CN110812532A - Construction method of tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection - Google Patents

Abstract

A construction method of a tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection. By applying the principle of mutual combination of ligands and receptors between PTP sigma-TrkC, the neural stem cells transfected by TrkC genes are planted in a porous gelatin sponge cylindrical bracket for slowly releasing NT-3, a three-dimensional biological bracket containing over-expression TrkC stem cell source neurons is constructed, and the bracket is transplanted to a spinal cord injury area to provide a new connecting target point for a regenerated cortical spinal cord bundle expressing PTP sigma and promote the development of excitatory synapses. The method is a construction method of the tissue engineering scaffold which can be connected with the corticospinal tracts in a targeted mode.

Description

Construction method of tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection

Technical Field

The invention relates to a construction method of a tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection. Based on the principle that a ligand and a receptor between PTP sigma-TrkC are combined with each other, Neural Stem Cells (NSCs) transfected by TrkC genes are planted in a porous gelatin sponge cylindrical scaffold for slowly releasing NT-3, and a stem cell source neuron three-dimensional biological scaffold containing over-expressed TrkC is constructed. The bracket is transplanted to the spinal cord injury, so as to provide a new connecting target point for regenerated corticospinal Tract (CST), and the method is a method for treating the spinal cord injury by applying tissue engineering technology and transgenic technology to target and connect CST.

Background

Spinal cord injury is a nervous system disease with very high disability rate and death rate. According to statistics, the annual incidence rate of spinal cord injuries in Asian countries, especially China and Korea, is 23/million, and the incidence rate of spinal cord injuries in Asian countries, especially China and Korea, is 12.06-61.6/million. At present, about 200 million paraplegic patients caused by spinal cord injury exist in China, the number of paraplegic patients increases at the speed of about 5 million people every year, the tendency of high morbidity, high disability rate and low aging is presented, and great economic pressure is brought to families and society. In china alone, government direct economic expenses due to spinal cord injury are as high as billions, and thus research and treatment of spinal cord injury become hot spots for research in various countries around the world.

After the spinal cord is damaged, the connection between the brain and the limbs is interrupted, so that the signals of the brain cannot reach the position below the damaged plane, and the patient is paralyzed below the damaged plane and loses the ability of autonomous movement. CST, which consists of the fifth-layer pyramidal neurons of the cerebral cortex emitting descending fibers, terminates directly or indirectly in anterior horn motor neurons of the spinal cord, controlling the autonomic movement of the limbs and trunk, is considered as a key element for restoring autonomic motor function. And the signal path for connecting the CST and the tail end of the spinal cord is reconnected, so that the re-domination of the brain signals to the limbs is expected. The key scientific question is how to target the junction of the CST, thereby conveying brain-derived signals from the CST. The transplantation of NSCs can realize partial connection function, a tissue engineering scaffold with synaptic connection is formed by performing in vitro induction culture on a three-dimensional gelatin sponge scaffold and NSCs from hippocampus, and the tissue engineering scaffold is transplanted to a spinal cord injury part, so that the formation of synaptic connection between the tissue engineering scaffold and intrinsic neurons at the head end and tail end of the spinal cord injury area can be realized, signal conduction is realized, and the recovery of animal behavior function is promoted [1-3], and on the basis, how to make transplanted stem cells target signals connected with CST is an unsolved key problem.

Studies have shown that differentiated neurons from embryonic spinal cord-derived NSCs can promote CST regeneration and establish functional synapses more efficiently after spinal cord injury than neurons from embryonic telencephalon or hindbrain origin, but the mechanism is unknown and presumably related to the interaction of specific adhesion molecules [4 ]. Thus, specific adhesion between CST axon terminals and nascent neurons may be a key factor in improving synaptic connectivity between the two. The role of protein Tyrosine Phosphatase σ (PTP σ) on presynaptic membranes in regulating CST axon growth and establishing synapses with target neurons is of great interest. Studies have shown that PTP sigma can be combined with postsynaptic membrane neurotrophin-3 receptor tyrosine kinase C (TrkC), thereby improving the adhesion performance of presynaptic and postsynaptic membranes and promoting the development of excitatory synapses [5], and NT-3 can further promote the adhesion between PTP sigma-TrkC [6 ]. PTP σ is a protein tyrosine phosphatase, abundantly expressed on axons, TrkC is not merely a receptor for the neurotrophic factor NT-3, it also has a typical cell adhesion domain, and the extracellular domain is a non-catalytic subunit that can play an important role in excitatory glutamatergic synapses by PTP σ binding to the axon envelope [5 ]. Therefore, we utilized the property of TrkC binding to PTP σ on the axon of CST to induce differentiation of stem cells into neurons after overexpression of TrkC and transplantation into spinal cord injury regions. Thereby achieving the purposes of improving the adhesion performance of the presynaptic membrane and the postsynaptic membrane, promoting the development of excitatory synapses and leading CST and an exogenous artificial tissue engineering scaffold to form more synapse connections.

Disclosure of Invention

In order to overcome the problem of insufficient targeting connection of CST in the existing spinal cord injury research and realize the transmission of brain-derived signals from CST, the patent constructs a three-dimensional biological scaffold containing stem cell-derived neurons over-expressing TrkC, which can be combined with regenerated CST-expressed PTP sigma and promote the formation of more functional synapses through the interaction between specific adhesion molecules, thereby promoting the repair of spinal cord injury.

The basic scheme of the invention comprises the following steps: firstly, lentivirus over expressing TrkC is constructed, NSCs from hippocampus are transfected, then the lentivirus is planted in a multi-gap gelatin sponge cylinder support slowly releasing NT-3, an exogenous artificial tissue engineering support is constructed in vitro, the artificial tissue engineering support is transplanted to a defect area of a mouse full-transection spinal cord injury area with 1mm of deletion, and the combination of TrkC and PTP sigma adhesion molecules is utilized to promote regenerated CST and transplanted stem cell source neurons to form synapse, so that CST is better connected.

The invention has the beneficial effects that: the method promotes CST connection to relay brain-derived signals in a targeted manner through the interaction between specific adhesion molecules, such as the combination of TrkC and PTP sigma, so that the repair of spinal cord injury is promoted, and a new treatment strategy is provided for clinically treating severe complete spinal cord injury.

Drawings

FIG. 1 ligation of TrkC overexpressing NSCs co-cultured with brain slices in three-dimensional scaffold sheets. (Panel A shows GFP brain pieces planted in TrkC-overexpressing NSCs at bar 40 μm; Panel B shows brain piece-derived neurites in intimate contact with TrkC-overexpressing cells, and these neurites express PTP σ at bar 10 μm.)

FIG. 2 expression of synapsin SYN between brain slice-derived projections cultured in vitro and NSCs-derived neurons overexpressing TrkC. (Panel A shows the expression of SYN in brain slices and NSCs overexpressing TrkC at bar 10 μm; Panel B shows the expression of SYN in brain slices and NSCs transfected with unloaded viruses at bar 10 μm; Panel C is a statistical representation thereof, P P < 0.05.)

FIG. 3 is a diagram of a general idea model

FIG. 4 map of vector

Detailed Description

The animal information, instruments, reagents and methods used in the present invention are described in detail below by way of specific examples:

1. animal information

(2) Mice: c57 mouse, provided by the experimental animals center of university of zhongshan.

2. Main instruments and reagents

Cryomicrotome (Thormo), fluorescence microscope (Leica), 0.01M PBS (sequoia bridge), Hoechst33342(Sigma), goat serum (GIBCO), primary antibody (MAP2, SYN, Abcam), secondary antibody (Alex-555, Invitrogen).

3. Construction of lentiviral vectors for the TrkC gene:

the constructed vector is a lentivirus vector with a red fluorescent protein reporter gene and an over-expression TrkC gene with a puromycin resistance gene.

(1) Design of primer sequences and amplification of each fragment:

Primer EF1A-TRKC-F	cagaacacaggaccggttctagagcgctgccaccATGGATGTCTCTCTTTGCCC
		TRKC-MF	GCCCTCGTCACTGGATGCCGGGCCCGACACTGTGGTC
TRKC-MR	GACCACAGTGTCGGGCCCGGCATCCAGTGACGAGGGC
		Primer TRKC CMV+	CTACCTGGACATTCTTGGCTAGCGTTACATAACTTACGGTAAATG
Primer CMV TRKC-	CATTTACCGTAAGTTATGTAACGCTAGCCAAGAATGTCCAGGTAG
		Primer RFP-	gagaagtttgttgcgccggatccCTTGTACAGCTCGTCCATGCC

the Lenti-puro-T2A-eRFP vector is subjected to double enzyme digestion by XbaI and EcoRI, four fragments, namely TRKC, I TRKC, II CMV-GFP and CMV-RFP, are amplified, are connected and transformed by adopting a recombinant cloning method, and are subjected to colony PCR identification, sequencing and plasmid extraction.

Fragment amplification conditions:

(2) plasmid extraction step:

1) 4000g of bacteria liquid is collected by centrifugation, the supernatant is discarded, 10ml of Solution1 (RNase is added) is added, and the mixture is shaken and mixed evenly.

2) Adding 10ml Solution2, mixing by gently inverting for 8-10 times until the mixture is clear, standing at room temperature for 2-3min, and mixing by inverting during the period. (Note that this step cannot be shaken vigorously, the whole process does not exceed 5min, Solution2 is dissolved before use, the cap is screwed after use to prevent acidification)

3) Adding 5ml ice bath N3, reversing gently and mixing thoroughly 10 times until white precipitate forms, standing for 2min, preparing a syringe filter, removing a piston, placing on a 50ml centrifuge tube, and pouring the liquid into the syringe filter quickly.

4) The clear lysate is filtered into a centrifuge tube by gently plugging a piston, adding 0.1 volume of ETRSolution, mixing by inversion for 10 times, ice-bathing for 10min, inverting for several times, and incubating at 42 ℃ for 5 min.

5) Pretreating the HiBind DNA Maxi Column, washing the HiBind DNA Maxi Column with 3ml of GPS, standing at room temperature for 4min, centrifuging at 25 ℃ for 5min at 4000g, and discarding the waste liquid.

The following centrifugation was carried out at 25 ℃ C

6) The sample treated in the step 10 is centrifuged at 4000g for 5min at 25 ℃, the supernatant is transferred to a new 50ml centrifuge tube, absolute ethyl alcohol with 0.5 time volume is added, the mixture is mixed by gentle inversion for 6 to 7 times, and the mixture is incubated for 2min at room temperature.

7) Transferring 10ml of the sample obtained in the last step to HiBind DNAxi Column, centrifuging for 3min at 4000g, discarding the waste liquid, and adding the sample obtained in the last step until the sample is separated.

8) 10ml of HBC buffer (isopropanol added) is added, 4000g of the mixture is centrifuged for 3min, and waste liquid is discarded.

(3) Lentivirus packaging, purification concentration and titer determination

1) Seeding of Day 0 cells: inoculating Low passage 293T into a 10cm/15 cm culture dish (the inoculation amount is determined by the expected virus amount, and the culture dish is 1 multiplied by 10^8/15 cm), controlling the inoculation density, and growing to 80% fusion the next day;

2) transfection of Day 1 plasmid: co-transfecting 293T cells with the library master plasmid, psPAX2 and pvvg helper plasmid;

3) changing the fluid by Day 2: the medium was aspirated off completely 18 hours after transfection (transfection system was toxic) and 20ml of fresh complete medium (15cm dish) was carefully added;

4) virus supernatant pretreatment: after collecting virus supernatant by Day3, 4, 5, transferring the culture supernatant into a 50ml centrifuge tube, and centrifuging for 10min at the highest rotation speed; filtering the virus supernatant by using a 0.45um filter, and directly collecting the virus supernatant by using a sterilized 250ml centrifugal bottle;

5) and (3) high-speed centrifugal purification of the virus: slowly injecting 10% sucrose solution into the bottom of a centrifuge bottle by using a 20ml syringe, keeping the volume ratio of 4:1 (4 parts of virus supernatant and 1 part of sucrose solution), centrifuging at 4 degrees and 14000rpm for 2 hours;

6) and (3) virus resuspension: discarding the supernatant, sucking, adding 100 ul-1000 ul PBS, blowing, sucking and mixing;

7) respectively packaging virus supernatants, and freezing and storing at-80 ℃; and (3) freezing and storing the left 30ul alone during subpackaging for titer determination.

8) Lentivirus titers were determined using Chemiluminescence (CMIA).

4. In vitro construction of tissue engineering scaffold over expressing TrkC

(1) 4C 57 suckling mice born for 1-3 days are selected for culturing NSCs, the brains are cut off and taken under the aseptic condition, the brains are placed in cold D-Hank's solution, and the hippocampus is separated out by using an instrument under a dissecting microscope. NSCs are cultured by adopting a mechanical blow beating method: firstly, shearing hippocampal tissues by using an ophthalmic scissors, then moving the hippocampal tissues together with D-Hank's solution into a centrifuge tube, slightly blowing and beating the D-Hank's solution for several times by using a thin-head glass pipette until no obvious tissue block can be seen by naked eyes, slowly blowing and beating the D-Hank's solution with moderate force to avoid generating bubbles, centrifuging the D-Hank's solution for 5min at 1000rpm, removing supernatant, repeating the operation once, blowing and beating the suspension cell sediment again by using NSCs culture solution, counting and adjusting the cell density to be about 1 × 105/ml, moving the cell suspension into a culture bottle, and performing suspension culture in a 5% CO2 culture box at 37 ℃. When a large number of cell clonal balls were observed to begin to form, the isolated NSCs clonal balls were mechanically blown with a thin-tipped glass pipette every other day for passaging.

(2) The tissue engineering scaffold for expressing TrkC is constructed by adopting three-dimensional gelatin sponge, NSCs with good growth state of P2 generation are selected, then certain fresh culture solution 200 mu l of RFP-TrkC lentivirus with puromycin resistance gene with MOI value of 5 is added, after 72h of culture, puromycin screening (the final concentration is 2 mu g/mL) is added, after 24h, centrifugation is carried out, old supernatant is discarded, fresh culture solution is supplemented, then 24h of culture is carried out, after cells are planted in the three-dimensional gelatin sponge scaffold for slowly releasing NT-3, the scaffold is placed in a 24-hole plate of DMEM/F12 containing 10% FBS of 300 mu l, and each hole is provided with one scaffold material. Culturing in 5% CO2 incubator at 37 deg.C for 14 days, and replacing culture solution every other day.

5. In vitro brain slices were seeded on NSCs overexpressing TrkC to detect the formation of junctions with cells overexpressing TrkC

Selecting 1C 57 suckling mouse born for 1-3 days, cutting head under aseptic condition, taking out brain, placing the brain in cold D-Hank's solution, separating cerebral cortex with an instrument under a dissecting microscope, removing hippocampus, cutting the cortex into brain slices with the thickness of 200-500 μm, separating into small blocks with the thickness of about 1mm, gently placing on pre-cultured over-expressed TrkC NSCs, culturing for 7 days, fixing, staining and observing.

6. Construction of mouse spinal cord full-transection model and transplantation of tissue engineering scaffold over-expressing TrkC constructed in vitro

Three days before operation, mice were injected with cyclosporin (0.3mg/10g) subcutaneously, and were anesthetized with pentobarbital sodium (0.064mg/10 g) intraperitoneally before operation. After fixing body position and skin preparation and disinfection, incising skin and superficial fascia under aseptic condition, blunt separating muscle and ligament along the trend of spinal acanthomys group along the spinous processes at two sides of T8-T10 by using instruments, fixing an operation area by using a self-made draw hook, clearly exposing the T9 spinous process and vertebral arch, slightly lifting the T9 spinous process by using dental forceps, slightly biting the root of the vertebral arch along the gap of the vertebral arch from T9-T10 by using ophthalmic needle holding forceps, gradually biting the T9 vertebral arch, and exposing T10 spinal cord. After cutting off the dura mater by using a straight-pointed trabecular scissors, inserting one side of a cutter foot to the bottom, quickly and completely transecting the whole spinal cord, transecting the spinal cord again at a position 2mm away from the transection part of the head end, carefully taking out the middle spinal cord tissue by using a pair of micro-forceps to ensure complete transection, fully stopping bleeding, filling the tissue engineering scaffold constructed in vitro into a tissue defect area, and suturing layer by layer according to the sequence of a muscular layer, subcutaneous tissue and skin. Marking after the operation, injecting penicillin 16 ten thousand units into each animal muscle with 1mL/d, continuously for 3 days, and carrying out artificial urination in the bladder area by using hand to moderately press 1-2 times a day. In order to prevent the undeveloped wound from being bitten, the patient is fed in a single cage after operation. Thereafter, the number of urination times can be gradually reduced according to the recovery of bladder function, the animals are raised to a time point and then the animals are subjected to material drawing and detection, and heat preservation, natural illumination time and sufficient diet are provided in the period.

The experimental results show that:

1. we succeeded in constructing a lentiviral vector of TrkC, with identical post-translational amino acid sequences. The sequencing results were as follows:

5’-TCGGAGATGGATGTCTCTCTTTGCCCAGCCAAGTGTAGTTTCTGGCGGATTTTCTTGCTGGGAAGCGTCTGGCTGGACTATGTGGGCTCCGTGCTGGCTTGCCCTGCAAATTGTGTCTGCAGCAAGACTGAG ATCAATTGCCGGCGGCCGGACGATGGGAACCTCTTCCCCCTCCTGGAAGGGCAGGATTCAGGGAACA GCAATGGGAACGCCAGTATCAACATCACGGACATCTCAAGGAATATCACTTCCATACACATAGAGAAC TGGCGCAGTCTTCACACGCTCAACGCCGTGGACATGGAGCTCTACACCGGACTTCAAAAGCTGACCA TCAAGAACTCAGGACTTCGGAGCATTCAGCCCAGAGCCTTTGCCAAGAACCCCCATTTGCGTTATATA AACCTGTCAAGTAACCGGCTCACCACACTCTCGTGGCAGCTCTTCCAGACGCTGAGTCTTCGGGAAT TGCAGTTGGAGCAGAACTTTTTCAACTGCAGCTGTGACATCCGCTGGATGCAGCTCTGGCGGGAGCA GGGGGAGGCCAAGCTCAACAGCCAGAACCTCTACTGCATCAACGCTGATGGCTCCCAGCTTCCTCTC TTCCGCATGAACATCAGTCAGTGTGACCTTCCTGAGATCAGCGTGAGCCACGTCAACCTGACCGTACG AGAGGGTGACAATGCTGTTATCACTTGCAATGGCTCTGGATCACCCCTTCCTGATGTGGACTGGATAGTCACTGGGCTGCAGTCCATCAACACTCACCAGACCAATCTGAACTGGACCAATGTTCATGCCATCAAC TTGACGCTGGTGAATGTGACGAGTGAGGACAATGGCTTCACCCTGACGTGCATTGCAGAGAACGTGG TGGGCATGAGCAATGCCAGTGTTGCCCTCACTGTCTACTATCCCCCACGTGTGGTGAGCCTGGAGGAG CCTGAGCTGCGCCTGGAGCACTGCATCGAGTTTGTGGTGCGTGGCAACCCCCCACCAACGCTGCACT GGCTGCACAATGGGCAGCCTCTGCGGGAGTCCAAGATCATCCATGTGGAATACTACCAAGAGGGAGA GATTTCCGAGGGCTGCCTGCTCTTCAACAAGCCCACCCACTACAACAATGGCAACTATACCCTCATTG CCAAAAACCCACTGGGCACAGCCAACCAGACCATCAATGGCCACTTCCTCAAGGAGCCCTTTCCAGA GAGCACGGATAACTTTATCTTGTTTGACGAAGTGAGTCCCACACCTCCTATCACTGTGACCCACAAAC CAGAAGAAGACACTTTTGGGGTATCCATAGCAGTTGGACTTGCTGCTTTTGCCTGTGTCCTGTTGGTG GTTCTCTTCGTCATGATCAACAAATATGGTCGACGGTCCAAATTTGGAATGAAGGGTCCCGTGGCTGTCATCAGTGGTGAGGAGGACTCAGCCAGCCCACTGCACCACATCAACCACGGCATCACCACGCCCTCG TCACTGGATGCCGGGCCCGACACTGTGGTCATTGGCATGACTCGCATCCCTGTCATTGAGAACCCCCA GTACTTCCGTCAGGGACACAACTGCCACAAGCCGGACACGTATGTGCAGCACATTAAGAGGAGAGAC ATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGCTACAACC TCAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGGCCCTGAAGGATCACACCCTGGCTGCCCG GAAGGATTTCCAGAGGGAGGCCGAGCTGCTCACCAACCTGCAGCATGAGCACATTGTCAAGTTCTAT GGAGTGTGCGGCGATGGGGACCCCCTCATCATGGTCTTTGAATACATGAAGCATGGAGACCTGAATAA GTTCCTCAGGGCCCATGGGCCAGATGCAATGATCCTTGTGGATGGACAGCCACGCCAGGCCAAGGGT GAGCTGGGGCTCTCCCAAATGCTCCACATTGCCAGTCAGATCGCCTCGGGTATGGTGTACCTGGCCTC CCAGCACTTTGTGCACCGAGACCTGGCCACCAGGAACTGCCTGGTTGGAGCGAATCTGCTAGTGAAG ATTGGGGACTTCGGCATGTCCAGAGATGTCTACAGCACGGATTATTACAGGCTCTTTAATCCATCTGGA AATGATTTTTGTATATGGTGTGAGGTGGGAGGACACACCATGCTCCCCATTCGCTGGATGCCTCCTGAA AGCATCATGTACCGGAAGTTCACTACAGAGAGTGATGTATGGAGCTTCGGGGTGATCCTCTGGGAGAT CTTCACCTATGGAAAGCAGCCATGGTTCCAACTCTCAAACACGGAGGTCATTGAGTGCATTACCCAAG GTCGTGTTTTGGAGCGGCCCCGAGTCTGCCCCAAAGAGGTGTACGATGTCATGCTGGGGTGCTGGCA GAGGGAACCACAGCAGCGGTTGAACATCAAGGAGATCTACAAAATCCTCCATGCTTTGGGGAAGGCC ACCCCAATCTACCTGGACATTCTTGGCTAGTGGT-3’

2. in vitro brain slice and NSCs co-culture system, it was observed that over-expression of TrkC promotes synapse formation increase.

The slow virus vector of the TrkC gene constructed by the inventor can successfully infect NSCs and express a reporter gene red fluorescent protein, the NSCs transfected with the red fluorescent TrkC are planted in a three-dimensional gelatin sponge sheet firstly, after the NSCs are cultured for 7 days, the cerebral cortex of a green fluorescent mouse is cut into a sheet under a microscope and is attached to the sheet, after the NSCs are cultured for 7 days, fixed staining is carried out, the GFP positive neurite expressing PTP sigma from a brain sheet is observed to be closely contacted with the NSCs transfected with the TrkC (figure 1), synapsin1, SYN is expressed at the place where the GFP positive neurite is closely contacted with the TrkC, compared with an unloaded virus group, the expression of SYN over-expressing the TrkC group is increased, and the statistical result shows that the two groups have statistical difference, and p is less than 0.05. (FIG. 2).

Reference documents:

[1]Lai BQ,Che MT,Du BL,Zeng X,Ma YH,Feng B,et al.Transplantation oftissue engineering neural network and formation of neuronal relay into thetransected rat spinal cord.Biomaterials.2016；109:40-54.

[2]Du BL,Zeng X,Ma YH,Lai BQ,Wang JM,Ling EA,et al.Graft of thegelatin sponge scaffold containing genetically-modified neural stem cellspromotes cell differentiation,axon regeneration,and functional recovery inrat with spinal cord transection.Journal of biomedical materials researchPart A.2015；103:1533-45.

[3]Jin H,Zhang YT,Yang Y,Wen LY,Wang JH,Xu HY,etal.Electroacupuncture Facilitates the Integration of Neural Stem Cell-DerivedNeural Network with Transected Rat Spinal Cord.Stem cell reports.2019；12:274-89.

[4]Kadoya K,Lu P,Nguyen K,Lee-Kubli C,Kumamaru H,Yao L,et al.Spinalcord reconstitution with homologous neural grafts enables robustcorticospinal regeneration.Nature medicine.2016；22:479-87.

[5]Takahashi H,Arstikaitis P,Prasad T,Bartlett TE,Wang YT,Murphy TH,et al.Postsynaptic TrkC and presynaptic PTPsigma function as a bidirectionalexcitatory synaptic organizing complex.Neuron.2011；69:287-303.

[6]Han KA,Woo D,Kim S,Choii G,Jeon S,Won SY,et al.Neurotrophin-3Regulates Synapse Development by Modulating TrkC-PTPsigma Synaptic Adhesionand Intracellular Signaling Pathways.The Journal of neuroscience:the officialjournal of the Society for Neuroscience.2016；36:4816-31。

Claims (7)

1. a construction method of a tissue engineering scaffold for repairing spinal cord injury by targeted promotion of corticospinal tract connection. The method is characterized in that:

(1) constructing a lentiviral vector over-expressing TrkC; (2) transfecting mouse hippocampal-derived Neural Stem Cells (NSCs) with the virus; (3) planting NSCs (non-steroidal cell cytokines) over-expressing TrkC in a porous gelatin sponge cylindrical bracket with independent intellectual property rights and sustained-release NT-3, and culturing in vitro for a period of time to construct an artificial tissue engineering bracket; (4) transplanting the spinal cord into a mouse full-transection spinal cord injury area; (5) TrkC provided by the artificial tissue engineering scaffold can be combined with PTP sigma on corticospinal Tract (CST) to promote formation of excitatory synapse;

(6) the better connection between the CST and the exogenous artificial tissue engineering scaffold is promoted through the interaction between adhesion molecules, and brain-derived signals are transmitted.

2. The constructed tissue engineering scaffold targeted to promote corticospinal tract attachment for spinal cord injury repair according to claim 1 has the following features: (1) transfecting cells with a viral vector with TrkC to overexpress TrkC; (2) planting the cell on a three-dimensional biodegradable material by using a tissue engineering method to form a tissue engineering scaffold loaded with the cell; (3) after the scaffold is cultured in vitro, induced and differentiated for a certain time, the scaffold is transplanted to a spinal cord injury region to provide more TrkC targets for combination of PTP sigma expressed on CST; (4) the specific binding between these adhesion molecules promotes the development of excitatory synapses, linking the CST to transmit brain-derived signals.

3. The tissue engineering scaffold according to claim 1, wherein the biological scaffold is a porous gelatin sponge cylinder scaffold, or other natural, semi-synthetic or synthetic biological scaffold, such as collagen sponge, acellular tissue material, chitosan, poly (lactic-co-glycolic acid) (PLGA), nanospheres, etc., and the NT-3 is provided by loading NT-3 on the scaffold to form a slow release material, by viral transfection of cells, or by implanting a micropump to continuously release exogenous NT 3.

4. The method for targeting and promoting CST connection according to claim 1, wherein the vector with TrkC can be various viruses such as lentivirus, adenovirus, adeno-associated virus, etc.; or electroporation, lipofection, and the like.

5. The cell according to claim 1, which provides a TrkC target, can be adult stem cells (including neural stem cells, mesenchymal stem cells, adipose stem cells, olfactory ensheathing stem cells, etc.), embryonic stem cells, and various stem cells or progenitor cells derived from induced pluripotent stem cells, and cells differentiated therefrom, or immature or mature neurons, etc.

6. The method of claim 1, wherein the method is used to promote the ligation of corticospinal tracts of mammals including humans, non-human primates, canines, porcines, ovines, lagomorphs and murines after spinal cord injury.

7. The method of claim 1, wherein the targeting of the binding site of CST is performed in addition to the TrkC and PTP σ pair molecules, and may be other molecules such as protein kinase C (protein kinase C γ, PKC γ) and N-methyl-D-aspartate (N-methyl-D-aspartate receptor, NMDA), integrin (integrin) and laminin (laminin), transcription factor protein (T-box brain 1, Tbr1) and its receptor Grin2b, Sema3A and its receptor neuroopin-1 (NP-1) or component L1 in the receptor complex, which can provide the CST expressed protein with its paired binding protein.

Images