CN1664110A - PCR amplification primer, kit and use thereof in identification of mammal sex - Google Patents

PCR amplification primer, kit and use thereof in identification of mammal sex Download PDF

Info

Publication number
CN1664110A
CN1664110A CN 200410014222 CN200410014222A CN1664110A CN 1664110 A CN1664110 A CN 1664110A CN 200410014222 CN200410014222 CN 200410014222 CN 200410014222 A CN200410014222 A CN 200410014222A CN 1664110 A CN1664110 A CN 1664110A
Authority
CN
China
Prior art keywords
embryo
reaction
pcr
primer
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200410014222
Other languages
Chinese (zh)
Inventor
陈宏权
洪桂云
章孝荣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN 200410014222 priority Critical patent/CN1664110A/en
Publication of CN1664110A publication Critical patent/CN1664110A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a PCR augmentation primer and agent box and the application in the sex identification of mammals, which is a pair of primer augmenting the 163bp area in gene Sry, sequence of basic group is: SRY5: 5'-TGAACGCCTTCATTGTGTGGTC-3',SRY3: 5'-GCTAGTAGTCTCTGTGCCTCCT-3'. The main components of the agent box are: buffer for DNA extraction, Taq DNA polymerase, PCR reaction liquid, blank control, paraffin oil and sample buffer. The applying steps of agent box in the sex identification of mammals are: (1) sample treatment, (2) augmentation, (3) product detecting. The invention is characterized by judging the existence of Y colorant layer specific fragment by detecting the augmenting product, and the avoidance of the unnecessary pollution, and the suitness for the quick(about 1 hour) sex identifying of mammal embryo in practice, the accuracy is 100%.

Description

Pcr amplification primer, and test kit and the application on mammalian sex is differentiated
Technical field
The invention belongs to detection method and test kit and the primer of a kind of PCR.
Background technology
Polymerase chain reaction (Polymerarse Chain Reaction) is called for short PCR, claim the amplification in vitro technology again, it is the external enzymatic DNA amplification new technology that human inheritance portion of U.S. Cetus company, University of California and Howghes medical colleges in 1985 etc. unite establishment, has high specificity, the susceptibility height, easy and simple to handle, rapidly and efficiently wait characteristics.After round pcr comes out, excite wide spread interest immediately and pay attention to, in worldwide, be widely used and develop very soon, enter the gene diagnosis of heredopathia, detection, medical jurisprudence, archeology and the molecular biological every field of infectious pathogen rapidly.
Round pcr is actually the enzymatic building-up reactions that depends on archaeal dna polymerase under the condition of template DNA, primer and 4 kinds of deoxyribonucleotide existence.The specificity of round pcr depends on primer and template DNA bonded specificity.Reaction divided for three steps: 1. sex change (denaturation): make the hydrogen bond rupture of dna double spiral, the two strands formation single stranded DNA that dissociates by heating; 2. annealing (annealling): when temperature suddenly and its complementary template form in the part and hybridize chain, and the complementary chance is less between the template DNA two strands; 3. extend (extension): at archaeal dna polymerase and 4 kinds of deoxyribonucleoside triphosphate substrates and Mg 2+Under the condition that exists, 5 ' → 3 ' polysaccharase catalysis is the DNA chain extension reaction of starting point with the primer.More than 3 the step be a circulation, each round-robin product can be used as next round-robin template, after a few hours, the DNA fragment specific between two primers has obtained massive duplication, quantity can reach 2 * 10 6 ~ 7Copy.
The discovery of sex-determining region Y's gene (SRY) has been introduced a new stage with sex control and the embryo gender authenticate technology of animal.Because SRY is male high special sex factor, be to judge the most reliable foundation of sex, identifying for embryo gender provides technological approaches accurately, combines with the pcr amplification technology, can be applied to early embryo sex and identify.Because the Sry gene is conservative at the Mammals camber, therefore when carrying out sex identification, can differentiate different animals with identical primer with the PCR method.The pcr amplification method is the process of dna replication dna in a kind of parody, it mainly is dna sequence dna design special primer at the Sry gene, and identify embryo's sex by pcr amplification embryo SRY specific DNA sequence, this method is because of there being reliable schedule of operation, have efficiently, characteristics fast, developed rapidly in recent years.
Have the researchist to set up the technology of milk cow and goat in vitro fertilization embryo's sex identification at present: the ovocyte of milk cow and goat through maturation in vitro, in vitro fertilization and ectogenesis to morula stage, under micrurgy, draw 4 ~ 6 embryonic cells, use the Nest-PCR technology and its DNA is carried out the mensuration of sry gene to carry out the embryo gender evaluation.There are the tube cattle embryo of foreign gene and test tube sheep embryo to carry out the sry gene detection to commentaries on classics.And will go in recipient cattle and the acceptor sheep through the embryo transfer of sex identification, the lamb that gives birth to conforms to fully with the result that sex of calf and embryo gender are identified.
Differentiate that accuracy is not high but aforesaid method exists, required time is longer, is used for animal embryo sex detection method and program and is difficult to carry out in production practice.
Summary of the invention
The PCR test kit that the purpose of this invention is to provide the evaluation of quick discriminating of a kind of cattle and sheep embryo gender and embryo cloning sex, and PCR primer are used round pcr and are carried out the discriminating of mammal embryo sex quickly and accurately.
Technology contents of the present invention is as follows:
1, the design of pcr amplification primer is with synthetic:
By sequence inquiry to animal Sry genes such as mouse, pig, sheep, goat, ox among the Genbank, with Clustal W program software to the discovery that compares of these several animal Sry gene orders: mammiferous Sry gene nucleic acid sequence has very high homology and conservative property, by the rule of design of primers, design the zone of 163bp on a pair of primer amplification Sry gene.Base sequence is as follows:
5 ' end upstream primer (SRY5): 5 '-TGAACGCCTTCATTGTGTGGTC-3 '
3 ' end upstream primer (SRY3): 5 '-GCTAGTAGTCTCTGTGCCTCCT-3 '
Above primer dilutes with sterilization distilled water 1.23-1.24mL, and ultimate density is 20 μ M ,-20 ℃ of preservations.
Table 1 and table 2 have been listed the primer sequence and the homology between several Mammalss thereof of amplification Sry gene.
Table 1, the used SRY primer of sex identification and with the homology of several Mammals Sry gene nucleic acid sequences
SRY5?TGAACGCCTTCATTGTGTGGTC
Pig TGAACGCTTTCATTGTGTGGTCTCGTGATCAAAGGAGAAAAGTGGCTCTAGAGAAC
Sheep .C....................A.G...AC....G..............T
Goat .C....................A.G...AC....G..............T
Ox .C....................A.G...AC....G..............T
Mouse TGAATG.A..T..G........C....G.G.G...CAC..GT....C.AGC....T
Rabbit TGAACG.A.....G........C.AAC....G..AC.CC.G........GC....T
Pig CCTCAAATGCAAAACTCAGAGATCAGCAAGTGGCTGGGATGCAAGTGGAAAATGCT
Continuous ..CA..C.......................CA........A.G.........G...
Mountain ..AA..T.......................CA........A.G.........G...
Ox ..CA................C.........CA........ATG.........G...
Mouse ..CAGC........TA.............CA...........G........GC..
Rabbit ..CA......G.........C.........CA.......CA.C.........G...
SRY3
Pig TACAGAAGCCGAAAAGCGCCCATTCTTCGAGGAGGCACAGAGGCTACAGGCGGT
Continuous ... T..T.................T..............A....TA..TA.
Mountain ... T..T.................T..............A....TA..TA.
Ox ... T..T.................T..............A....TA..CA.
Mouse ... G...........ATTG.......................A....G...TA.
Rabbit .T.......T.....AT.G.........C.......G..A..A..G.....CA.
Table 2, the homology of various animal Sry gene 151bp
Milk cow Sheep Goat Pig Rabbit Mouse
Milk cow sheep goat pig hairy rat ??- ?97.4 ?96.7 ?84.8 ?80.8 ?71.5 ?- ?98.7 ?86.1 ?81.5 ?72.8 ?- ?86.1 ?80.8 ?72.2 ?- ?78.1 ?74.2 ?- ?76.8 -
The PCR test kit that contains above-mentioned primer, its main moiety are (50 reaction):
1. DNA extraction damping fluid (DNA extract buffer) 1mL, its main component is embryo's treatment solution (10mmol/LTris-HCl (pH8.3), 50mmol/L KCl, 2mmol/LMgCl 2, 0.45%NP-40,0.45%Tween-20,0.1 μ g/ μ L Proteinase K);
2. Taq archaeal dna polymerase (Taq DNA polymerase) 20 μ L are total to 100IU;
3. PCR reaction solution (PCR reaction buffer) 1500 μ L include 2.533mmol/LMgCl 2, 0.337 μ mol/L primer, 0.168mmol/L dNTPs;
4. blank (negative contrast) 250 μ L;
5. paraffin oil (paraffin liquid) 1mL;
6. sample-loading buffer (loading buffer) 100 μ L include 0.2% tetrabromophenol sulfonphthalein, 50% sucrose solution.
The application of described test kit on the PCR mammalian sex is identified may further comprise the steps:
1. sample preparation,
Collect 1 ~ 2 cell of mammal embryo, earlier with 0.145mol/L NaCl towards Xian 2 times, add embryo's treatment solution (10mmol/LTris-HCl (pH8.3), 50mmol/L KCl, 2mmol/L MgCl again 2, 0.45%NP-40,0.45%Tween-20,0.1 μ g/ μ L Proteinase K), making cumulative volume is 20 μ L, with embryo and treatment solution thereof at 55 ℃ of water-bath effect 60min, then with this embryo's solute directly as the template of PCR reaction.
2. amplified reaction,
Get PCR reaction solution n * 29.6 μ L, Taq archaeal dna polymerase n * 0.4 μ L and mix in a centrifuge tube by waiting to expand sample number n (the n=embryo handles sample number+2), strike with finger and severally make its mixing down, with the reaction tubes mark good after, press every pipe 30 μ L packing.Blank 50 μ L are added in the reaction tubes, get each embryo again and handle in the corresponding reaction tubes of sample (20 μ L) adding (reaction system is 50 μ L), every pipe adds 20 μ L sterilization Valelinum Liquidum, increases on the of short duration centrifugal rearmounted amplification instrument.Reaction parameter: behind 95 ℃ of pre-sex change 5min, by 95 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min programs are carried out 35 circulations, and 9min is stretched in last 72 ℃ of courts of a feudal ruler, finish reaction in 4 ℃.
3. product detects,
Get pcr amplification product 10 μ L, add 2 μ L sample-loading buffers, fully point sample behind the mixing uses PCR Marker as molecular weight standard.Finish electrophoresis with containing the painted 2% agarose gel electrophoresis 1h (3-4V/cm) of EB back.Glue is placed observation under the ultraviolet lamp, and what special band occurs is male, otherwise is female.
DNTP (deoxyribonucleoside triphosphate) is a deoxyribonucleoside triphosphate.
The designed sex identification primer of the present invention can also be used for identifying the sex of Mammals body early embryos such as pig, rabbit.The suitableeest amplification condition of amplification cow genome group DNA is adopted in the PCR reaction.
The present invention uses primer SRY5, liver and the muscle cdna group DNA sample of SRY3 amplification ox, the genome DNA sample of sheep, the genome DNA sample of rabbit, the genome DNA sample of pig, the specific amplified band of the equal clear display of electrophoretic analysis result of amplified production, size is 163bp, the electrophoretic analysis result of the amplified production of sow sample and blank does not all have corresponding specific amplified band.
The a pair of sex identification primer of the present invention's design is mixed with PCR sex identification test kit by embryo's DNA cloning condition of optimizing.The key of the PCR sex identification test kit of being prepared is Mg 2+Concentration, Mg 2+The size of concentration is very big to the experimental result influence, Mg among the present invention 2+The concentration optimum concn is 1.5mol/L, is greater than or less than this concentration and all can not successfully carries out pcr amplification.And other composition and reaction parameter and Standard PC R reaction require basically identical.Test kit of the present invention adopts round pcr that the conservative nucleotide sequence in the male specificity sry gene is increased, by the detection of amplified production being judged the Y chromosome specific fragment exists, simultaneously can avoid unnecessary pollution, be applicable to the sex of quick (about 1 hour) discriminating mammal embryo in the production practice, rate of accuracy reached to 100%.
Description of drawings
Fig. 1 is a cow genome group DNA pcr amplification experiment spectrogram.
Among Fig. 1, (a) 1,2,3 bulls; 4 PCR Marker; 5,6,7 cows; 8 blanks
(b) 1 PCR Marker; 2,4,6,8 bulls; 3,5,7 cows; 9 blanks
(c) 1,2,3, the 4-bull; 5 PCR Marker; 6,7,8 cows; 9 blanks
Fig. 2 is sheep and rabbit genomic dna pcr amplification experiment spectrogram.
Among Fig. 2, the 1-ram; 2,3, the 4-buck; 5-PCR Marker; 6, the 7-ewe; The female rabbit of 8-; 9-
Blank
Fig. 3 is a pig genomic dna pcr amplification experiment spectrogram.
Among Fig. 3,1 PCR Marker; 2,4,6,8 boars; 3,5,7 sows; 9 blanks
Embodiment
Example 1
Utilize animal gene group DNA detection sex
The extraction purifying and the quality examination of the genomic dna of animal tissues
1,0.5mg fresh animal muscle tissue or liver organization are cut into pieces to be placed on fills 4.5mL DNA extraction damping fluid (10 mmol/LTris-HCl, 0.1mol/LEDTA, 20 μ g/mL RNA enzymes, in homogenate pipe 0.5%SDSpH8.0), the homogenate pipe places the beaker of ice cube, adopts the about 90sec of electric driven glass refiner middling speed homogenate.Homogenate is all poured in 2 5mL centrifuge tubes, and centrifuge tube is equipped with in the beaker of ice cube, with ultrasonic cell disruptor (power 400W, ultrasonic time 3sec, off time 4sec, work number of times 15 times) pulverize.EDTA is meant ethylenediamine tetraacetic acid (EDTA).
2, after the crash cells, centrifuge tube is put 37 ℃ of incubation 1 h in the constant temperature water bath vibrator fast.
3, in centrifuge tube, add 25 μ L Proteinase Ks, to final concentration be 100 μ g/mL, leniently enzyme is sneaked in the viscid solution with a glass rod.
4, the suspension with lysing cell places 50 ℃ of constant temperature water bath vibrators water-bath, 3 h.Solution is chilled to room temperature, adds the saturated phenol of equal-volume Tris-HCl (pH7.9 ± 0.2), put upside down the about 10min of centrifuge tube lentamente back and forth, mix two-phase carefully.Centrifugal 10,000r/min, 30min.
5, with heavy caliber (3mm) pipettor head upper water is moved in the centrifuge tube of a cleaning mutually.Add isopyknic phenol: chloroform: primary isoamyl alcohol (25: 24: 1), put upside down the about 10min of centrifuge tube lentamente back and forth, mix two-phase carefully.Centrifugal 10,000r/min, 20min.
6, with heavy caliber (3mm) pipettor head upper water is moved in the centrifuge tube of a cleaning mutually.Add isopyknic chloroform: primary isoamyl alcohol (24: 1), put upside down centrifuge tube 5min lentamente back and forth, to mix two-phase carefully.Centrifugal 10,000r/min, 10min.
7, with heavy caliber (3mm) pipettor head the upper strata water is all moved in the centrifuge tube of a cleaning.Add the sodium-acetate (3mol/L pH5.2) of 0.1 times of volume and the dehydrated alcohol of 2 times of volumes in room temperature, the centrifuge tube that rolls on the table makes its abundant mixing, and DNA forms flocks immediately.With glass rod picking precipitation or the centrifugal 5000r/min of room temperature, 5min collecting precipitation.And remove liquid with the pipettor head as far as possible.
8, with 70% ethanol suspension precipitation secondary, the centrifugal 5000r/min of room temperature, 5min collects DNA.Remove 70% ethanol as far as possible.(but do not make the precipitation complete drying, otherwise be difficult for dissolving.)
9, TE (10mmol/L Tris-HCl, 1mmol/L EDTA pH 8.0) dissolving DNA precipitation is rapped it, DNA is dissolved fully after ,-20 ℃ of preservations.
10, ultraviolet spectrophotometry detects purity and the content of DNA
In quartz colorimetric utensil, add 15 μ L DNA samples, add water to 3mL, measure the ultraviolet absorption value of DNA sample behind the mixing respectively, and calculate A at 260nm and 280nm place 260/ A 280Value.A 260/ A 280Should be between 1.75-1.8, be lower than 1.75 and show and retain remarkable protein in the prepared product, should add SDS this moment and be 0.5% and repeat the above-mentioned 2-10 step to final concentration; Show in the DNA sample that greater than 1.8 RNA is arranged, should add the RNA enzyme this moment, and repeat the above-mentioned 2-10 step.Calculate DNA concentration: 10 * A 260(μ g/ μ L)
11, agarose gel electrophoresis detects DNA purity.
1. the preparation of 2% gel
Accurately take by weighing the 0.18g agarose and dissolve in 1 * TAE (0.04mol/L Tris-HCl of 18mL, 0.02mol/LNaAC, 2 mmol/LEDTA pH8.0) in, put to heat on the electric furnace and also shake frequently to fusing fully, room temperature is chilled to 50-60 ℃, and the 10mg/mL EB that adds 1 μ L shakes up immediately, pours into rapidly and seals in the electrophoresis chamber of mouth with the adhesive waterproof tape of the bacterium of going out, place more than the 30min under the room temperature, extract comb.
2. the preparation of sample
Putting 2 μ L sample-loading buffers and 10 μ L DNA samples on the cured film paper, abundant mixing, and with PCRMarker as molecular weight standard.
3. electrophoresis
Gel is immersed in the electrophoretic buffer, behind the point sample, connect with the mains, 3 V/cm are more than the electrophoresis 1h.
4. observations
Use the hand-held ultraviolet lamp observations, and the preservation of taking pictures.
Example 2
The extraction purifying and the quality examination of the genomic dna of animal serum
1, collects about 6mL fresh blood, add in the centrifuge tube that the acid acid citrate dextrose solution B of 1mL (glucose 1.47g adds water to 100mL for ACD solution-citric acid 0.48g, Trisodium Citrate 1.32g) is housed.Blood can be in 0 ℃ of preservation a couple of days or in-70 ℃ of prolonged preservation before preparation DNA.
A, the centrifugal 4500r/min of fresh blood (2mL), 15min abandons upper plasma, carefully yellowish layer moved in the new centrifuge tube with suction pipe, and recentrifuge 4500r/min, 15min.After centrifugal yellowish layer is resuspended in 1.5mLDNA and extracts in the damping fluid, in 37 ℃ of incubation 1h, later step is with the 3-11 step of example 1.
B, refrigeration blood (2mL), room temperature is melted, and moves in the new centrifuge tube, with equal-volume phosphate buffered saline(PBS) PBS (8g NaCl, 0.2g KCl, 1.44g Na 2HPO 4, 0.24g KH 2PO 4, add water to 1 L adjust pH 7.4) and dilution, subsequently in the centrifugal 7000r/min of room temperature, 15min.And supernatant discarded, with the resuspended throw out of 1.5mLDNA extraction buffer, in 37 ℃ of incubation 1 h, later step is with the 3-11 step of example 1.
2, amplified reaction
Get PCR reaction solution n * 29.6 μ L, Taq archaeal dna polymerase n * 0.4 μ L and mix in a centrifuge tube by waiting to expand sample number n (the n=embryo handles sample number+2), strike with finger and severally make its mixing down, with the reaction tubes mark good after, press every pipe 30 μ L packing.Blank 50 μ are added in the reaction tubes, get each embryo again and handle in the corresponding reaction tubes of sample (20 μ L) adding (reaction system is 50 μ L), every pipe adds 20 μ L sterilization Valelinum Liquidum, increases on the of short duration centrifugal rearmounted amplification instrument.Reaction parameter: behind 95 ℃ of pre-sex change 5min, by 95 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min programs are carried out 35 circulations, and 9min is stretched in last 72 ℃ of courts of a feudal ruler, finish reaction in 4 ℃.
3, product detects
Get pcr amplification product 10 μ L, add 2 μ L sample-loading buffers, fully point sample behind the mixing uses PCR Marker as molecular weight standard.Finish electrophoresis with containing EB painted 2% agarose gel electrophoresis 1 h (3-4V/cm) back.
Glue is placed observation under the ultraviolet lamp, and what special band occurs is male, otherwise is female.
Example 3
Identify the method for sex with the embryo
1, embryo's evaluation and mensuration size
The embryo who examines under stereomicroscope puts in the sterilisable chamber for 3 times with clean Xian of PBS, leaves standstill 0.5h, in nutrient solution, evaluates its developmental stage, embryo age and rank.
2, embryo's processing
Collect 1 ~ 2 cell of mammal embryo, earlier with 0.145mol/L NaCl towards Xian 2 times, add embryo's treatment solution (10mmol/LTris-HCl (pH8.3), 50mmol/L KCl, 2mmol/L MgCl again 2, 0.45%NP-40,0.45%Tween-20,0.1 μ g/ μ L Proteinase K), making cumulative volume is 20 μ L, with embryo and treatment solution thereof at 55 ℃ of water-bath effect 60min, then with this embryo's solute directly as the template of PCR reaction.
3, amplified reaction
Get PCR reaction solution n * 29. μ L, Taq archaeal dna polymerase n * 0.4 μ L and mix in a centrifuge tube by waiting to expand sample number n (the n=embryo handles sample number+2), strike with finger and severally make its mixing down, with the reaction tubes mark good after, press every pipe 30 μ L packing.Blank 50 μ L are added in the reaction tubes, get each embryo again and handle in the corresponding reaction tubes of sample (20 μ L) adding (reaction system is 50 μ L), every pipe adds 20 μ L sterilization Valelinum Liquidum, increases on the of short duration centrifugal rearmounted amplification instrument.Reaction parameter: behind 95 ℃ of pre-sex change 5min, by 95 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min programs are carried out 35 circulations, and 9min is stretched in last 72 ℃ of courts of a feudal ruler, finish reaction in 4 ℃.
4, quality testing is surveyed
Get pcr amplification product 10 μ L, add 2 μ L sample-loading buffers, fully point sample behind the mixing uses PCR Marker as molecular weight standard.Finish electrophoresis with containing EB painted 2% agarose gel electrophoresis 1 h (3-4V/cm) back.Glue is placed observation under the ultraviolet lamp, and what special band occurs is male, otherwise is female.
Example 4
Can carry out the sex identification of pig, dog, other animal of sheep with aforesaid method, method is with example 1 or example 2 or example 3.

Claims (3)

1, a kind of pcr amplification primer is the zone of 163bp on a pair of primer amplification Sry gene, and base sequence is as follows:
5 ' end upstream primer (SRY5): 5 '-TGAACGCCTTCATTGTGTGGTC-3 '
3 ' end upstream primer (SRY3): 5 '-GCTAGTAGTCTCTGTGCCTCCT-3 '.
2, the test kit that contains claim 1 primer, its main moiety are (50 reaction):
1. DNA extraction damping fluid (DNA extract buffer) 1mL, its main component is embryo's treatment solution, the composition of embryo's treatment solution is: 10mmol/LTris-HCl pH8.3,50mmol/L KCl, 2mmol/LMgCl 2, 0.45%NP-40,0.45%Tween-20,0.1 μ g/ μ L Proteinase K;
2. Taq archaeal dna polymerase (Taq DNA polymerase) 20 μ L are total to 100IU;
3. PCR reaction solution (PCR reaction buffer) 1500 μ L include 2.533mmol/LMgCl 2, 0.337 μ mol/L primer, 0.168mmol/L dNTPs;
4. blank (negative contrast) 250 μ L;
5. paraffin oil (paraffin liquid) 1mL;
6. sample-loading buffer (loading buffer) 100 μ L include 0.2% tetrabromophenol sulfonphthalein, 50% sucrose solution.
3, the application of test kit on the PCR mammalian sex is identified as claimed in claim may further comprise the steps:
1. sample preparation,
Collect 1 ~ 2 cell of mammal embryo, earlier with 0.145mol/L NaCl towards Xian 2 times, add embryo's treatment solution again: 10mmol/LTris-HCl pH8.3,50mmol/L KCl, 2mmol/L MgCl 2, 0.45%NP-40,0.45%Tween-20,0.1 μ g/ μ L Proteinase K, making cumulative volume is 20 μ L, with embryo and treatment solution thereof at 55 ℃ of water-bath effect 60min, then with this embryo's solute directly as the template of PCR reaction,
2. amplified reaction,
By waiting to expand sample number n, the n=embryo handles sample number+2, gets PCR reaction solution n * 29.6 μ L, Taq archaeal dna polymerase n * 0.4 μ L and mixes in a centrifuge tube, strike with finger and severally down make its mixing, with the reaction tubes mark good after, press every pipe 30 μ L packing.Blank 50 μ L are added in the reaction tubes, get each embryo's processing sample 20 μ L again and add in the corresponding reaction tubes, reaction system is 50 μ L, and every pipe adds 20 μ L sterilization Valelinum Liquidum, increases on the of short duration centrifugal rearmounted amplification instrument; Reaction parameter: behind 95 ℃ of pre-sex change 5min, by 95 ℃ of 1min, 58 ℃ of 1min, 72 ℃ of 1min programs are carried out 35 circulations, and 9min is stretched in last 72 ℃ of courts of a feudal ruler, finish reaction in 4 ℃;
3. product detects,
Get pcr amplification product 10 μ L, add 2 μ L sample-loading buffers, fully point sample behind the mixing uses PCR Marker as molecular weight standard; With containing the painted 2% agarose gel electrophoresis 1h of EB, finish electrophoresis behind the 3-4V/cm, glue is placed under the ultraviolet lamp observe, what special band occurs is male, otherwise is female.
CN 200410014222 2004-03-03 2004-03-03 PCR amplification primer, kit and use thereof in identification of mammal sex Pending CN1664110A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 200410014222 CN1664110A (en) 2004-03-03 2004-03-03 PCR amplification primer, kit and use thereof in identification of mammal sex

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 200410014222 CN1664110A (en) 2004-03-03 2004-03-03 PCR amplification primer, kit and use thereof in identification of mammal sex

Publications (1)

Publication Number Publication Date
CN1664110A true CN1664110A (en) 2005-09-07

Family

ID=35035420

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200410014222 Pending CN1664110A (en) 2004-03-03 2004-03-03 PCR amplification primer, kit and use thereof in identification of mammal sex

Country Status (1)

Country Link
CN (1) CN1664110A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101701257B (en) * 2009-11-13 2011-12-21 中国检验检疫科学研究院 PCR authenticating primer and method of oryza punctata
CN101701256B (en) * 2009-11-13 2011-12-21 中国检验检疫科学研究院 Primer and method for PCR identification of maize
CN112094840A (en) * 2019-06-17 2020-12-18 南京尧顺禹生物科技有限公司 Rapid preparation method of trace animal sample genome DNA template for genome segment amplification
CN115851967A (en) * 2022-09-09 2023-03-28 海南省农业科学院畜牧兽医研究所 Substance for detecting SRY gene and PCR detection method for sex identification of pig, goat and cattle

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101701257B (en) * 2009-11-13 2011-12-21 中国检验检疫科学研究院 PCR authenticating primer and method of oryza punctata
CN101701256B (en) * 2009-11-13 2011-12-21 中国检验检疫科学研究院 Primer and method for PCR identification of maize
CN112094840A (en) * 2019-06-17 2020-12-18 南京尧顺禹生物科技有限公司 Rapid preparation method of trace animal sample genome DNA template for genome segment amplification
CN115851967A (en) * 2022-09-09 2023-03-28 海南省农业科学院畜牧兽医研究所 Substance for detecting SRY gene and PCR detection method for sex identification of pig, goat and cattle

Similar Documents

Publication Publication Date Title
CN103045727B (en) SNP (Single Nucleotide Polymorphism) marker related with Chinese Holstein cow milk production property and somatic cell score and application thereof
CN106636072B (en) General DNA extraction method and kit for animal traditional Chinese medicine molecular identification
CN102676514A (en) Single nucleotide polymorphism (SNP) mark relevant with milk production traits of Chinese Holstein dairy cattle and application thereof
CN107385079B (en) Method for detecting components of cattle, sheep, chicken, duck and pork by PCR (polymerase chain reaction) and RPA (reverse transcription amplification) amplification modes, primer group and kit
WO2014079350A1 (en) Cho cell dna detection method
WO2012155577A1 (en) Method for separating and purifying rna from biomaterial
CN104498599A (en) Microsporidium molecule universal detection primers and kit thereof
CN109837345B (en) Primer and method for detecting residual DNA of mouse cells
CN1721552A (en) Fluorescent quantitative PT-PCR detection kit for detecting BCR-ABL fusion gene (P210bcr/abl)mRNA
CN101063169A (en) PCR-RFLP method for checking goat luteotropin gene mononucleotide polymorphism
CN1664110A (en) PCR amplification primer, kit and use thereof in identification of mammal sex
CN1693479A (en) Kit with fluorescent quantitative RT-PCR detection technique used for cell keratin 19(Ck19)mRNA
CN1506468A (en) PCR test kit for hygrophilous aeromonad and its test method
CN1824801A (en) Real-time fluorescent PCR testing primer, probe and immobilized kit for citrus ulcer bacteria and testing process thereof
CN101029336A (en) Reagent kit for predicting serotonin re-uptake inhibitor medicine effect
CN1900314A (en) Fluorescence labelling ABO gene typing method and its reagent kit
CN1814785A (en) Method for detecting Brucellosis and primer thereof
CN1196755A (en) Methods for determining coat colour genotype of pig
CN1687458A (en) FQ-PCR diagnosis kit of WSSV and test method
CN100344758C (en) Antibacterial peptide gene of Chinese prawn containing single whey acidic protein structure domain and its coded antibacterial peptide and application
JPWO2019240073A1 (en) Quantitative PCR probe
CN104498509B (en) HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection
CN109355379B (en) Kit for detecting autosomal dominant hereditary deafness family-induced deafness gene mutation
CN107130037B (en) Method and special kit for auxiliary detection of cattle growth and carcass traits through TNNI1 gene
CN202671540U (en) SNP (single nucleotide polymorphism) typing reagent kit for BMP (bone morphogenetic protein) 15 genes related to egg laying character of chicken

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20050907