentiating human PSC cells into NK cells in vitro.

FIG. 6 shows the EB differentiation CD34 on day eight⁺Flow chart of MACS sorting results for hematopoietic progenitor cells.

FIG. 7 shows CD34⁺Directed differentiation of hematopoietic precursor cells into NK cell marker expression profiles.

FIG. 8 shows the preparation of antigen presenting cells expressing IL21-CD 19-K562.

FIG. 9 is CD19-CAR-NK cell expansion in vitro.

FIG. 10 is a schematic diagram of the structure of the Lenti-EF1A-GFP-Luci plasmid.

Fig. 11 shows GFP microscopy results of two tumor cells: bright field and green fluorescence images of CD 19K 562 and RAJI cells, with bright field above and fluorescence below each group.

FIG. 12 is the result of CD19-CAR-NK cell killing in vitro.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Human induced pluripotent stem cells (hipscs) in the following examples were reprogrammed to human induced pluripotent stem cells (hipscs) by infecting sendai virus-carrying Yamanaka factors (OCT4, SOX2, KLF4, and MYC) with human Peripheral Blood Mononuclear Cells (PBMCs) in the laboratory. (Seki T, YuasaS & Fukuda K.Generation of induced plotter cells from a small aggregate of human functional blocks using a combination of activated T cells and Sendaiviruses. Nat Protoc 2012, 7, 718-728. https:// doi. org/10.1038/nprot.2012.015).

Example 1 preparation of CD19-CAR-NK cells

1. Structure and sequence of the CD19-CAR (NK-19CAR) Gene

An intact CAR molecule consists essentially of an extracellular domain, a transmembrane domain and an intracellular domain. The extracellular domain consists of a single chain antibody (scFv) which is a monoclonal antibody responsible for recognizing and binding antigens and a Hinge region (Hinge) which serves for ligation. The intracellular domain is composed of a costimulatory domain and a signaling domain. The invention is favorable for promoting the activation and proliferation of late CD19-CAR-NK cells and enhancing the killing property of CD19-CAR-NK cells to tumors by optimizing the designed CD19-CAR gene structure.

The structural molecule of the CD19-CAR of the invention (also referred to herein and in the drawings as NK-19CAR, 19CAR) consists of the Signal peptide (Signal peptide), anti-CD 19 heavy chain and linker region, anti-CD 19 light chain, CD8 Hinge region (Hinge), 2B4 Transmembrane region (Transmembrane) and intracellular region, DAP10 intracellular region and CD3 ζ (a Signal-transduction component of the T-cell antigen receptor) proteins (FIG. 1).

Among them, the anti-CD 19 heavy chain and the linker region and the anti-CD 19 light chain constitute an anti-CD 19scFv (hereinafter, referred to as CD19scFv), the CD19scFv and the CD8 hinge region constitute an extracellular domain, the 2B4 Transmembrane region (Transmembrane) constitutes a Transmembrane domain, the 2B4 intracellular region and the DAP10 intracellular region constitute a costimulatory domain, and the CD3 ζ (a signal-transduction component of the T-cell antigen receptor) constitutes a signal transduction domain.

The NK-19CAR structure is characterized by its intracellular receptor signaling region (intracellular domain) that activates cells using two costimulators for NK cells, 2B4 and DAP10, and the T cell activating molecule, CD3 ζ.

NK-19CAR is a protein whose amino acid sequence is SEQ ID No. 2. Wherein, the 1 st to 21 st positions of the SEQ ID No.2 are the amino acid sequence of the signal peptide, the 22 nd to 263 nd positions of the SEQ ID No.2 are the amino acid sequence of the CD19scFv, the 264 th and 308 th positions of the SEQ ID No.2 are the amino acid sequence of the CD8 hinge region, the 309 th and 332 th positions of the SEQ ID No.2 are the amino acid sequence of the 2B4 transmembrane region, the 333 rd and 446 th positions of the SEQ ID No.2 are the amino acid sequence of the 2B4 intracellular region, the 447 th and 470 th positions of the SEQ ID No.2 are the amino acid sequence of the DAP10 intracellular region, and the 471 rd and 582 nd positions of the SEQ ID No.2 are the amino acid sequence of the CD3 ζ and ζ.

2. Construction of recombinant human pluripotent Stem cells (CD19-CAR-hPSC)

The NK-19CAR gene is knocked in at the AAVS1 site to construct a recombinant human pluripotent stem cell (CD 19-CAR-hPSC). The AAVS1 site is located on chromosome 19 of the human genome, is an open chromosome structure, can ensure the normal transcription of the transferred target gene, and has no known side effect on cells. The invention utilizes the principle that a CRISPR/CAS9 system of a targeting AAVS1 site can specifically cut an AAVS1 site, trigger a natural repair mechanism of DNA, induce homologous recombination between the site and a DNA clone (donor clone) carrying a target gene, and integrate the target gene on the donor clone into an AAVS1 site, and the NK-19CAR gene is directionally knocked in (Knockin) to a genome AAVS1 region of a human pluripotent stem cell (hPSC), and the specific method is as follows:

the NK-19CAR gene (SEQ ID No.1) is constructed on an AAVS1-Donor vector to obtain a recombinant vector p19CAR-Donor carrying the NK-19CAR gene, the recombinant vector p19CAR-Donor and the vector AAVS1-Cas9n are jointly transferred into human induced pluripotent stem cell (hipSC) cells by a liposome transfection method, the Cas9n can efficiently cut the AAVS1 site of the human genome by utilizing the efficient specific cutting function of a CRISPR/CAS9 system, and simultaneously, a Nick on DNA can be rapidly repaired by cells and generally cannot cause gene mutation because a single-cut Cas9n (instead of a wild-type Cas9) is used. The recombinant vector p19CAR-Donor contains a homologous sequence of AAVS1 site, and can effectively integrate a target fragment into the AAVS1 site of a human genome in a gene homologous recombination manner to obtain the recombinant human pluripotent stem cell (CD 19-CAR-hPSC).

The knock-in of the NK-19CAR gene into the AAVS1 position of hipSC was determined by puromycin (puromycin) screening and nucleic acid PCR electrophoretic identification (FIG. 2). The specific experimental steps are as follows:

2-1, construction of recombinant vector p19CAR-Donor

The AAVS1easy gene modification kit (product of Beijing Saibei biotechnology, Inc.) comprises an AAVS1-Cas9n vector and an AAVS1-donor vector. The AAVS1-donor vector is a homologous vector with an AAVS1 site.

A recombinant expression vector of the NK-19CAR gene was constructed using AAVS1-Donor vector and named p19 CAR-Donor. The p19CAR-Donor is a recombinant vector obtained by replacing the fragment between 2856 th site and 2870 th site of AAVS1-Donor vector with the DNA fragment of SEQ ID No.1 in the sequence table, keeping the other sequences of AAVS1-Donor vector unchanged, and using EF1 alpha (SEQ ID No.3) as a promoter.

The p19CAR-Donor contains NK-19CAR gene with the nucleotide sequence of SEQ ID No.1, and NK-19CAR with the amino acid sequence of SEQ ID No.2 is transferred into human and animal cells for expression.

2-2, mixedly transfecting hipSC cells with recombinant vectors p19CAR-Donor, AAVS1-Cas9n

The transfection experimental groups were set as follows: transfection of p19CAR-Donor and AAVS1-Cas9 n;

the mock transfection control group was set as: transfection of AAVS1-Cas9n alone;

(1) cell culture

The hiPSC cells were passaged at a ratio of 1:3 into six-well plates in Matrigel + mTeSR medium (Stemcell) at 37 ℃ with 5% CO₂And (4) culturing in a cell culture box, and performing transfection when the confluence degree of the cells reaches 30-40%.

(2) Transfection by Lipofectation

hiPSC cells transfected with 1 μ g p19CAR-Donor and 0.5 μ g AAVS1-Cas9n were used as experimental groups; hiPSC cells transfected with only 1 μ g of AAVS1-Cas9n (designated recombinant control hiPSC cells) served as a control group.

Plasmids of the experimental group and the control group were transferred into hiPSC cells according to the instructions of Lipofectamine 3000Transfection Reagent.

(3) Screening

Cells in the experimental and control groups after transfection were at 5% CO₂After incubation in an incubator at 37 ℃ for 24 hours, puromycin (puromycin) was added at 2. mu.g/ml for selection, and fresh medium with puromycin was replaced daily. After 3-5 days, it can be observed that: the cells of the control group before screening have no GFP fluorescence, and the cells of the experimental group have GFP fluorescence; after screening, the cells of the control group are all dead, and a large number of cells of the experimental group survive; cells are observed under a fluorescence microscope, the cells in an experimental group are GFP positive mostly, and the efficiency of fixed-point integration can reach more than 90%.

If a monoclonal cell line needs to be obtained, GFP positive cells need to be inoculated at a low density, a sufficient distance is kept between single cells, a larger single clone is formed after the single cells are cultured for 5 to 10 days, and positive subclones are picked.

(4) Identification

And (3) inoculating GFP positive cells at low density, keeping a sufficient distance between single cells, culturing for 5-10 days to form a large monoclonal, picking out a positive subclone, amplifying the picked monoclonal by using a primer AAVS1-F and a primer AAVS1-R to perform PCR (Genomic-PCR) verification of Genomic DNA, screening when a 1668bp band appears in a PCR product to obtain a correct clone, namely obtaining the positive clone of the NK-19CAR gene inserted into the AAVS1 site of the hipSC cells, and obtaining the recombinant human pluripotent stem cells which are named as CD19-CAR-hPSC or CD 19-CAR-T-iPS.

The primer sequences are as follows:

AAVS1-F:5’ACCAACGCCGACGGTATCAG 3’

AAVS1-R:5’GTGGGCTTGTACTCGGTCATCT 3’

the PCR procedure was as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min for 30s, 35 cycles; extension at 72 ℃ for 8 min.

The experiment was synchronized with a control group: control groups that mimic transfection (untransfected): the hiPSC cells (named T-iPS) transfected with AAVS1-Cas9n alone were subjected to PCR validation after genomic DNA extraction.

The results of identifying the PCR products of the experimental group and the control group by 1% agarose gel electrophoresis are shown in FIG. 3. The size of the target fragment of the HaPSC cell knocked in the NK-19CAR gene at the AAVS1 site is 1668 bp.

Total RNA of the hipSC cell T-iPS without site-specific knockin and the CD19-CAR-T-iPS cell with site-specific knockin is extracted, the RNA is subjected to reverse transcription to form cDNA, a constitutively expressed GAPDH gene is used as an internal reference, and the expression condition of CD19-CAR is analyzed by using a specific primer of a CD19-CAR gene (RT-PCR). Primer pair of internal reference gene GAPDH:

GAPDH-F：5’-TCTCCTCTGACTTCAACAGCGAC-3’

GAPDH-R：5’-CCCTGTTGCTGTAGCCAAATTC-3’

specific primer pair for CD19-CAR gene:

CD19-CAR-F：5’-GGAGAAATCACGAGCAGGAG-3’

CD19-CAR-R：5’-GCCTGGCATGTTGATGTAGA-3’

the size of the specifically amplified fragment is expected to be 1668 bp. The results showed that housekeeping gene GAPDH was expressed in both CD19-CAR-T-iPS and T-iPS cells, and NK-19CAR gene was expressed only in site-directed knock-in CD19-CAR-T-iPS cells (fig. 4).

3. Differentiation of CD19-CAR-hPSC cells to prepare CD19-CAR-NK cells

3-1, HiPSC cells knocking in NK-19CAR Gene (CD19-CAR-hPSC cells) differentiate in vitro into hematopoietic cells and NK cells

The invention designs a three-step method: in vitro directed early hematopoietic, NK cell differentiation and expansion, as shown in figure 5.

Stage 1: differentiation of human pluripotent stem cells into Embryoid Bodies (EBs), sorting CD34 from the EB-differentiated hematopoietic precursor cells⁺Hematopoietic precursor cells.

And (2) stage: CD34⁺Hematopoietic precursor cells differentiate into NK cells.

And (3) stage: activation and expansion of NK cells.

The methods reported in the literature generally differentiate into EBs, which are then inoculated directly into feeder cells or feeder-coated plates without substrate. However, there is a potential risk of developing tumors if undifferentiated pluripotent stem cells and other precursor cells (e.g., precursor cells differentiated into cardiac muscle) are mixed with differentiated cells; if the precursor cells of other types are contained, differentiation into other cell types such as cardiac muscle is possible. Thus, the present invention enhances sorting of CD34 from EB-differentiated hematopoietic precursor cells⁺The key step of hematopoietic precursor cells is the complete avoidance of cardiomyocyte appearance and expression of undifferentiated pluripotent genes, CD34⁺Hematopoietic precursor cells differentiate only in the direction of hematopoietic cells.

The three-step method comprises the following specific steps:

(1) preparation of hematopoietic differentiation medium

TABLE 2StemPro hematopoietic differentiation Medium ingredient Table

StemPro34 base medium and StemPro34 additives in Table 2 are available from GIBCO, USA, lot 10639011; MTG was Sigma-Aldrich, USA, lot number M6145-25 ML; BMP4 is a product of R & D, USA, lot 314-BP; VEGF is a product of America R & D company, lot No. 293-VE; stem Cell Factor is a product of Miltenyi Biotec, Germany, lot No. 130-.

(2) EB hematopoietic differentiation and CD34⁺Sorting of hematopoietic precursor cells (first step)

a) The confluency of the CD19-CAR-hPSC cells in the step 2 is about 80%, the supernatant is aspirated, the cells are softly flushed by 2ml of PBS, and the PBS is aspirated;

b) adding 2ml of digestive juice, and incubating in an incubator at 37 ℃ for 7 minutes to form an Embryoid Body (EB);

c) the digestion solution was aspirated, pipetted with 2ml StemPro hematopoietic differentiation medium from Table 2 and resuspended into small cell masses, which were then plated onto low-adherence plates and placed in a hypoxic chamber (5% CO)₂/5％O₂) Culturing for 8 days.

d) Day 8 cultures were harvested by using anti-CD 34⁺Antibody flow cytometry for CD34⁺Hematopoietic precursor cell sorting (fig. 6).

(3)CD34⁺Differentiation of hematopoietic progenitor cells into NK cells (second step)

a) Collecting CD34⁺After counting the hematopoietic precursor cells, inoculating the hematopoietic precursor cells into NK cell differentiation culture medium of table 3 according to the number of 50000 cells per well of a six-well plate, wherein each well of the six-well plate contains 2ml of the culture medium;

TABLE 3NK cell differentiation Medium

DMEM/F12 in Table 3 is available from GIBCO, USA under lot number 11320033; PEN is available from GIBCO corporation, USA, under lot number 10378016; Flt-3L is a product of Miltenyi Biotec, Germany, lot No. 130-; SCF was a product of Miltenyi Biotec, Germany, under the batch number 130-.

b) Culturing at 37 deg.C for 20 days, wherein 2ml of NK cell differentiation medium of Table 3 is supplemented every 3-4 days;

c) after 20 days, the cells were resuspended in an IL-3 factor-removed medium (a medium obtained by removing IL-3 from NK cell differentiation medium of Table 3), and the cell suspension was centrifuged at 1200rpm for 4 minutes;

d) discarding the supernatant to about 2ml, supplementing 2ml of IL-3 factor-removed medium (the medium obtained by removing IL-3 from NK cell differentiation medium of Table 3), resuspending, and passaging according to 1:2 or 1: 3;

e) obtaining the differentiated CD19-CAR-NK cells.

f) Immunophenotypic testing of CD19-CAR-NK cells:

the hiPSC cells containing the NK-19CAR gene were subjected to flow cytometry at different time points of differentiation in vitro into NK cells, and surface molecular markers CD45, CD56, CD16, CD94, NKG2D, NKP44, NKP46 of NK cells were detected:

cells cultured at days 0, 18, 23, and 31 in a) -d) were taken, added to an EP tube, collected by centrifugation, and washed once with PBS. Resuspending the cells in PBS, adding a fluorescent labeled antibody (CD45 antibody, CD56 antibody, CD16 antibody, CD94 antibody, NKG2D antibody, NKP44 antibody, NKP46 antibody, all of which are available from Biolegend, usa), setting a test tube as a blank control, and incubating for 30 minutes at 4 ℃ in the absence of light; washing with PBS, and discarding the supernatant; cells were resuspended in PBS and assayed by flow cytometry.

The results are shown in fig. 7, with the extension of the differentiation time (18 days, 23 days and 31 days), the expression level of the surface molecular marker of the NK cell gradually increases, wherein the expression of CD45 reaches 99% at the 18 th day and 100% at the 31 th day, which indicates that the expression level of CD45 in the cell is very high, which is very beneficial to the NK cell to exert cytotoxicity (ADCC); the expressions of CD56, CD16, CD94, NKG2D, NKP44 and NKP46 reach 98%, 94%, 86%, 97% and 96% on day 31, respectively, which indicates that the differentiated CD19-CAR-NK cells prepared by the invention have the surface molecular phenotype of NK cells and are confirmed to be NK cells expressing CD19-CAR genes.

(4) Activation and expansion of CD19-CAR-NK cells (third step)

Antigen presenting cells were prepared as feeder cells (feeder cells) for NK cell expansion in vitro. The method comprises the following steps:

a) preparation of antigen presenting cells:

the PGK promoter of the Lentiviral Vector pRRL-SIN. cPPT. PGK-GFP. WPRE (ZHao Y, Stepto H, Schneider CK. development of the First World Health Organization viral Vector Standard: aware the Production Control and Standardization of expression-basic Gene Therapy methods.2017; 28(4):205 and 214) was replaced by the Elongation factor-1 alpha (Elongation factor-1 alpha, EF1 alpha) promoter by endonucleases of the restriction BamHI and BstXI, by cutting down the PGK promoter of pRRL-SIN. cPPT. PGK-GFP. WPRE, by the nucleotide sequence of SEQ ID No. 36, the promoter of the Lentivirus Vector LrEF 1 alpha was synthesized by Leef 32, Ostwa strain, hoid-36, hoid 2, hoid-36, hoid-1. The nucleotide sequence of the membrane-bound IL21 gene is SEQ ID No.5, and the amino acid sequence translated into protein is SEQ ID No. 4. The synthesized membrane-bound IL21 gene (synthesized by Beijing Liuhua Dagenescience and technology Co., Ltd.) was ligated into Lenti-EF 1. alpha. -WPRE, followed by DNA sequence of IRES and red fluorescent protein (mCherry).

The recombinant lentivirus containing the membrane-bound IL-21 gene is infected into K562 cells, red fluorescence is detected under the microscope after the lentivirus transfection operation is carried out for 48 hours, the fact that the K562 cells in a visual field basically and completely express Cherry red can be observed, the IL-21 expression on the cell surface is further detected through a flow antibody by using an anti-IL-21 antibody (as shown in figure 8), the K562 cells can achieve the full positive expression of IL21, and antigen presenting cells (named as IL21-K562 cells) are obtained.

DNA sequences encoding the membrane-outer region and the transmembrane region of human CD19 were synthesized by Beijing Oakuo Spongsheng organism Co., Ltd, a gene encoding CD19 (the coding sequence was at positions 31-1071 of GenBank Accession NM-001770.6 (Update Date 24-MAY-2021)) was inserted into a lentiviral vector Lenti-EF1 α -WPRE using restriction enzymes XbaI and SalI to prepare a lentivirus expressing the membrane-outer region and the transmembrane region of CD19, and IL21-K562 cells were infected to obtain antigen-presenting cells expressing CD19 and IL21, which were named as IL21-CD19-K562 cells.

b) NK cells were expanded by co-culture with IL21-CD19-K562 cells

CD19-CAR-NK cells differentiated on day 28-35 and irradiated (5 Gy dose irradiated) IL21-CD19-K562 cells were collected according to 1:2 in RMPI1640 medium with 15% Fetal Bovine Serum (FBS) in 5% CO₂The number of NK cells was measured after 7 days of co-incubation in the incubator, and the number of NK cells was increased from initial 50000 to 540000, which was approximately 10.8-fold (FIG. 9).

Example 2 in vitro killing Capacity of CD19-CAR-NK cells (cytotoxicity assay)

The K562 cells and RAJI cells in this example were derived from the cell center of the basic medical research institute of the chinese academy of medical sciences, beijing.

A human leukemia cell line CD19-K562 which is sensitive to NK cell killing and is used for lentivirus over-expression CD19 and a cell expressing CD19 lymphoma RAJI are selected as target cells, and the ability of NK cells modified by NK-19CAR genes to kill the target cells is evaluated by a luciferase-based reporter gene transfection method. The reporter gene-luciferase (luciferase, luc) gene is transfected into target cells to establish a stable transfected target cell line, so as to determine NK cell mediated cytotoxicity and apoptosis. The percentage of target cells killed by effector cells can be calculated by measuring the reporter enzyme activity released into the culture broth (representing the number of target cell deaths).

The method comprises the following specific steps:

1. construction of Lenti-EF1A-GFP-Luci lentivirus plasmid (FIG. 10)

A Green Fluorescent Protein (GFP) code is derived from a plasmid vector pRRL-SIN.cPPT.PGK-GFP.WPRE, and a DNA sequence of the GFP is obtained by PCR amplification; plasmid vector pGL4.14, containing the Luciferase (Luciferase) encoding gene, P2A being a ribosome-independent translation structure, was purchased from Promega, USA, and primers were designed to amplify the GFP and Luciferase gene sequences by Polymerase Chain Reaction (PCR), respectively, and then inserted into lentivirus vector Lenti-EF 57 α -WPRE, named Lenti-1-82-Luciferase (GFP vector FIG. 10), by the method of overlaid PCR extension (Heckman KL, Pease LR. Gene application and mutagenesis by PCR-driven overlap extension. Nat Protoc. 2007; 2(4):924-32.doi:10.1038/nprot.2007.132.PMID:17446874), by the double-enzymatic cleavage method with restriction enzymes XbaI and SalI. P2A is ribosome-independent translation function (Szymczak-Workman AL, Vignali KM, Vignali DA. design and construction of 2A peptide-linked polymorphic vectors. Cold Spring Harb Protoc.2012Feb1; 2012(2):199-204.), allowing GFP and Luciferase to be expressed independently under the drive of one promoter. Lenti-EF1A-GFP-Luci plasmid is used for transfecting HEK293T cells, and lentiviruses are prepared and collected for infecting cells such as K562 cells, RAJI cells and the like.

2. Lenti-EF1A-GFP-Luci lentivirus infected K562, RAJI cell

Cells of K562 and RAJI were inoculated into 6-well plates, and 24 hours later, when the cell density reached 10 ten thousand per well, Lenti-EF1A-GFP-Luci lentivirus was infected.

1) According to MOI for different cells (lentivirus amount TU: cell number) 1-30, adding a calculated volume of virus stock to K562 or RAJI target cells in a biosafety cabinet, with a medium volume of about 1 ml;

2) adding 25 Xtransfection-promoting reagent, and shaking up;

3) after setting slow speed increasing and reducing modes, centrifuging for 1 hour at room temperature by a centrifuge of 350 g;

4) culturing in 37 deg.C incubator for 12 hr, changing culture medium, and culturing in 2ml culture medium;

5) detecting the transfection efficiency of the cells by flow cytometry after 48 hours;

6) staining the infected virus cells and the control cells with specific antibodies;

7) resuspending the cells using 1ml of PBS buffer, removing cell clumps through a cell sieve, and placing the cell suspension in a 5ml flow tube;

8) carrying out flow cell sorting to obtain required cells;

9) the tubes were centrifuged at 1000rpm for 4 minutes, the supernatant was discarded and resuspended in the medium itself and plated in 6-well plates or 10cm dishes.

Cells successfully expressing Green Fluorescent Protein (GFP) were enriched for Lenti-EF1A-GFP-Luci transfection in the above cell line by flow sorting one week later (FIG. 11).

And (3) preparing lentiviruses expressing the CD19 extracellular region and the transmembrane region, and infecting GFP and Luciferase positive K562 cells to obtain a K562 cell line expressing the CD19 extracellular region, namely CD19-K562 cells, serving as target cells expressing CD 19.

3. CD19-CAR-NK cells and NK cells without CD19-CAR of example 1 (NK cells prepared by differentiation of recombinant control hiPSC cells as effector cells according to the method of step 3 of example 1) were separately cultured with CD19-K562 or RAJI-GFP-luciferase cells as target cells, and cultured in the presence of 10: the 1-effect target ratio is respectively mixed with target cells to carry out an in vitro luciferase killing experiment, and the specific steps are as follows:

1) 10000 tumor cells (CD19-K562 or RAJI-GFP-luciferase cells) were seeded in a clear white 96-well plate per well;

2) adding quantitative tumor cells and differentiated CD19-CAR-NK cells into each well according to an effective target ratio, setting two multiple wells for each effective target ratio, and setting a group of tumor cell-only controls;

3) fixing the volume to 150 mul per hole, and culturing for 16 hours in an incubator at 37 ℃;

4) according to the following steps of 1: diluting the luci substrate by 50 proportion, and adding 50 mul of luci substrate into each hole before the detection by the loading machine in a dark place;

5) wait for 5 minutes, detect with chemiluminescence apparatus, convert to killing data according to Luci data, and then plot. Tumor cell lysis rate ═ 100% of [1- (control chemiluminescence reading-experimental chemiluminescence reading)/control chemiluminescence reading ].

As a result, as shown in fig. 12, the killing activity of NK cells expressing the CD19-CAR gene (CD19-CAR-NK cells) against CD19-K562 cells and RAJI cells was significantly improved, compared to NK cells without the CD19-CAR gene (NK cells in fig. 12). It was demonstrated that the gene editing transfer of CD19-CAR at the pluripotent stem cell stage can result in CD19-CAR with greater killing ability against CD19 expressing tumor cells after committed differentiation.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Beijing university

<120> method for preparing chimeric antigen receptor NK (natural killer) cells targeting CD19 by using human pluripotent stem cells and application of method

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 1749

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggaggtga aactgcagga gtcaggacct ggcctggtgg cgccctcaca gagcctgtcc 120

gtcacatgca ctgtctcagg ggtctcatta cccgactatg gtgtaagctg gattcgccag 180

cctccacgaa agggtctgga gtggctggga gtaatatggg gtagtgaaac cacatactat 240

aattcagctc tcaaatccag actgaccatc atcaaggaca actccaagag ccaagttttc 300

ttaaaaatga acagtctgca aactgatgac acagccattt actactgtgc caaacattat 360

tactacggtg gtagctatgc tatggactac tggggccaag gaacctcagt caccgtctcc 420

tcaggtggcg gtggctcggg cggtggtggg tcgggtggcg gcggatctga catccagatg 480

acacagacta catcctccct gtctgcctct ctgggagaca gagtcaccat cagttgcagg 540

gcaagtcagg acattagtaa atatttaaat tggtatcagc agaaaccaga tggaactgtt 600

aaactcctga tctaccatac atcaagatta cactcaggag tcccatcaag gttcagtggc 660

agtgggtctg gaacagatta ttctctcacc attagcaacc tggagcaaga agatattgcc 720

acttactttt gccaacaggg taatacgctt ccgtacacgt tcggaggggg gaccaagctg 780

gagatcacaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatcatc gtgattctaa gcgcactgtt ccttggcacc 960

cttgcctgct tctgtgtgtg gaggagaaag aggaaggaga agcagtcaga gaccagtccc 1020

aaggaatttt tgacaattta cgaagatgtc aaggatctga aaaccaggag aaatcacgag 1080

caggagcaga cttttcctgg aggggggagc accatctact ctatgatcca gtcccagtct 1140

tctgctccca cgtcacaaga acctgcatat acattatatt cattaattca gccttccagg 1200

aagtctggat ctaggaagag gaaccacagc ccttccttca atagcactat ctatgaagtg 1260

attggaaaga gtcaacctaa agcccagaac cctgctcgat tgagccgcaa agagctggag 1320

aactttgatg tttattccct gtgcgcacgc ccacgccgca gccccgccca agaagatggc 1380

aaagtctaca tcaacatgcc aggcaggggc agagtgaagt tcagcaggag cgcagacgcc 1440

cccgcgtacc agcagggcca gaaccagctc tataacgagc tcaatctagg acgaagagag 1500

gagtacgatg ttttggacaa gagacgtggc cgggaccctg agatgggggg aaagccgaga 1560

aggaagaacc ctcaggaagg cctgtacaat gaactgcaga aagataagat ggcggaggcc 1620

tacagtgaga ttgggatgaa aggcgagcgc cggaggggca aggggcacga tggcctttac 1680

cagggtctca gtacagccac caaggacacc tacgacgccc ttcacatgca ggccctgccc 1740

cctaggtaa 1749

<210> 2

<211> 582

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu

20 25 30

Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val

35 40 45

Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys

50 55 60

Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr

65 70 75 80

Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys

85 90 95

Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala

100 105 110

Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met

115 120 125

Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met

145 150 155 160

Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr

165 170 175

Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr

180 185 190

Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser

195 200 205

Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly

210 215 220

Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala

225 230 235 240

Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly

245 250 255

Gly Thr Lys Leu Glu Ile Thr Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Ile Val Ile Leu Ser Ala Leu Phe Leu Gly Thr

305 310 315 320

Leu Ala Cys Phe Cys Val Trp Arg Arg Lys Arg Lys Glu Lys Gln Ser

325 330 335

Glu Thr Ser Pro Lys Glu Phe Leu Thr Ile Tyr Glu Asp Val Lys Asp

340 345 350

Leu Lys Thr Arg Arg Asn His Glu Gln Glu Gln Thr Phe Pro Gly Gly

355 360 365

Gly Ser Thr Ile Tyr Ser Met Ile Gln Ser Gln Ser Ser Ala Pro Thr

370 375 380

Ser Gln Glu Pro Ala Tyr Thr Leu Tyr Ser Leu Ile Gln Pro Ser Arg

385 390 395 400

Lys Ser Gly Ser Arg Lys Arg Asn His Ser Pro Ser Phe Asn Ser Thr

405 410 415

Ile Tyr Glu Val Ile Gly Lys Ser Gln Pro Lys Ala Gln Asn Pro Ala

420 425 430

Arg Leu Ser Arg Lys Glu Leu Glu Asn Phe Asp Val Tyr Ser Leu Cys

435 440 445

Ala Arg Pro Arg Arg Ser Pro Ala Gln Glu Asp Gly Lys Val Tyr Ile

450 455 460

Asn Met Pro Gly Arg Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

465 470 475 480

Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

485 490 495

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

500 505 510

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

515 520 525

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

530 535 540

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

545 550 555 560

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

565 570 575

Gln Ala Leu Pro Pro Arg

580

<210> 3

<211> 546

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

aaggatctgc gatcgctccg gtgcccgtca gtgggcagag cgcacatcgc ccacagtccc 60

cgagaagttg gggggagggg tcggcaattg aacgggtgcc tagagaaggt ggcgcggggt 120

aaactgggaa agtgatgtcg tgtactggct ccgccttttt cccgagggtg ggggagaacc 180

gtatataagt gcagtagtcg ccgtgaacgt tctttttcgc aacgggtttg ccgccagaac 240

acagctgaag cttcgagggg ctcgcatctc tccttcacgc gcccgccgcc ctacctgagg 300

ccgccatcca cgccggttga gtcgcgttct gccgcctccc gcctgtggtg cctcctgaac 360

tgcgtccgcc gtctaggtaa gtttaaagct caggtcgaga ccgggccttt gtccggcgct 420

cccttggagc ctacctagac tcagccggct ctccacgctt tgcctgaccc tgcttgctca 480

actctacgtc tttgtttcgt tttctgttct gcgccgttac agatccaagc tgtgaccggc 540

gcctac 546

<210> 4

<211> 414

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 4

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro His Lys Ser Ser Ser Gln Gly Gln Asp Arg

20 25 30

His Met Ile Arg Met Arg Gln Leu Ile Asp Ile Val Asp Gln Leu Lys

35 40 45

Asn Tyr Val Asn Asp Leu Val Pro Glu Phe Leu Pro Ala Pro Glu Asp

50 55 60

Val Glu Thr Asn Cys Glu Trp Ser Ala Phe Ser Cys Phe Gln Lys Ala

65 70 75 80

Gln Leu Lys Ser Ala Asn Thr Gly Asn Asn Glu Arg Ile Ile Asn Val

85 90 95

Ser Ile Lys Lys Leu Lys Arg Lys Pro Pro Ser Thr Asn Ala Gly Arg

100 105 110

Arg Gln Lys His Arg Leu Thr Cys Pro Ser Cys Asp Ser Tyr Glu Lys

115 120 125

Lys Pro Pro Lys Glu Phe Leu Glu Arg Phe Lys Ser Leu Leu Gln Lys

130 135 140

Met Ile His Gln His Leu Ser Ser Arg Thr His Gly Ser Glu Asp Ser

145 150 155 160

Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe

165 170 175

Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

180 185 190

Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val

195 200 205

Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val

210 215 220

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser

225 230 235 240

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu

245 250 255

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser

260 265 270

Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro

275 280 285

Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln

290 295 300

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

305 310 315 320

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr

325 330 335

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu

340 345 350

Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser

355 360 365

Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser

370 375 380

Leu Ser Leu Gly Lys Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly

385 390 395 400

Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe Cys Val Arg

405 410

<210> 5

<211> 1242

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atcccacaca aatcaagctc ccaaggtcaa gatcgccaca tgattagaat gcgtcaactt 120

atagatattg ttgatcagct gaaaaattat gtgaatgact tggtccctga atttctgcca 180

gctccagaag atgtagagac aaactgtgag tggtcagctt tttcctgctt tcagaaggcc 240

caactaaagt cagcaaatac aggaaacaat gaaaggataa tcaatgtatc aattaaaaag 300

ctgaagagga aaccaccttc cacaaatgca gggagaagac agaaacacag actaacatgc 360

ccttcatgtg attcttatga gaaaaaacca cccaaagaat tcctagaaag attcaaatca 420

cttctccaaa agatgattca tcagcatctg tcctccagaa cacacggaag tgaagattcc 480

gagtctaaat atggtccccc atgccctcca tgtcctgctc cagaattttt ggggggacca 540

agcgtgtttc tgtttccccc caaaccaaag gataccctga tgatcagtag aacaccggaa 600

gttacctgcg ttgtcgtgga tgtaagccag gaagatcccg aagtccagtt caactggtac 660

gtagatggag tggaggtcca taatgctaaa actaaaccta gagaggaaca atttaacagc 720

acctataggg tcgtgtctgt gctgacggtg ctccaccagg attggcttaa tggcaaggaa 780

tacaaatgca aggtcagcaa taagggtttg ccgtcatcca tcgaaaaaac catttccaag 840

gcaaaagggc agcccaggga gccacaggtg tacacacttc ctccctccca ggaagaaatg 900

actaaaaacc aggtgagcct tacctgcctt gtaaaagggt tctatccaag cgacatcgct 960

gttgaatggg aaagcaatgg tcagccagag aacaactaca agacaacacc ccctgttctg 1020

gatagcgacg ggtcattctt tctgtatagc aggttgacag tagataagag ccgctggcaa 1080

gaaggaaatg tgttctcttg cagcgtcatg cacgaagccc tgcacaacca ctacacccag 1140

aagtcactca gcctttcact gggcaaaatg gcgctgatcg tgcttggtgg agtcgcagga 1200

ctgctgctct ttatcggcct cgggatcttc ttctgcgtga ga 1242

<210> 6

<211> 1191

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ggagtgggaa ttggctccgg tgcccgtcag tgggcagagc gcacatcgcc cacagtcccc 60

gagaagttgg ggggaggggt cggcaattga accggtgcct agagaaggtg gcgcggggta 120

aactgggaaa gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg 180

tatataagtg cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca 240

caggtaagtg ccgtgtgtgg ttcccgcggg cctggcctct ttacgggtta tggcccttgc 300

gtgccttgaa ttacttccac tggctgcagt acgtgattct tgatcccgag cttcgggttg 360

gaagtgggtg ggagagttcg aggccttgcg cttaaggagc cccttcgcct cgtgcttgag 420

ttgaggcctg gcctgggcgc tggggccgcc gcgtgcgaat ctggtggcac cttcgcgcct 480

gtctcgctgc tttcgataag tctctagcca tttaaaattt ttgatgacct gctgcgacgc 540

tttttttctg gcaagatagt cttgtaaatg cgggccaaga tctgcacact ggtatttcgg 600

tttttggggc cgcgggcggc gacggggccc gtgcgtccca gcgcacatgt tcggcgaggc 660

ggggcctgcg agcgcggcca ccgagaatcg gacgggggta gtctcaagct ggccggcctg 720

ctctggtgcc tggcctcgcg ccgccgtgta tcgccccgcc ctgggcggca aggctggccc 780

ggtcggcacc agttgcgtga gcggaaagat ggccgcttcc cggccctgct gcagggagct 840

caaaatggag gacgcggcgc tcgggagagc gggcgggtga gtcacccaca caaaggaaaa 900

gggcctttcc gtcctcagcc gtcgcttcat gtgactccac ggagtaccgg gcgccgtcca 960

ggcacctcga ttagttctcg agcttttgga gtacgtcgtc tttaggttgg ggggaggggt 1020

tttatgcgat ggagtttccc cacactgagt gggtggagac tgaagttagg ccagcttggc 1080

acttgatgta attctccttg gaatttgccc tttttgagtt tggatcttgg ttcattctca 1140

agcctcagac agtggttcaa agtttttttc ttccatttca ggtgtcgtga g 1191

Claims

1. A method of making a recombinant NK cell expressing a CAR, said method comprising the steps of: differentiating the recombinant pluripotent stem cell expressing the CD19-CAR gene into a natural killer cell, wherein the natural killer cell is a recombinant NK cell expressing CAR; the CD19-CAR is a protein comprising an extracellular domain, a transmembrane domain, and an intracellular domain; the extracellular domain comprises an scFv against CD19, and the intracellular domain comprises the intracellular region of 2B4 and the intracellular region of DAP 10.

2. The method of claim 1, wherein the CD19-CAR is any one of the following proteins:

p1, the transmembrane domain is the transmembrane region of 2B 4;

3. The method according to claim 1 or 2,

the intracellular region of 2B4 is any one of the following proteins:

C1) the protein of which the amino acid sequence is 333-446 of SEQ ID No. 2;

the intracellular region of DAP10 is any one of the following proteins:

the transmembrane region of 2B4 is any one of the following proteins:

E1) the protein of which the amino acid sequence is 309-332 of SEQ ID No. 2;

the CD3zeta is any one of the following proteins:

F1) the protein with the amino acid sequence of 471-582 of SEQ ID No. 2;

the CD8 hinge region is any one of the following proteins:

the scFv against CD19 is any one of the following proteins:

H1) protein with amino acid sequence of 22-263 of SEQ ID No. 2;

the signal peptide is any one of the following proteins:

I1) a protein having an amino acid sequence of positions 1-21 of SEQ ID No. 2;

4. The method of any one of claims 1-3, wherein the CD19-CAR is any one of the following proteins:

K1) a protein having the amino acid sequence of SEQ ID No. 2;

5. The method according to any one of claims 1 to 4, wherein the method for differentiating the recombinant pluripotent stem cell expressing the CD19-CAR gene into a natural killer cell comprises the step of constructing the recombinant pluripotent stem cell expressing the CD19-CAR gene, and the step of constructing the recombinant pluripotent stem cell expressing the CD19-CAR gene comprises knocking in the CD19-CAR gene and the EF1a promoter at the AAVS1 site of the pluripotent stem cell.

6. The method of any one of claims 1-5, wherein said differentiating into a natural killer cell comprises differentiating said recombinant pluripotent stem cell expressing a CD19-CAR gene into an embryoid body, differentiating said embryoid body into a hematopoietic precursor cell, and isolating CD34 from said hematopoietic precursor cell⁺The hematopoietic precursor cell of (a), so that the CD34 is present⁺The hematopoietic precursor cells of (a) are differentiated into natural killer cells, i.e., recombinant NK cells expressing the CAR.

7. A protein or a recombinant cell or a tumor treatment drug, wherein the protein is the CD19-CAR of any one of claims 1-6, the recombinant cell is the CAR-expressing recombinant NK cell prepared by the method of any one of claims 1-6 or the CD19-CAR gene-expressing recombinant pluripotent stem cell of any one of claims 1-6, and the active ingredient of the tumor treatment drug is the CAR-expressing recombinant NK cell prepared by the method of any one of claims 1-6.

8. A biomaterial, characterized in that the biomaterial is any one of the following:

B1) a nucleic acid molecule encoding the CD19-CAR of any one of claims 1-6;

B2) an expression cassette comprising the nucleic acid molecule of B1);

9. The biomaterial according to claim 8, wherein the nucleic acid molecule is any of:

C1) the coding sequence is a DNA molecule of SEQ ID No. 1;

C2) the nucleotide sequence is a DNA molecule shown in SEQ ID No. 1;

C3) a DNA molecule having 75% or more 75% identity to a nucleotide sequence defined by C1) or C2) and encoding the CD19-CAR of claim 4.

10. Use of a nucleic acid molecule according to claim 8 or 9 and/or a biological material according to claim 8 or 9 and/or a protein or recombinant cell according to claim 7 for the preparation of a medicament or product for the treatment of a tumor.