CN107385079B - Method for detecting components of cattle, sheep, chicken, duck and pork by PCR (polymerase chain reaction) and RPA (reverse transcription amplification) amplification modes, primer group and kit - Google Patents

Abstract

The invention relates to a meat biological detection technology, in particular to a method for detecting components of cattle, sheep, chickens, ducks and pork by a PCR (polymerase chain reaction) and RPA (reverse transcription amplification) method, a primer group and a kit. The invention designs a PCR and RPA detection primer for duck, cattle, sheep, chicken and pig animal-derived components. The lowest copy number of target sequence detected by PCR was 10²A copy; the copy number of the lowest target sequence detected by the pig and chicken source specific primer RPA is 10²The copy number of the lowest target sequence of the specific primers of duck and sheep is 10¹The lowest copy number of the target sequence of the bovine-derived specific primer is 10⁰And (4) respectively.

Description

Method for detecting components of cattle, sheep, chicken, duck and pork by PCR (polymerase chain reaction) and RPA (reverse transcription amplification) amplification modes, primer group and kit

Technical Field

The invention relates to a meat biological detection technology, in particular to a method for detecting components of cattle, sheep, chickens, ducks and pork by a PCR and RPA amplification mode, a primer group and a kit.

Background

In recent years, adulteration of beef and mutton occurs. The mutton is often mixed with pork, duck meat, fox meat and other meats with lower value, or the pork and duck meat are directly mixed with mutton fat, essence, mutton powder and other illegal cases. The continuously exposed fake mutton cases for making and selling have attracted great social attention. The reason for the adulteration of beef and mutton mainly has three aspects:

1. the domestic animal meat and meat products have huge consumption market. Since the country is built, the annual average meat consumption of China is increased by nearly 13 times, and the meat consumption demand is in a steady rising trend through the change from quality to quality. In 10 years after prediction of Zhang Tianzhu in 2013, the average growth speed of the demand of meat products in China is not lower than 5%.

2. The breeding amount of the livestock and poultry in China is huge, the market distribution is scattered, the supervision department is difficult to cover the livestock and poultry, and the supervision strength can not meet the requirements. According to relevant data statistics, about more than 3000 existing beef cattle in China are hidden in various small towns and rural street-side trading markets, most of the trading markets are small in scale, the trading modes are not standard, the market supervision is not in place, many holes in supervision exist, and black-heart vendors find opportunities.

3. Cattle, mutton and the like can gain a great deal of profit by adulteration. The market price of beef, mutton and other meat products is gradually increased under the influence of factors such as increased feeding cost and the like. In 2011, the market selling prices of cattle and mutton in China are 36 yuan/kg and 40 yuan/kg respectively, and the selling prices in 2017 are increased to 70 yuan/kg and 60 yuan/kg. The market is driven by interests by illegal vendors at home and abroad, and the events that low-price meat is mixed into high-price beef and mutton for sale are shown, such as the horse meat wind wave that horse meat is mixed into beef hamburgers for sale in 1 month in 2013 and British and Ireland; the tin-free detection and preparation of the fake mutton case in Jiangsu of 2 months in 2013.

Pork and duck meat are mixed with beef and mutton for sale so as to be secondary, frequent events disturbing the market order not only seriously infringe the rights and benefits of consumers, but also threaten the physical health of the consumers. The method for judging animal sources according to sensory judgment, morphology (such as color, smell, elasticity, and the like) and other means has great limitation, and cannot completely meet the rapid detection requirement of the current meat product market, especially meat product deep-processing products. Therefore, how to improve the level of animal source detection by using modern molecular biology technology and develop a set of rapid, quick and effective detection system has important significance for protecting the benefit of consumers and maintaining the food safety.

At present, animal source component detection is mainly divided into two categories, one is based on protein level detection, and the detection mainly comprises an electrophoresis method, a chromatography method and an enzyme-linked immunosorbent assay; the other is based on the detection of nucleic acid level, and mainly comprises restriction fragment length polymorphism, PCR, multiplex PCR, real-time fluorescence quantitative PCR, a loop-mediated isothermal amplification method and the like.

Most of detection technologies for protein or nucleic acid level require expensive and professional instruments, are complicated in operation process, and require operators with professional backgrounds, so that many of the technologies cannot be separated from laboratories and further applied to production practice.

The current miscellaneous meat sale market in China needs to be strictly supervised, and a rapid, simple, convenient and accurate meat component detection method needs to be established urgently. RPA has significant advantages over other means of detecting animal derived components. If a nucleic acid amplification system of RPA of different animal meat can be established, the method not only meets the urgent requirements of consumers on food safety detection, but also provides a new technical support for the national quality inspection department.

Disclosure of Invention

In order to solve the technical problems, the first object of the present invention is to provide a primer set for detecting the components of cattle, sheep, chicken, duck and pork simultaneously by using PCR and RPA amplification methods; the second purpose of the invention is to provide a kit for detecting the components of cattle, sheep, chicken, duck and pork simultaneously by using PCR and RPA amplification modes; the third purpose of the invention is to provide a method for detecting the components of cattle, sheep, chicken, duck and pork by a PCR amplification mode, and the fourth purpose of the invention is to provide a method for detecting the components of cattle, sheep, chicken, duck and pork by an RPA amplification mode. The invention designs a PCR and RPA detection primer for duck, cattle, sheep, chicken and pig animal-derived components. The lowest copy number of the target sequence detectable by PCR is 10²A copy; the lowest copy number of the detection target sequence of the pig and chicken source specific primer RPA is 10²The lowest copy number of the target sequence of the specific primer of duck, sheep originNumber 10¹The minimum copy number of the target sequence of the bovine-derived specific primer is 10⁰And (4) respectively.

In order to achieve the first object, the invention adopts the following technical scheme:

a primer group simultaneously suitable for detecting components of cattle, sheep, chicken, duck and pork in PCR and RPA amplification modes comprises the following sequences:

duck:

YA-F:CCTAGTCCTCAGTCTCGCAT

YA-R:CTTGTAGGACTTCTGGGAATC；

cattle:

NIU-F:GATTCAGTGCATCTAACCCT

NIU-R:CCTTGCGGTACTTTCTCTAT；

sheep:

YANG-F:GCAGGGTTCATTATCTCTAATAA

YANG-R:GGCTTGTGATTGTGGTGGATAT；

chicken:

JI-F:TACCATGTTCTAACCCATTTGG

JI-R:AGTTCAGGAGTTATGCATGG；

a pig:

ZHU-F:CACGCGCATATAAGCAGGTAA

ZHU-R:CAGATTGTGGGCGTATACT。

in order to achieve the second object, the invention adopts the following technical scheme:

a kit for detecting components of cattle, sheep, chickens, ducks and pork simultaneously suitable for PCR and RPA amplification modes comprises the primer group.

In order to achieve the third object, the present invention adopts the following technical solutions:

the method for detecting the components of cattle, sheep, chicken, duck and pork by a PCR amplification mode comprises the following steps:

1) extracting genomic DNA according to the method of the kit for extracting genomic DNA from animal tissue, or extracting reference molecule

The DNA extraction method of the clone, obtain DNA from tissue sample, dissolve in TE solution or pure water and keep for subsequent use;

2) preparing PCR reaction solutions according to the following system using the primer sets according to claim 1, respectively;

3) the PCR conditions were set as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃, and storing at 4 ℃;

4) after the reaction is finished, 10 mu L of target PCR amplification product is mixed with 2 mu L of 6 XLoading Buffer, and the mixture is loaded on 1.5% agarose gel and subjected to 200V electrophoresis for 15 min; ending the electrophoresis when the bromophenol blue moves to 2/3 below the gel; EB staining for 5min, observing under ultraviolet lamp, and taking a picture; the lengths of the amplified fragments of the duck, the cattle, the sheep, the chicken and the pig are 338bp, 292bp, 349bp, 208bp and 324 bp.

In order to achieve the fourth object, the present invention adopts the following technical solutions:

a method for detecting components of cattle, sheep, chicken, duck and pork by an RPA amplification mode comprises the following steps:

1) extracting genomic DNA according to the operation method of the animal tissue genomic DNA extraction kit, or obtaining DNA from a tissue sample by a DNA extraction method of reference molecule cloning, and dissolving the DNA in TE solution or pure water for storage;

2) using the primer sets according to claim 1, twist Amp^TMThe Basic kit is used for preparing an RPA reaction solution according to the following system;

3) after the reaction solution was prepared, 1.25. mu.L of 280mM MgAc was added to each 0.2mL eppendorf tube₂Fully and uniformly mixing; placing 0.2mL of eppendorf tube on a PCR instrument with a hot cover function, and preserving the temperature for 40min at 37 ℃;

4) after the RPA reaction is finished, adding 100 mu L of Tris saturated phenol into a 0.2mL eppendorf tube, and shaking and uniformly mixing; centrifuging at 12000rpm for 10min at 4 deg.C;

5) mixing 10 μ L of supernatant with 2 μ L of 6 × Loading Buffer, Loading on 1.5% agarose gel, and performing 200V electrophoresis for 15 min; ending the electrophoresis when the bromophenol blue moves to 2/3 below the gel; EB staining for 5min, observing under an ultraviolet lamp and taking a picture; the lengths of the amplified fragments of the duck, the cattle, the sheep, the chicken and the pig are 338bp, 292bp, 349bp, 208bp and 324 bp.

Preferably, the step 3) adopts the body surface temperature of a human body to carry out the RPA reaction.

The invention designs the PCR and RPA detection primers of animal-derived components of ducks, cattle, sheep, chickens and pigs by analyzing the mitochondrial DNA of cattle, sheep and duck, chicken and pig species frequently used when cattle and mutton are adulterated in the market. The lowest copy number of target sequence detected by PCR was 10²A copy; the copy number of the lowest target sequence detected by the pig and chicken source specific primer RPA is 10²The copy number of the lowest target sequence of the specific primers of duck and sheep is 10¹The lowest copy number of the target sequence of the bovine-derived specific primer is 10⁰And (4) respectively. The invention determines that the RPA amplification reaction of animal source detection can be completed by using the body temperature of a human body.

Drawings

FIG. 1 shows PCR amplification of a duck origin component detection primer (the templates of the amplification products in lanes 1 to 5 correspond to the total DNA of ducks, cattle, sheep, chickens and pigs, respectively; M, DNA marker, the same applies hereinafter)

FIG. 2 PCR amplification of bovine-derived component detection primers.

FIG. 3 PCR amplification of sheep derived component detection primers.

FIG. 4 PCR amplification of chicken-derived component detection primers.

FIG. 5 PCR amplification of pig origin component detection primers.

FIG. 6 RPA amplification of the primers for detection of duck-origin components.

FIG. 7 RPA amplification of bovine-derived component detection primers.

FIG. 8 RPA amplification of sheep derived component detection primers.

FIG. 9 RPA amplification of chicken-derived component detection primers.

FIG. 10 RPA amplification of pig origin component detection primers.

FIG. 11 detection of Duck origin components by PCR amplificationThe sensitivity of the primers was determined (10 for each template of the amplification products in lanes 1-8)⁷、10⁶、10⁵、10⁴、10³、10²、10¹、10⁰A copy of plasmid DNA solution; lane 9 is a negative control; m, DNA Marker. The same applies below).

FIG. 12 sensitivity of the primers for RPA amplification detection of duck origin components.

FIG. 13 sensitivity of primers for detecting bovine-derived components by PCR amplification.

FIG. 14 sensitivity of primers for RPA amplification detection of bovine-derived components.

FIG. 15 sensitivity of primers for detection of sheep derived components by PCR amplification.

FIG. 16 sensitivity of primers for detecting sheep derived components by RPA amplification.

FIG. 17 sensitivity of primers for detection of chicken-derived components by PCR amplification.

FIG. 18 sensitivity of primers for RPA amplification detection of chicken-derived components.

FIG. 19 sensitivity of primers for detecting pig-derived components by PCR amplification.

FIG. 20 sensitivity of primers for detecting porcine-derived components by RPA amplification.

FIG. 21 shows the amplification of the RPA primers for detection of sheep origin using the body surface temperature (M: DL2000plus DNA marker; template for the amplified product in lane 1, 1 is total DNA in sheep.)

Detailed Description

The following describes a detailed embodiment of the present invention with reference to the accompanying drawings.

1 materials and methods

1.1 test animals

Chinese Holstein cattle peripheral blood samples are taken from the core group of Yikang dairy cow farm in Jinhua city, Zhejiang, Hu sheep peripheral blood samples are taken from the core group of Hu sheep meat use line of Yihui ecological agriculture Limited company, Huzhou, Ross chicken blood samples are taken from individual purchase of Zhejiang university big broiler chicken Limited company, Muscovy duck genome DNA is presented to the West duck genome DNA by Lu Lizhi researche poultry breeding research institute of agricultural science institute, Zhejiang, and Jinhua pig genome DNA is presented to the Xuan auxiliary researcher of poultry breeding research institute of agricultural science institute, Zhejiang.

1.2 test reagents

TwistAmp^TMBasic (twist Amp, England)

Taq DNA Polymerase (TaKaRa, Japan)

Proteinase K (Amersham, USA)

Vector pEASY^TM-T5Zero Cloning Vector (gold, Beijing)

XL10-Gold competent cell (Gold, Beijing)

Plasmid DNA Mini Kit (Simgen, Hangzhou)

dNTPs (TaKaRa, Japan)

DL2000Plus DNA Marker (all-round gold, Beijing)

Anhydrous ethanol (Hangzhou Changzhou chemical reagent Co., Ltd.)

(reagent formulation in appendix)

1.3 extraction of genomic DNA

1.3.1 preparation of DNA extraction reagent

1M Tris-HCl (pH 8.0): dissolving 121.1g of Tris in 800mL of double distilled water, adding concentrated hydrochloric acid to adjust the pH value to 8.0, metering to 1000mL, and sterilizing under high pressure.

0.5M EDTA (pH8.0): 800mL of double distilled water was added 186.1g of disodium ethylenediaminetetraacetate (Na)₂EDTA·2H₂O), adjusting the pH value to 8.0, diluting to 1000mL, and autoclaving.

10% SDS: 10g of SDS was dissolved in double distilled water, and the solution was dissolved at 68 ℃ to a constant volume of 100mL, and then sterilized and stored with a 0.2 μm filter.

0.5M NaCl: 5.844g NaCl was dissolved in double distilled water to a volume of 200mL, and autoclaved.

TE buffer (pH8.0) contained 20mM Tris-HCl (pH8.0), 1mM EDTA (pH 8.0): 2mL of 1M Tris-HCl (pH8.0), 0.2mL of 0.5M EDTA (pH8.0), and adding double distilled water to a volume of 100mL, followed by autoclaving.

Proteinase K (20 mg/mL): 100mg of proteinase K was dissolved in 5mL of double distilled water, and the mixture was dispensed into 400. mu.L tubes and stored at-20 ℃.

3M NaAc (pH5.2): 12.305g of anhydrous NaAc is dissolved by adding double distilled water, the volume is adjusted to 50mL, glacial acetic acid is added to adjust the pH value to 5.2, and the mixture is sterilized by high pressure.

PBS：8.0g NaCl，0.2g KCl，3.48g Na₂HPO₄·12H₂O，0.2g KH₂PO₄And (5) fixing the volume to 200mL, and autoclaving.

Tissue DNA extract (STE) formulation:

preparation of Tris saturated phenol

Reagent: phenol 40g, 2-mercaptoethanol 90. mu.L

0.5M EDTA(pH8.0)90μL

0.5M Tris-HCl(pH8.0)60mL

0.1M Tris-HCl(pH8.0)60mL

Taking out solid phenol, standing at room temperature in 65 deg.C water bath to melt, and immediately placing into 68 deg.C water bath to prevent glass from cracking.

40g of phenol was put into a 100mL blue-capped bottle, and 0.04g of 8-hydroxyquinoline and 0.5M Tris-HCl (pH8.0) were added thereto to 80 mL.

After the bottle cap is covered, the bottle is put into a water bath at 65 ℃ to fully dissolve phenol.

Stirring with a stirrer for 10min to mix the solution thoroughly.

Standing for 15min, and discarding the upper water layer.

Then, 0.5M Tris-HCl (pH8.0) was added to the flask, and the procedure of 4)5) was repeated.

Adding 0.1M Tris-HCl (pH8.0) into the bottle, stirring with a stirrer for 10min to mix the solution thoroughly, standing for 15min, and removing water layer.

The above procedure was repeated until the pH of the solution reached 7.8 or more.

To this was added about 10mL of 0.1M Tris-HCl (pH8.0), followed by 90. mu.L of 2-mercaptoethanol, 90. mu.L of 0.5MEDTA (pH 8.0). And (5) uniformly mixing.

Finally, the bottle mouth is wrapped with aluminum foil, the date is recorded, and the bottle is stored at 4 ℃.

1.3.2 extraction of genomic DNA

Extracting peripheral blood genome DNA by phenol/chloroform extraction and combining with a nucleic acid purification column adsorption method. After the EDTA anticoagulated blood sample is unfrozen and mixed evenly, 0.7mL of EDTA is absorbed into a numbered 1.5mL eppendorf tube, the EDTA is centrifuged at 12000rpm for 10min, and the supernatant liquid is removed.

The cells precipitated at the bottom of the eppendorf tube were added with 500. mu.L of PBS (pH7.2) and lysed, and after well mixing, the mixture was centrifuged at 12000rpm for 10min, and the supernatant was discarded. The resuspension and centrifugation were repeated until the resuspended solution was colorless or pink, centrifuged at 12000rpm for 10min, the supernatant was aspirated, and the pellet was resuspended in 200. mu.L of ultrapure water.

mu.L of STE and 20. mu.L (20mg/mL) of proteinase K were added to the same eppendorf tube and mixed well. The water bath was shaken at 55 ℃ for 3h until the solution was digested to clear and transparent. Add 600. mu.L of Tris saturated phenol to the well digested solution with proteinase K, mix well by gentle shaking for 15min, and then centrifuge at 12000rpm for 10 min. The operation is repeated once.

The supernatant was pipetted into a new eppendorf tube, 500. mu.L chloroform was added, mixed well by gentle shaking for 10min, and centrifuged at 12000rpm for 10 min. The operation is repeated once.

The supernatant was pipetted into a new eppendorf tube, 400. mu.L of the nucleic acid binding solution was added, and mixed well. If the solution becomes colorless or pink, a proper amount of acetic acid is added to the solution until the solution becomes yellow.

The nucleic acid purification column was placed on a 2mL collection tube, the lysate and the nucleic acid binding solution were added to the nucleic acid purification column, and centrifuged at 13000rpm for 1 min. Discard the liquid in the collection tube and replace the nucleic acid purification column on the collection tube.

Add 500. mu.L of washing solution to the nucleic acid purification cartridge, centrifuge at 12000rpm for 1min, discard the liquid in the collection tube, and replace the nucleic acid purification cartridge on the collection tube. The operation is repeated once.

The nucleic acid purification column was placed in a new centrifuge tube and dried at room temperature for 5 min. 200. mu.L of double distilled water (pH7.0) or an Elution buffer (pH8.0) was added to the nucleic acid purification column membrane, and after standing at room temperature for 2min, the mixture was centrifuged at 12000rpm for 2min to obtain a purified DNA solution at the bottom of the tube.

1.4 species-specific primer design

The complete sequence of the mitochondrial genomes of ducks (EU009397.1), cows (NC _006853.1), sheep (AF010406.1), chickens (NC _001323.1) and pigs (NC _000845.1) is downloaded from NCBI, after multiple alignment is carried out by DNAMAN 8.0, species specific sequences (the corresponding genes are shown in table 2-1) are obtained, and primers are designed according to the following design principle:

1. the PCR annealing temperatures of the primers among species are consistent, and the amplification product is 200-350 bp;

2. the template has species specificity, and can not generate non-specific amplification under a non-species template;

3. can be commonly used in PCR and RPA.

The primer was synthesized by Hangzhou Zhikexi Biotechnology Limited, as shown in Table 2-1.

TABLE 2-1 primer sequences for detection of animal-derived components

1.5 cloning of target sequence of primer for detecting animal-derived component of species

1.5.1 PCR amplification of sequences of interest

TABLE 2-2 primer PCR reaction System for animal derived component detection

PCR reaction solutions were prepared according to the system shown in Table 2-2. The reaction conditions were set as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃, and storing at 4 ℃.

After the reaction, 10. mu.L of the target PCR amplification product was mixed with 2. mu.L of 6 × Loading Buffer, and the mixture was applied to 1.5% agarose gel and subjected to 200V electrophoresis for 15 min. The electrophoresis was terminated when the bromophenol blue moved 2/3 below the gel. EB staining was performed for 5min, observed under UV lamp, and photographed.

The agarose gel containing the desired fragment was cut with a clean blade under an ultraviolet lamp and placed in a 1.5mL sterile eppendorf tube. Add 500. mu.L Binding Buffer (Qiagen, USA). The eppendorf tube was shaken intermittently at 55 ℃ water bath until the gel mass completely melted (if the solution turned colorless or pink, the appropriate amount of acetic acid was added until the solution turned yellow) and the sol solution was allowed to stand to room temperature.

Placing the adsorption column on a new collecting tube, transferring the sol solution obtained by the above operation into the adsorption column, and standing for 1 min. Centrifuging at 12000rpm for 1-2 min, and discarding the waste liquid in the collecting tube. Adding 500 mu L Binding Buffer into the adsorption column to clean the adsorption column, centrifuging at 12000rpm for 1-2 min, and discarding the waste liquid in the collection tube. This operation is repeated.

The nucleic acid purification column is placed in a 2mL collection tube, the tube is centrifuged for 3min at the maximum speed, and the collection tube is discarded. The adsorption column was placed in a clean eppendorf tube and dried at room temperature for 3 min. Adding 30 μ L of sterilized distilled water (heated to 60 deg.C, and has better elution effect) into the center of the adsorption column membrane, and standing at room temperature for 2 min. Centrifuging at 12000rpm for 2min, and obtaining the purified PCR amplification product at the bottom of the centrifugal tube.

1.5.2 ligation of the desired product

After the PCR amplification products were purified, they were ligated according to the system shown in tables 2-3.

TABLE 2-3 ligation of PCR products of sequences of interest for animal derived components

The ligation product is sucked, beaten and mixed evenly, and then is subjected to instantaneous centrifugation and reaction at 25 ℃ for 10 min. After the ligation reaction was completed, the ligation product was added to 100. mu.L of freshly thawed competent cells, the tube wall was flicked with a finger, mixed well, and incubated on ice for 30 min. Heat shock at 42 deg.c for 90 sec, taking out quickly and setting on ice for 3 min. Then 900 mul LB liquid culture medium without Amp is added into the centrifuge tube, after shaking recovery at 37 ℃ and 270rpm for 1h, the bacterial liquid is centrifuged for 5min at 4000rpm, and 950 mul LB liquid culture medium is removed. And after the bacterial cells are re-rotated, uniformly coating the residual bacterial liquid on an LB solid culture medium containing Amp (100 mu g/mL), after the liquid is completely absorbed, reversely buckling the flat plate in a constant-temperature incubator at 37 ℃ and culturing for 10-14 h until a single bacterial colony appears.

1.5.3 screening and sequencing of the transformation products

A clean and sterile 1.5mL eppendorf tube was taken, 500. mu.L of LB broth containing Amp (100. mu.g/mL) was added to the tube, and a 10. mu.L sterilized tip of a small gun was grasped with forceps to pick up a single colony on the plate, which was placed in the eppendorf tube. Placing the eppendorf tube on a shaker, culturing at 37 ℃ and 270rpm for 10-14 h until the culture medium is turbid.

A25. mu.L reaction system was prepared in a 0.2mL PCR reaction tube. The specific components are shown in tables 2-4.

After the PCR reaction, 5. mu.L of the target PCR amplification product was mixed with 1. mu.L of 6 × Loading Buffer, and the mixture was subjected to 1.5% agarose gel electrophoresis and 200V electrophoresis for 10 min. The electrophoresis was terminated when the bromophenol blue moved 1/2 below the gel. EB staining was performed for 5min, observed under UV lamp, and photographed. Selecting a monoclonal bacterial solution with a single and bright PCR amplification result band and corresponding to the size marked in the table 2-1, sucking 100 mu L of the bacterial solution, placing the bacterial solution in a sterilized eppendorf tube with the volume of 1.5mL, and handing over to the Yongchi Biotechnology Limited company of Hangzhou department for sequencing.

TABLE 2-4 PCR reaction System for detection of conversion products of animal-derived component target sequences

1.5.4 extraction of plasmid DNA of positive clone

A plasmid DNA miniprep kit (Hangzhou Xinjie Biotech, Inc.) was used. 1-5 mL of overnight-cultured bacterial liquid is taken out and centrifuged at 12000rpm for 30s, the liquid culture medium is aspirated and discarded, and the collected thalli are resuspended in 250 μ L of Buffer I (added with RNase A) until the thalli are in a uniform suspension.

Add 250. mu.L of Buffer II and gently and thoroughly invert the tube 4-6 times until the solution is viscous and translucent.

Add 350. mu.L of Buffer III to the tube and gently and thoroughly invert the tube until the upper pale blue solution disappears and a pale yellow flocculent precipitate forms. Centrifuge at 13000rpm for 10 min.

The supernatant was added to the nucleic acid purification cartridge which had been loaded into the collection tube, the cap of the nucleic acid purification cartridge was closed, and centrifuged at 12000rpm for 30 seconds. The filtrate in the collection tube was discarded.

The nucleic acid purification cartridge was returned to the collection tube, and 500. mu.L of Buffer W1 was added to the nucleic acid purification cartridge, which was then capped and centrifuged at 12000rpm for 30 seconds. The filtrate in the collection tube was discarded.

The nucleic acid purification column was returned to the collection tube and centrifuged at maximum speed for 1 min. The collection tube was discarded.

The nucleic acid purification column was placed in a clean 1.5mL eppendorf tube, 50. mu.L of the eluent was added to the center of the purification column membrane, the nucleic acid purification column was capped, allowed to stand at room temperature for 1min, centrifuged at 12000rpm for 30s, and the purification column was discarded. 1.5mLeppendorf tube for purification of plasmid DNA.

Measuring OD of plasmid DNA with ultraviolet spectrophotometer₂₆₀The copy number of the plasmid DNA is calculated according to the formula OD260:1OD ═ 50 mug/mL dsDNA and the molecular weight of the recombinant plasmid corresponding to the amplified fragment of each species of duck, cattle, sheep, chicken and pig.

The obtained plasmid DNA solutions with different copy numbers are frozen at-20 ℃ for standby.

1.65 amplification of RPA primers for detection of animal-derived Components

And performing RPA amplification by using the primers subjected to PCR and clone transfer assay. Using twist Amp^TMBasic (twist Amp, UK) kit, RPA reaction solution was prepared according to the system in tables 2-5. After the reaction solution was prepared, 1.25. mu.L of 280mM MgAc was added to each 0.2mL eppendorf tube₂And mixing the mixture completely. 0.2mL of eppendorf tube was placed on a PCR instrument with a hot lid function and incubated at 37 ℃ for 40 min.

After the RPA reaction is finished, 100 mu L of Tris saturated phenol is added into a 0.2mL eppendorf tube, and the mixture is shaken and mixed evenly. Centrifuge at 12000rpm for 10min at 4 ℃.

mu.L of the supernatant was mixed with 2. mu.L of 6 × Loading Buffer, applied to 1.5% agarose gel, and subjected to 200V electrophoresis for 15 min. The electrophoresis was terminated when the bromophenol blue moved 2/3 below the gel. EB staining for 5min, viewing under UV lamp and taking pictures.

TABLE 2-5 primer RPA reaction System for animal-derived component detection

Minimum detection copy number of 1.75 animal-derived component detection primers

1.5.4 the plasmid DNA solution was diluted by a ten-fold copy dilution method to obtain 10⁷、10⁶、10⁵、10⁴、10³、10²、10¹And 10⁰Plasmid copy number/μ L of DNA solution.

Amplification was carried out according to the PCR reaction system shown in 1.5.3 and the RPA reaction system shown in 1.6, and a negative control (ddH with the same volume) was provided during amplification₂O replaces DNA solution), after the reaction is finished, 10 mu L of amplification product (RPA product needs to be purified) is mixed with 2 mu L of 6 × Loading Buffer, the mixture is loaded on 1.5% agarose gel, electrophoresis is carried out at 200V for 10min, the electrophoresis is finished when bromophenol blue shifts to 1/2 position under the gel, EB staining is carried out for 5min, observation and photographing are carried out under an ultraviolet lamp, and the lowest detection copy number of the primer is determined according to the existence of the amplification band.

1.8 human body surface temperature RPA reaction

As the reaction temperature of the RPA is 37 ℃, the possibility of detecting animal-derived components by the RPA by using the body temperature of a human body is explored. Using 2 ng/. mu.L Hu sheep genomic DNA as a template, a reaction solution was prepared in accordance with the RPA reaction system shown in 1.6. After the reaction solution was prepared, 0.2mL eppendorf tube was attached to the abdomen of the examinee with an adhesive tape, and the RPA reaction was carried out using the human body temperature for 1 hour. After the reaction was completed, detection was performed in the manner of 1.6.

2 results and analysis

2.15 screening of primers for detecting animal origin components

Primers for detecting animal-derived components of 5 species were designed and synthesized according to the principle of 1.4, and PCR amplification was performed using genomic DNA solutions of the 5 species as templates, and the reaction results are shown in FIGS. 1 to 5. The amplification product only has an amplification band in a target detection species, the size of the product is consistent with that in the table 2-1, the band is single and bright, and the species specificity is good.

After obtaining species-specific animal-derived PCR detection primers, carrying out amplification in an RPA system, and determining whether the primers can be used in the RPA amplification system. Because the RPA has no steps of denaturation and annealing in the PCR process, the RPA amplification product may exist in the amplification system in a tandem manner, which is shown by the existence of the amplification product and the amplification product with 2 times or even 3 times of length. Such a product may be considered a single product. The results of the RPA detection of the above 5 pairs of primers show (FIGS. 6-10) that the amplification product only shows an amplification band in the target detection species, and the size of the product is consistent with that in Table 2-1, and sometimes 2 times or even 3 times of the length of the product appears at the same time. The bands are bright and have good species specificity.

2.2 sensitivity of primers for PCR and RPA amplification

At 10⁷、10⁶、10⁵、10⁴、10³、10²、10¹、10⁰After the reaction is finished, 10 mu L of amplification product (RPA product needs to be purified) is mixed with 2 mu L of 6 × Loading Buffer, the mixture is loaded on 1.5% agarose gel and subjected to 200V electrophoresis for 10min, and the lowest detection copy number of the primer is determined according to the existence of an amplification band under an ultraviolet lamp after EB staining.

When the duck source component detection primer is used for PCR amplification, the template concentration is 10¹At copy number, the amplified band was very weak or no amplified band was visible (FIG. 11); when RPA amplification is performed, the template concentration is 10⁰At several copies, no amplified band was visible (FIG. 12).

When the bovine-derived component detection primer is used for PCR amplification, the template concentration is 10²At the time of single copy number, the amplified band was extremely weak, and the template concentration was 10¹And 10⁰At copy number, no amplified band was visible (FIG. 13); when RPA amplification is performed, template concentration is as low as 10⁰At several copies, amplified bands were still visible (FIG. 14).

When the sheep-derived component detection primer is used for PCR amplification, the template concentration is 10²Number of copiesIn time, the amplified band was extremely weak with a template concentration of 10¹And 10⁰At copy number, no amplified band was visible (FIG. 15); when RPA amplification is performed, template concentration is as low as 10¹At the time of copy number, a weak amplification band still exists, and the template concentration is 10⁰At each copy number, no amplified band was visible (FIG. 16).

When the chicken-derived component detection primer is used for PCR amplification, the template concentration is 10²At the time of single copy number, the amplified band was extremely weak, and the template concentration was 10¹And 10⁰At copy number, no amplified band was visible (FIG. 17); the template concentration was 10 when RPA amplification was performed²At the time of single copy number, the amplified band was extremely weak, and the template concentration was 10¹And 10⁰At several copies, no amplified band was visible (FIG. 18).

When the pig-derived component detection primer is used for PCR amplification, the template concentration is 10³、10²At the time of single copy number, the amplified band was extremely weak, and the template concentration was 10¹And 10⁰At copy number, no amplified band was visible (FIG. 19); when RPA amplification is performed, template concentration is as low as 10²At the time of copy number, a weak amplification band still exists, and the template concentration is 10¹And 10⁰At several copies, no amplified band was visible (FIG. 20).

The sensitivity test of 5 kinds of animal source component detecting primers shows that the sensitivity of each kind of primers in PCR reaction can reach 10²(ii) level of individuals; the detection sensitivity of the specific primers of pig and chicken in RPA is 10²The detection sensitivity of the specific primers of duck and sheep is 10¹The detection sensitivity of the bovine-derived specific primer can reach 10⁰And (4) respectively. From the above results, it was found that the detection sensitivity of the chicken and pig origin component detection primers RPA was the same as the detection level of PCR, and that the detection sensitivity of the other 3 animal origin component detection primers were superior to the detection sensitivity of PCR.

2.3 carrying out the RPA reaction at the body surface temperature

Selecting a sheep specific primer, taking mutton genome DNA as a template, uniformly mixing an RPA reaction system in a 0.2mL eppendorf tube, adhering the eppendorf tube to the abdomen of a tester, reacting for 1h, extracting with Tris saturated phenol, and performing agarose gel electrophoresis to generate a target fragment of a sheep with the size of 349bp (figure 21). Test results show that the RPA reaction can be carried out by utilizing the body surface temperature of a human body.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> method for detecting components of cattle, sheep, chicken, duck and pork by PCR and RPA amplification modes, primer group and kit

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cctagtcctc agtctcgcat 20

<210>2

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

cttgtaggac ttctgggaat c 21

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gattcagtgc atctaaccct 20

<210>4

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccttgcggta ctttctctat 20

<210>5

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcagggttca ttatctctaa taa 23

<210>6

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggcttgtgat tgtggtggat at 22

<210>7

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

taccatgttc taacccattt gg 22

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

agttcaggag ttatgcatgg 20

<210>9

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cacgcgcata taagcaggta a 21

<210>10

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cagattgtgg gcgtatact 19

Claims (4)

1. A primer group simultaneously suitable for detecting components of cattle, sheep, chicken, duck and pork in a PCR and RPA amplification mode has the following sequences:

duck:

YA-F:CCTAGTCCTCAGTCTCGCAT

YA-R:CTTGTAGGACTTCTGGGAATC；

cattle:

NIU-F:GATTCAGTGCATCTAACCCT

NIU-R:CCTTGCGGTACTTTCTCTAT；

sheep:

YANG-F:GCAGGGTTCATTATCTCTAATAA

YANG-R:GGCTTGTGATTGTGGTGGATAT；

chicken:

JI-F:TACCATGTTCTAACCCATTTGG

JI-R:AGTTCAGGAGTTATGCATGG；

a pig:

ZHU-F:CACGCGCATATAAGCAGGTAA

ZHU-R:CAGATTGTGGGCGTATACT。

2. a kit for detecting components of cattle, sheep, chickens, ducks and pork simultaneously suitable for PCR and RPA amplification modes, which is characterized by comprising the primer group of claim 1.

3, a method for detecting components of cattle, sheep, chicken, duck and pork by a PCR amplification mode, which is characterized by comprising the following steps:

1) extracting genomic DNA according to the operation method of the animal tissue genomic DNA extraction kit, or obtaining DNA from a tissue sample by a DNA extraction method of reference molecule cloning, and dissolving the DNA in TE solution or pure water for storage;

2) preparing PCR reaction solutions according to the following system using the primer sets according to claim 1, respectively;

3) the PCR conditions were set as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extending for 10min at 72 ℃, and storing at 4 ℃;

4) after the reaction is finished, 10 mu L of target PCR amplification product is mixed with 2 mu L of 6 XLoading Buffer, and the mixture is loaded on 1.5% agarose gel and subjected to 200V electrophoresis for 15 min; ending the electrophoresis when the bromophenol blue moves to 2/3 below the gel; EB staining for 5min, observing under ultraviolet lamp, and taking a picture; the lengths of the amplified fragments of the duck, the cattle, the sheep, the chicken and the pig are 338bp, 292bp, 349bp, 208bp and 324 bp.

A method for detecting components of cattle, sheep, chicken, duck and pork by an RPA amplification mode, which is characterized by comprising the following steps

The method comprises the following steps:

1) extracting genomic DNA according to the method of the kit for extracting genomic DNA from animal tissue, or extracting reference molecule

The DNA extraction method of the clone, obtain DNA from tissue sample, dissolve in TE solution or pure water and keep for subsequent use;

2) preparing an RPA reaction solution by using the primer set of claim 1 and a twist AmptM Basic kit according to the following system;

3) after the reaction solution was prepared, 1.25. mu.L of 280mM MgAc was added to each 0.2mL eppendorf tube₂Fully and uniformly mixing; placing 0.2mL of eppendorf tube on a PCR instrument with a hot cover function, and preserving the temperature for 40min at 37 ℃;

4) after the RPA reaction is finished, adding 100 mu L of Tris saturated phenol into a 0.2mL eppendorf tube, and shaking and uniformly mixing; centrifuging at 12000rpm for 10min at 4 deg.C;

5) mixing 10 μ L of supernatant with 2 μ L of 6 × Loading Buffer, Loading on 1.5% agarose gel, and performing 200V electrophoresis for 15 min; ending the electrophoresis when the bromophenol blue moves to 2/3 below the gel; EB staining for 5min, observing under an ultraviolet lamp and taking a picture; the lengths of the amplified fragments of the duck, the cattle, the sheep, the chicken and the pig are 338bp, 292bp, 349bp, 208bp and 324 bp.

Images