CN108486124A - Jiaxing Black Pig TFAM gene expression characteristics sequence, primer and detection kit - Google Patents

Abstract

The present invention relates to Jiaxing Black Pig TFAM gene expression characteristics sequence and specificity amplification primers, and the detection kit for Jiaxing Black Pig meat correlated traits including TFAM gene expression characteristics sequence and specificity amplification primer.The present invention has inquired into the association analysis of TFAM gene expression amounts and Jiaxing Black Pig Meat Quality and carcass trait; Jiaxing Black Pig Genes Affecting Meat Quality Genetic Mechanisms are explored from molecular level; meat, protection Jiaxing Black Pig germ plasm resource and utilization to improve Native Pig provide corresponding theoretical foundation, are of great significance to improveing and improving the reproductive capacity of low-yield variety and improve meat.

Description

Jiaxing Black Pig TFAM gene expression characteristics sequence, primer and detection kit

(1) technical field

The present invention relates to Jiaxing Black Pig TFAM gene expression characteristics sequence and specificity amplification primers, and including TFAM genes The detection kit for Jiaxing Black Pig meat correlated traits of characteristic sequence and specificity amplification primer.

(2) background technology

Jiaxing Black Pig is the excellent local varieties in China, through very long acclimatization and producing region peasant household long-term breeding, shape Good characteristic high, with good meat quality at reproductive capacity, resistance is strong, hybridization coordinate force is good, the especially high characteristic of reproductive capacity are generation People is attracted attention, and is the pig resources of China's preciousness.

But for China's local pig breed since the speed of growth is slow, the rate of animals delivered to the slaughter-house is low, and dressing percentage is low, lean meat percentage is low, feed conversion rate is low The deficiencies of, the industrialized development of pig breeding industry is not adapted to, be cannot be satisfied the market demand growing to thin pork yet, is led to group The continuous atrophy of body scale (Liu Yingying etc., 2015).20th century pig breeding practice have shown that, the too fast speed of growth and excessively high thin Meat rate results in the reduction of the decline and individual viability of meat quality.Modern pig breeding direction, which thus turns to, stresses quality pigs training It educates, and is inclined to and utilizes local black pig kind.Also it is more preferable to meet market to meat quality high quality, multiple demands The famous excellent local pig breed Jiaxing Black Pig in ground protection and developmental utilization Zhejiang Province, it is necessary to carry out the cultivation of high-quality black pig breed system.

Berkshire is the most ancient cultivation pig kind of Britain, and the history and the pure breeding in more than 200 years for having for more than 300 years so far are recorded Record.Since Berkshire meat is excellent, snowflake lean meat is abounded with, Japan is thereby bred as Kagoshima Cavia porcllus.Especially Berkshire Crop snowflake meat advantage significantly makes it be occupied an important position in the kind pattern that the world raises pigs (Zhang Weili etc., 2008).With Improvement of living standard, increase of the people to superfine product pork consumption figure, demand international, on domestic market to the black pork of superfine product Increasingly increase, Berkshire has been bobbed up like a cork after depression half a century.Therefore, Berkshire is set to high-quality black pig to match The maternal male parent varieties of set system carry out specialized selection and breeding, and exploitation Jiaxing Black Pig is that maternal breed system has important practical significance With wide exploitation prospect (Zhang Weili etc., 2010).While pursuing quantity, the Meat Quality of breeding species is improved It is always one of the target of breed breeding with carcass characteristic, and can be increasingly taken seriously.

Up to now, the molecule mechanism influence about the Meat Quality and carcass trait of Jiaxing Black Pig and its cross combination is ground Study carefully report it is less, the effect of especially TFAM gene pairs Jiaxing Black Pig Meat Quality and carcass trait has not been reported.

Mitochondrial transcription factor A (mitochondrial transcription factor A, TFAM) is core interior coding High mobility albumen, synthesize in cytoplasm, then combined with HSP60-70 complexs, and then participate in mitochondrial DNA Transcriptional activation and adjust mitochondrial DNA copy number (Fisher et al., 1988, Kanki T et al., 2004, Gaspari M et al., 2004).Additionally the stability to mitochondria biological function and mitochondrial DNA and integrality and The expression of sarcoplasmic reticulum calcium atpase plays an important role (Yao Pengcheng etc., 2011, Song Yinjuan etc., 2017), missing or excessive table Up to can all influence mitochondrial genomes stability, and then cell growth is had an impact (Campbell C T et al., 2012)。

TFAM is the energy workshop of organism, the mitochondrial disease important regulating and controlling factor and meat flavor regulatory factor, Play irreplaceable role in body.In recent years, many scholars are in research TFAM gene pairs mankind's relevant diseases Influencing mechanism.Because the biological function by TFAM genes is more, certain economic characters of animal can be also influenced, so TFAM bases Because the research on the line balancing rate of animal is also increasing.

Marble grain is the important intuitive index for identifying pork quality, and lines will have a direct impact on containing for intramuscular fat Amount, the content of intramuscular fat have significant impact to the flavor and taste of meat, which is carried out by more and more people now It studies and is taken seriously.What fat was mainly built in mitochondria, there is indivisible pass with the biological function of mitochondria System (Wilson-Fritch L et al., 2004), if aliphatic acid beta oxidation process occurs mainly in mitochondria, passes through activation Pyruvate carboxylase provides intermediary for the synthesis of triglycerides.In addition, the esterification in tricarboxylic acid cycle needs line grain Body generates acetyl coenzyme A (acetyl-CoA), to activate aliphatic acid.

Found in the research of ox TFAM, fatty conjugated protein 4 (fatty acid binding protein 4, FABP4) and 3 core interior coding chondriogens such as mitochondria polymerase A (mitochondrial polymerase A) with it is big Significant difference between reason stone line (Jiang Z et al., 2009).Therefore TFAM genetic mutations may influence intramuscular fat metabolism A series of and biologicallies in downstream.Jiang etc. screens two SNP sites in the gene promoter areas TFAM of ox, passes through base Because of parting, show that two SNP sites and marble grain and subcutaneous fat deposits are significantly correlated, also cause and fat deposition and energy It is metabolized related Binding site for transcription factor to change, it was confirmed that mitochondria transcriptional machinery influences deposition (the Jiang Z of muscle fat Et al., 2010).The change of TFAM gene locis is to catalo carcass trait such as tenderness, high-quality beef ratio and separates Beef fat rate suffers from and significantly affects (Kaplanova K et al., 2010).Xie Hai by force it is equal by comparing the numb sheep in Guizhou Province north and The gene frequency of the G1099C polymorphic sites in two kinds of Guizhou White Goat in TFAM gene Second Exons, hair Now the site influences the Meat Qualities such as the intramuscular fat deposition of the two kinds (Xie Hai strong etc., 2013).

As seen from the above, the Meat Quality of TFAM gene pairs domestic animal has important influence.Currently, about pork quality The research of related gene is concentrated mainly on GH, IGF, MSTN etc., and the report about TFAM genes has no.

TFAM genes are the indispensable constituents of mitochondrial genomes transcription, participate in the aliphatic acid generation in body It thanks, also contributes to certain economic characters of biology.The main research of TFAM genes concentrates on people and mouse, and to the TFAM of pig The research report of gene is few, it is often more important that influencing mechanism of the main research TFAM genes in certain diseases, to Meat The research of the influence of character is not yet.

(3) invention content

It is an object of the present invention to provide Jiaxing Black Pig TFAM gene expression characteristics sequence and specificity amplification primers, inquire into TFAM genes The association analysis of expression quantity and Jiaxing Black Pig Meat Quality and carcass trait explores Jiaxing Black Pig Meat Quality phase from molecular level Correlation gene Genetic Mechanisms, meat, protection Jiaxing Black Pig germ plasm resource and utilization to improve Native Pig provide corresponding Theoretical foundation is of great significance to improveing and improving the reproductive capacity of low-yield variety and improve meat.

The technical solution adopted by the present invention is：

Jiaxing Black Pig TFAM gene expression characteristics sequences, nucleotide sequence is as shown in SEQ ID No.1.

SEQ ID No.1 sequences are as follows：

5’-CATGCGCTCGGGAGCTGCACAAGATTGGGGCCTGGTCAGTGCTTTGTCTACGGGTGCAATGGCGCT TCTCCGGGGCGTGTGGGGCGTGCTGAGTGCCCTGGGAAAGTCAGGAGCGGACCTCTGTGCGGTTTGTGGAAGTCGAC TGCGCTCTCCGTTCAGTTTTGCGTATGTACCAAGATGGTTTTCATCCACCCTGAGTGGTTTTCCAAAGAAGCCTATG ACTTCATACGTTCGATTTTCTAAAGAACAGCTACCCATATTTAAAGCTCAGAACCCAGATGCAAAAAATTCAGAACT AATTAAAAAAATTGCTGAGCTGTGGAGGGAACTTCCTGATTCAGAGAAAAAGATATATGAAGATGCTTATAGGGCAG ACTGGCAGGTGTACAAAGAAGAGGTAAACAGAATTCAAGAACAGCTAACTCCAAGTCAAATGGTATCTTTGGAAAAA GAAATCATGCAGAAACGTTTAAAAAAGAAAGCGTTAATCAAAAAGAGAGAATTAACAATGCTTGGAAAACCAAAAAG ACCTCGATCAGCTTATAACATTTTTATTGCTGAACGCTTTCAGGAAGCTAAGGATGGTCCATCACAGGTAAAGCTGA AAACTATAAATGAAAACTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATTCAACTTGCTGAAGATGATAAA GTTCGTTATTATAATGAAATGAAATCTTGGGAAGAACAAATGGTTGAAGTTGGGCGAAACGATCTTATACGTCGCTC AATGAAACATTCAGCAAAGAAAGACACTGAGGAGTGTTGAAATAGAAGGTTGAGCTATGTTCGTATGGTACCCCCCA AAAAAAACACAATTTATAAAAAAAACCCCCCAAAAACAAACCATCCAAAAAAAAAACTTCCCCACCATATTATATTT CCAAAAATAAAATTTTTATAAAAACCAATA-3’；

The present invention clones the coding region sequence of Jiaxing Black Pig TFAM genes, carries out biological information analysis, for deeply The biological function and mechanism of action for solving TFAM genes have great meaning.

The invention further relates to the specificity amplification primer of Jiaxing Black Pig TFAM genes, primer sequence is as follows：

Sense primer：5’-TTGCGAGTTCAAGTCGTCAT-3’；

Downstream primer：5’-GGTTTCTCGTGTCTATCCAT-3’.

The invention further relates to a kind of Jiaxing Black Pig meat correlated traits detection kits, include mainly Jiaxing Black Pig TFAM bases Because of characteristic sequence, the specificity amplification primer and PCR reaction reagents of Jiaxing Black Pig TFAM genes；

The nucleotide sequence of the Jiaxing Black Pig TFAM gene expression characteristics sequences is as shown in SEQ ID No.1, the specificity Amplimer sequence is as follows：

Sense primer：5’-TTGCGAGTTCAAGTCGTCAT-3’；

Downstream primer：5’-GGTTTCTCGTGTCTATCCAT-3’.

The invention further relates to application of the kit in Jiaxing Black Pig breeding.The present invention is filtered out to improving pork The advantageous molecular labeling of matter can be to improve meat quality, accelerate breeding selection and breeding and provide reference frame.

The present invention inquires into the regulatory mechanism of crucial chondriogen TFAM gene pairs Jiaxing Black Pig fat metabolisms, to sieve from now on It selects and provides theoretical foundation to the advantageous molecular labeling of Jiaxing Black Pig meat or candidate gene, to improving Jiaxing Black Pig meat, adding Fast kind and mating system selective breeding further develop its blastogenesis potential and are all of great significance.

(4) it illustrates

Fig. 1 is the electrophoresis detection collection of illustrative plates of the tissue samples total serum IgE of extraction；

Fig. 2 is the RT-PCR products of agar sugar detection TFAM genes；

Fig. 3 is Jiaxing Black Pig TFAM Gene Partial sequence figures；

Fig. 4 is Jiaxing Black Pig TFAM nucleotide and amino acid sequence；

Fig. 5 is TFAM albumen Tertiary structure predictions；

Fig. 6 is the fluorescent quantitation amplification of TFAM genes；

Fig. 7 is the fluorescent quantitation solubility curve of TFAM genes；

Fig. 8 is expression of the Jiaxing Black Pig TFAM genes in different tissues.

(5) specific implementation mode

With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This：

Embodiment 1：

1.1 materials and methods

1.1.1 experiment material

1.1.1.1 experimental animal

The Jiaxing Black Pig 1 for choosing 72kg or so health, is provided by Zhejiang Qinglian Food Co., Ltd..It is taken after butchering Its liver, be placed in cryopreservation tube in launching into liquid nitrogen container carry out it is quick-frozen, after returning to laboratory, from liquid nitrogen container take out be placed in -80 It is preserved in DEG C refrigerator, it is spare as test specimen.

1.1.1.2 key instrument and reagent

1.1.1.2.1 key instrument

1.1.1.2.2 main agents

Trizol A⁺The small extraction reagent kit of reagent, plasmid (No.DP103), DH5 α competent cells (No.CB101), DL2000Marker DL1000Marker are purchased from TIANGEN Biotech (Beijing) Co., Ltd.；Prime Script RT reagent Kit with gDNA Eraser(No.DRR037A)、EX Taq(No.DR001A)、Gel Extraction Kit (plastic recovery kit) is purchased from precious bioengineering (Dalian) Co., Ltd.Tris alkali, yeast extract, agar powder, tryptose Peptone, IPTG (Isopropyl β-D-1-Thiogalactopyranoside) isopropyl-β-D-thiogalactoside, X-Ga (5- Bromo-4-chloro-3-indolyl β-D-galactopyranoside) the chloro- 3- indoles-β-D galactosides of the bromo- 4- of 5-, Amp (Ampicillin) ampicillin is all from laboratory.Specific primer, carrier universal primer and pMD19-T Simple Vector carriers are provided by Hangzhou Qing Ke Zi Xi Bioisystech Co., Ltd, deionized water dissolving, -20 DEG C of preservations.

1.1.1.2.3 the preparation of reagent

1) LB solid mediums (prepare and calculate by 1L volumes)

Preparation method：After load weighted solute is dissolved in 960mL ultra-pure waters, about 900 μ L 5mol/L NaOH tune are added PH to 7.2 is saved, 1000mL is settled to, high pressure sterilization 1.5h is cooled to 60 DEG C, and 1.0 μ L100mg/mL are added per mL culture mediums Kan store liquid to final concentration of 100 μ g/mL, cross shakes up culture medium, takes the glass culture dish that high pressure sterilization is good, each The paved tablet of appropriate culture medium is added in culture dish, room temperature cooling is spare.

2) LB liquid medium (prepare and calculate by 1L volumes)

Material:The special tryptone 10g of germ experiment

Germ experiment special yeast extract 5g

The special NaCl 10g of germ experiment

Preparation method：After load weighted solute is dissolved in 960mL ultra-pure waters, about 700 μ L 5mol/L NaOH tune are added PH to 7.2 is saved, is settled to 1000mL, high pressure sterilization 1.5h, 4 DEG C save backup.

3) 50 × TAE buffers mother liquor formula (prepare and calculate by 1L volumes)

Material：Tris 242g

Na2EDTA ﹒ 2H2O 37.2g

CH3COOH 57.1mL

Preparation method：Load weighted solute is dissolved in 600mL ultra-pure waters, after stirring and dissolving, is settled to 1000mL, room temperature preservation are spare.

1 × TAE working solutions are prepared：It takes the above-mentioned 50 × TAE mother liquors of 20mL, 980mL deionized waters is added, you can obtain 1 × TAE working buffer solutions.

4)1mol/L CaCl2:It weighs 14.7g CaCl22H2O to be dissolved in enough water, is settled to 100mL, high pressure is gone out Bacterium 20min, 4 DEG C save backup.Common 0.1mol/L CaCl2 solution.

5) contain the 0.1mol/L CaCl2 solution of 15% glycerine：15mL pure glycerins are added in 10mL 1mol/L CaCl2, Water is added to be settled to 100mL, high pressure sterilization 20min, 4 DEG C save backup.

6) 75% alcohol：The absolute alcohol for taking 75mL 100% adds water to be settled to 100mL, and 4 DEG C save backup.

7) 1% Ago-Gel：It weighs 0.2g agaroses to be dissolved in 20mL1 × TAE electrophoretic buffers, with microwave stove heat 1 minute or so to dissolving completely, put be cooled on the table be placed on the back of the hand it is not hot until, 1 microlitre of nucleic acid dye is then added, It pours into the small electrophoresis tank with comb, is about placed on desk 20 minutes or so after mixing.

1.1.2 method

1.1.2.1 design of primers

Primer is synthesized by Hangzhou Qing Ke Zi Xi Bioisystech Co., Ltd.Primer sequence information is shown in Table 1：

Table 1：TFAM gene cDNA clone primers

1.1.3 the extraction and detection of total serum IgE

1.1.3.1 the extraction of total serum IgE

The total serum IgE of Jiaxing Black Pig liver organization is extracted using Trizol reagents, concrete operations are as follows：

(1) freezing tissue of liver is taken out from -80 DEG C of refrigerator, the sample of clip about 50-100mg or so is added To having steel ball and being added in the 1.5ml centrifuge tubes of 1mL Trizol, put it into beveller (frequency 70HZ, time 120s) 5min is stood after grinding on superclean bench, it is made fully to crack；

(2) centrifuge tube with abundant lysate sample is put into centrifuge, is centrifuged in the case where 4 DEG C of 12000rpm Then 10min takes supernatant in another new centrifuge tube, is precipitated and discarded, make the impurity such as cell membrane, organelle film in this way All outwell；

(3) chloroform of 0.2ml is added into centrifuge tube again, 15min is stood after mixing on whirlpool mixed instrument；

(4) 15min is centrifuged in the case where 4 DEG C of 12000rpm, is inhaled in upper strata aqueous phase to another centrifuge tube；

(5) isopropanol of about 0.5ml is added, is placed at room temperature for 10min after mixing, is then centrifuged in the case where 4 DEG C of 12000rpm 10min discards supernatant, can be appreciated that gluey RNA precipitate in the bottom of pipe；

(6) 75% ethyl alcohol 1ml being pre-chilled at 4 DEG C is added, it is mild to vibrate or repeatedly blown and beaten with liquid-transfering gun, to make precipitation Suspended state is presented, centrifuge tube is centrifuged into 10min at 8000rpm4 DEG C, abandons supernatant；

(7) 5-10min is dried or be dried in vacuo at room temperature, makes sure to keep in mind excessively to dry；

(8) RNA sample, 55~60 DEG C of 5~10min of water-bath are dissolved with 50 μ L ddH2O；

(9) OD values are surveyed and quantify RNA concentration and the quality of detected through gel electrophoresis RNA.

1.1.3.2 the quality testing of total serum IgE

The quality testing of total serum IgE：The RNA for taking 10 μ L or so, after 1% agarose gel electrophoresis, if can see that Clearly three bands of RNA are 28S, 18S, 5S respectively since Jiao Kongchu, and the brightness of wherein 28S bands is about the 2 of 18S Times, 5S bands are most weak, show that the RNA mass of extraction is preferable, can be used for follow-up test.Then there is integrality to what is do not degraded Total serum IgE carry out OD260/OD280 values and concentration measurement.About 2 μ L of total serum IgE are taken, are measured in nucleic acid-protein analyzer The value and concentration of A260 and A280, OD260/OD280 values indicate that quality is preferable, meets reverse transcription to total serum IgE between 1.8-2.0 Concentration requirement.

1.1.4 reverse transcription reaction

Reverse transcription reaction is to use RNA as template, and cDNA is synthesized under the action of reverse transcriptase.

1) removal genomic DNA reaction

Reaction mixture is prepared on ice is eventually adding RNA sample in packing to each reaction tube.

After 42 DEG C of water-bath 2min, 4 DEG C of preservations.

2) reverse transcription reaction

Reaction mixture is prepared on ice, is dispensed to each reaction tube of above-mentioned 10 μ L, is gently inverted immediately after mixing Record reaction.

37 DEG C of water-bath 15min, then 85 DEG C of metal bath 5s, last 4 DEG C of preservations.

1.1.5PCR reaction

Using cDNA as template, PCR reactions are carried out with designed primer, complete amplification.

(1) reaction system

(2) reaction condition

3 μ L PCR products are taken to carry out electrophoresis detection with 1% agar gel after amplification, if occurring mesh in electrophoresis result Band, carry out sample presentation sequencing, determine best annealing temperature.Then it with best 54 DEG C of progress PCR amplifications of annealing temperature, obtains To required target fragment.

1.1.6 the purifying and recycling of PCR product

Kit for PCR product recycling is Gel Extraction Kit, and operating procedure is as follows：

(1) under 150V voltages, PCR product is placed on to electrophoresis about 30min in 1% agar gel；

(2) agar block containing purpose band is cut, is shredded, is put into the centrifuge tube of 1.5ml；

(3) lysate Buffer GM are added into blob of viscose, dosage is as follows：

(4) blob of viscose is dissolved at 37 DEG C after evenly mixing, carries out reverse mixing every few minutes；

(5) after blob of viscose is completely dissolved, the color that blob of viscose can be observed is yellow；

(6) dissolved blob of viscose liquid being moved on in the adsorption column being placed on collecting pipe, 12000rpm centrifuges 1min, and Discard the liquid in collecting pipe；

(7) Buffer WB, 12000rpm the centrifugation 1min of 700 μ L are added in adsorption column, discard the liquid in collecting pipe Body；

(8) step 7 is repeated；

(9) the empty collecting pipe that will have adsorption column, room temperature 12000rpm centrifuge 1min；

(10) centrifuge tube of one one clean 1.5ml of knife of adsorption column is stood into 30min, then in adsorption column film 30 μ LddH are added at centre₂O；

(11) 12000rpm centrifuges 1min eluted dnas；

(12) and then concentration is surveyed, runs glue and is confirmed whether purposeful segment.

1.1.7 RT-PCR product clonings

1.1.7.1 the connection of target gene and carrier

Here is the system that pMD19-T Simple Vector are connect with the PCR product after recycling, it is to be noted that by carrying Body is melted on ice.

It is incubated overnight at 16 DEG C after mixing.

1.1.7.2 the conversion of attachment

(1) it is added 100 μ L DH5 α competent cells in full dose (10 μ L) attachment, placed in ice after mixing 30min。

At (2) 42 DEG C after heat shock 90s, 5min is placed in ice immediately.

(3) LB liquid medium of 890 μ L preheatings, 37 DEG C of shaken cultivation 60min are added.

(4) 200 μ L bacterium solutions are drawn, are uniformly applied on the LB Agar Platings containing X-Gal, IPTG, Amp with pearl is applied It smears, is incubated at room temperature about 30min, 37 DEG C of inversions are incubated overnight.

(5) second days observation bacterium colony growing states, are then screened with blue hickie, and blue is feminine gender, and white is the positive, is selected White single bacterium colony, is verified.

1.1.7.3 the identification of recombinant plasmid

Bacterium solution PCR identifications：It chooses white colony to be inoculated in Amp/LB fluid nutrient mediums, carries out shaking bacterium at 37 DEG C and train overnight It supports.Using 0.5 μ L bacterium solutions as template, PCR amplification is carried out.

Reaction system is as follows：

Then the same 2.2.4 of reaction condition (2) take 3 μ L reactants to carry out 1% agarose gel electrophoresis identification.

1.1.7.4 sequencing

The bacterium solution that PCR reactions rear electrophoresis result shows purpose band is selected to send to the limited public affairs of the prosperous biotechnology in the Hangzhou Chinese catalpas Qing Ke Department's sequencing.

1.2 results and analysis

1.2.1 the result of Total RNAs extraction

Fig. 1 is the electrophoresis detection collection of illustrative plates of the tissue samples total serum IgE of extraction, therefrom it can be seen that there is apparent 3 bands, from The brightness of top to bottm 28S bands is approximately 2 times of 18S bands, and 5S bands are most weak, illustrates that total serum IgE has very in tissue sample Good integrality, quality is preferable, less degradation.

According to nucleic acid-protein detector reality the result shows that, the value of the OD260/OD280 of the total serum IgE of extraction is in 1.80- Between 1.95, meet 1.8<OD260/OD280<2.0 requirement illustrates that RNA is not polluted by albumen or chemical reagent, can be with For subsequent experiment.

1.2.2 the PCR amplification of cDNA

Using cDNA as template, RT-PCR amplifications are carried out with specific primer, are then carried out with 1% agarose gel electrophoresis Detection.Fig. 2 is the length that TFAM gene RT-PCR products are 943bp, is consistent with expected length.

1.2.3 the sequencing result of target fragment

The cDNA sequence sequencer map of Jiaxing Black Pig TFAM, TFB2M gene, Fig. 3 TFAM, TFB2M genes are obtained after sequencing Part sequencing result figure.

1.2.4 the sequence analysis of TFAM genes

1.2.4.1 the cDNA sequence analysis of Jiaxing Black Pig TFAM genes

Successful amplification goes out target fragment 943bp, and Jiaxing Black Pig TFAM bases are analyzed using the ORF Finder programs on NCBI Because of sequence, the areas CDS that length is 741bp are obtained, 246 amino acid (Fig. 4) are encoded.

1.2.4.2 Jiaxing Black Pig TFAM analysis of physical and chemical property

It is obtained by online software ExPASy ProtParam analyses：Jiaxing Black Pig TFAM albumen contains 20 kinds of amino acid, Wherein Lys proportions are up to 12.2%, His ratios minimum 0.4%.TFAM protein molecular formulas are C₁₂₈₁H₂₀₅₁N₃₅₇O₃₇₀S₁₁, molecular weight 28726.21, theoretical iso-electric point is 9.62.Unstability index value is 46.20, external to feed Half-life period is 30h in newborn animal granulophilocyte, and fat coefficient 74.15, average hydrophobicity coefficient is -0.746.

TFAM albumen hydrophobicitys are analyzed through ProtScale programs, TFAM encodes albumen hydrophobicity in the 165th amino acid position There is maximum value 3.933, has minimum value -4.100 in the 172nd amino acid position.The cross-film knot of TFAM albumen is predicted by TMHMM Structure finds that transmembrane helix structure is not present in TFAM amino acid sequences.Gained after II Prediction of PSORT analyses as shown in Table 2 The subcellular localization of the TFAM arrived.Through 3.1 forecast analysis of NetPhos, TFAM albumen has 20 Ser, and 3 Thr, 5 Tyr can It can be potential phosphorylation site.By conserved structure domain analysis, finding TFAM, there are two HMG (high mobility group Protein, HMG) structural domain position in 49-119 and 154-220 amino acid residues, deposits before first structural domain respectively The sequence for having one section of low complex degree among a signal peptide, the two, in 136-147 amino acid residue positions.HMG albumen has Play the role of adjusting biological function in core, also there is adjustment effect, and HMG albumen tune to the duplication of DNA, reparation and recombination The expression transcription of control gene has confirmed TFAM and has played a significant role in the transcription of mitochondrial DNA.

Table 2：The subcellular localization of TFAM

1.2.4.3 Jiaxing Black Pig TFAM two levels and Tertiary structure predictions analysis

With online software SOPMA software predictions TFAM Protein secondary structures, the ratio shared by display alpha-helix (h) is 52.03%, totally 128；Extended chain (e) accounts for 14.23%, totally 35；β-corner (t) accounts for 10.98%, totally 27；Random volume Bent (c) has 56, accounts for 22.76%.

The tertiary structure model prediction result of TFAM protein is as shown in figure 5, α spirals and random coil constitute TFAM eggs The tertiary structure of white matter, the result are consistent with secondary protein structure.

1.3 discussing

1.3.1 the sequence analysis of Jiaxing Black Pig TFAM genes

Currently, TFAM genes are cloned in the species such as goat, sheep, people, mouse, rat successively, it is especially right Relatively deep functional study is carried out in people, goat and mouse, the present invention has cloned Jiaxing Black Pig TFAM gene orders, and transports Its structure is predicted with bioinformatics software, to provide the foundation to the research of its function later.

By being found to the cDNA sequence analysis of Jiaxing Black Pig TFAM genes, 246 ammonia of Jiaxing Black Pig TFAM gene codes Base acid, albumen contain 20 kinds of amino acid, and wherein Lys proportions are up to 12.2%, His ratios minimum 0.4%.According to The amino acid similarity discovery that Blast is compared, the similitude of the amino acid and Large White, sheep, ox of Jiaxing Black Pig TFAM albumen 90% or more, illustrate that TFAM genes have a very high conservative, the biological function of TFAM genes between these species It is similar.According to the difference between amino acid, it can be seen that the affiliation between species.When the amino acid of differences between species are smaller, Illustrate that affiliation is closer, conversely, remoter.Systematic evolution tree is the result shows that genetic distance relative close between ox and pig, and two Affiliation between person is closer.There is differences for the nucleotide of different species TFAM genes.This is species long-term evolution As a result.

2.3.2 the biological information analysis of Jiaxing Black Pig TFAM genes

The present invention is 9.62 by the iso-electric point that prediction obtains Jiaxing Black Pig TFAM albumen, and unstability index value is 46.20, liposoluble coefficient 74.15.Statistical analysis finds that the protein is unstable as the unstability index ＞ 40 of protein. This illustrates that TFAM albumen is the unstable fat-soluble albumen of alkalinity.TFAM albumen hydrophobicitys are predicted, are had most in the 165th amino acid position Big value 3.933, has minimum value -4.100 in the 172nd amino acid position.Protein transmembrane structure prediction analysis shows TFAM amino acid Transmembrane helix structure is not present in sequence, this illustrates that TFAM is not belonging to memebrane protein or secretory protein.TFAM albumen may in summary It plays a significant role on the physiological regulating control of body, signal transduction.

1.4 brief summary

1.4.1 the ORF long 741bp of TFAM, 246 amino acid of codified.

1.4.2 TFAM albumen belongs to the unstable fat-soluble albumen of alkalinity, and there are maximum values for TFAM albumen hydrophobicity 3.933, minimum value -4.100.In addition transmembrane helix structure is not present in TFAM amino acid sequences, is not belonging to memebrane protein or secretion egg In vain.

Embodiment 2：Differential expression analysis of the TFAM genes in Jiaxing Black Pig different tissues

2.1 materials and methods

2.1.1 sample material

2.1.1.1 specimen sample

Select health, up to the Jiaxing Black Pig 10 of slaughter weight, Berkshire × Jiaxing Black Pig 5 grows white × Jiaxing Black pig 5, good 5 of Du × Ba Jia 5, Du × length, Berkshire 5, scissors used, tweezers go out by high temperature when acquiring tissue It is spare after bacterium processing.After butchering, 8 heart, liver, spleen, lung, sebum, abdominal fat, stomach, leg flesh tissues are acquired rapidly, they are put It into cryopreservation tube, quickly puts into and takes back laboratory in liquid nitrogen container, and be put in -80 DEG C of refrigerators and save backup.

2.1.1.2 test apparatus

Scissors, tweezers, cryopreservation tube, liquid nitrogen, freezing storing box, real-time fluorescence quantitative PCR instrument (ABI700Real-Time System, the U.S.), liquid nitrogen container (CK509X4, the U.S.), reverse transcription reagent box, SYBR Premix Ex Taq II are purchased from precious life Object engineering (Dalian) Co., Ltd etc..

2.1.2 method

2.1.2.1 the design of primers of quantitative fluorescent PCR

The GAPDH gene orders logged in the TFAM and GenBank that are obtained according to clone, in the principle of fluorescent primer design Under, with primer-design software Primer5.0 design primers are used, by Hangzhou, Qing Ke Zi Xi Bioisystech Co., Ltd synthesizes, Primer information is as follows：

Table 3：The primer information of quantitative fluorescent PCR

2.1.2.2 the reaction of RT-qPCR

Quantitative fluorescent PCR measures TFAM genes in Jiaxing Black Pig and its cross combination and external using GAPDH as reference gene Expression of the kind Berkshire in 8 heart, liver, spleen, lung, sebum, abdominal fat, stomach, leg flesh tissues.RT-qPCR's is anti- Answer system as follows：

Table 4：20 μ L reaction systems of RT-qPCR

Carry out reaction condition when relative quantification：94 DEG C of pre-degeneration 2min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C Extend 30s, 40 cycles.Reaction result is checked after reaction, checks whether the specificity of primer is good.Standard curve with it is molten Solution curve reaches Ct average values to be sought.

2.1.3 data analysis

Using relative quantification 2^-△△CtMethod analyzes TFAM genes in Jiaxing Black Pig and its cross combination and adventive Berkshire Differential expression amount in different cultivars different tissues, wherein △ △ Ct=(△ △ Ct_{Target gene}-△△C_{T reference genes}) test group-(△ △Ct_{Target gene}-△△Ct_{Reference gene}) control group.According to the mRNA tables of TFAM genes in result finishing analysis different cultivars different tissues Up to level.Then the expression quantity by obtained TFAM gene mRNAs in different cultivars different tissues and Meat Quality and trunk Shape index is associated analysis.

2.2 results and discussion

2.2.1 RT-PCR solubility curves and amplification curve

From fig. 6, it can be seen that amplification curve is smooth S type curves, baseline is smooth, and inflection point understands, exponential phase is apparent, expands It is good to increase curve entirety collimation.As shown in Figure 7, melting curve is unimodal, and repeatability is good, illustrates that amplified production is single, draws Object high specificity can be used for further analyzing.Illustrate that quantitative fluorescent PCR atopic and repeatability are good in this experiment, The quantitative testing result of expression is reliable.

2.2.2 expression rule of the TFAM genes in Jiaxing Black Pig different tissues

Using GAPDH as reference gene, with real-time fluorescence quantitative PCR detection TFAM genes Jiaxing Black Pigs Hearts, liver, spleen, Lung, sebum, abdominal fat, stomach, leg flesh totally eight tissue in mRNA expressions.Expression of results is shown in Fig. 8, and TFAM genes are in Jiaxing Black Expression quantity during pig is respectively organized is followed successively by：Spleen ＞ stomach ＞ liver ＞ heart ＞ sebum ＞ abdominal fat ＞ lung ＞ leg fleshes, wherein in lung, leg flesh The expression quantity of TFAM genes and spleen, stomach, liver, in the heart have pole significant difference (P ＜ 0.01), and in sebum be in significant difference (P ＜ 0.05)；Expression quantity of the TFAM genes in spleen and sebum have significant difference (P ＜ 0.05), the expression quantity in abdominal fat with There is conspicuousness (P ＜ 0.05) in stomach.

2.2.3 the correlation analysis of TFAM gene expression amounts and meat and carcass trait

2.2.3.1 the correlation analysis of TFAM gene expression amounts and Jiaxing Black Pig Meat Quality

Expression quantity of the analysis TFAM genes in Jiaxing Black Pig is respectively organized and its are carried out with the correlation in SPSS softwares Relevance between Meat Quality, from result in table：Expression quantity of the TFAM genes in Jiaxing Black Pig lung and leg flesh with Yellowish pink is in notable positive correlation (P ＜ 0.05), expression quantity in liver and marble grain and be waterpower in notable positive correlation (P ＜ 0.05), with percentage of water loss in significantly negatively correlated (P ＜ 0.05)；TFAM genes expression quantity in sebum and leg flesh is in marble grain Significant difference belongs to positive correlation (P ＜ 0.05).Expression quantity of the TFB2M genes in Jiaxing Black pig spleen is with marble grain in notable Negatively correlated (P ＜ 0.05), expression quantity under one's belt with yellowish pink in significantly negatively correlated (P ＜ 0.05), expression quantity in sebum with Marble grain and be that waterpower is proportionate significant difference (P ＜ 0.05), there are significant differences with tenderness for the expression quantity in leg flesh Positive correlation (P ＜ 0.05).The positive correlation of significant difference is not present between remaining tissue expression quantity and Meat Quality index and bears It is related.

Table 5：Each tissue TFAM gene expression amounts and Meat Quality correlation analysis

Note：*, it is significantly correlated on 0.01 horizontal (bilateral)；*, significantly correlated on 0.05 horizontal (bilateral).

4.2.3.2 the correlation analysis of TFAM gene expression amounts and Jiaxing Black Pig carcass trait

Expression quantity of the analysis TFAM genes in Jiaxing Black Pig is respectively organized is carried out according to SPSS softwares with its carcass trait to refer to Correlation between mark is obtained a result as follows：Expression quantity of the TFAM genes in Jiaxing Black pig stomach is in notable negative with sebum rate Close (P ＜ 0.05), expression quantity in liver and 6-7 rib fat thickness in significantly negatively correlated (P ＜ 0.05) and with triadic mean fat thickness In significant positive correlation (P ＜ 0.05), expression quantity and Slaughter weight in the heart are in extremely significant positive correlation (P ＜ 0.01), Expression quantity in sebum is with 6-7 rib fat thickness in notable positive correlation (P ＜ 0.05) and with triadic mean fat thickness in extremely significant negative It closes (P ＜ 0.05), the expression quantity in leg flesh is in notable positive correlation (P ＜ 0.05) with 6-7 ribs fat thickness and sebum rate.

Table 6：Each tissue TFAM gene expression amounts and carcass trait related coefficient

Note：*, it is significantly correlated on 0.01 horizontal (bilateral)；*, significantly correlated on 0.05 horizontal (bilateral).

2.2.3.3 TFAM gene expression amounts and intramuscular fat, inosinicacid, glutamic acid, sub- oil in Jiaxing Black Pig longissimus dorsi muscle The correlation analysis of acid content

Analyze expression quantity of the TFAM genes in Jiaxing Black Pig is respectively organized and intramuscular fat, inosinicacid, glutamic acid, linoleic acid The relevance of content, by table it is found that expression quantity of the TFAM genes in Jiaxing Black pig spleen and linoleic acid content have it is negatively correlated Significant difference (P ＜ 0.05), expression quantity under one's belt have negatively correlated significant difference (P ＜ 0.05) with content of glutamic acid, Expression quantity and intramuscular fat content in liver are in notable positive correlation (P ＜ 0.05), the expression quantity in the heart, sebum and inosinicacid Content is in significant positive correlation (P ＜ 0.05), and the expression quantity in sebum and leg flesh is respectively with intramuscular fat content in extremely significantly (P ＜ 0.01) and significant positive correlation (P ＜ 0.05).

Table 7：The correlation analysis of each tissue TFAM gene expression amounts and main flavor

Note：*, it is significantly correlated on 0.01 horizontal (bilateral)；*, significantly correlated on 0.05 horizontal (bilateral).

2.3 discussing

2.3.1 differential expression between Jiaxing Black Pig TFAM gene organizations

As the fast development and quantitative analysis of biotechnology have become indispensable during scientific research, using reality When fluorescent quantitative PCR technique expressed from the mRNA level in-site of gene and carry out quantitative analysis and have become biological field and more widely grind Study carefully.(clock Jiang Hua etc., 2011).Real-Time Fluorescent Quantitative PCR Technique principle is combined in fluorescent dye and the ditch of DNA double chain, Cause the insertion of fluorescent material that fluorescence signal is made to enhance, certainly when this method is used it is noted that nonspecific products and primer two The generation of aggressiveness.(Chen Xu etc., 2010).The present invention is the relative expression quantity for studying gene in individual is organized, and opposite table Up to amount need to be chosen at different cells and under the conditions of stablize the gene of expression, common reference gene have β-actin, GAPDH, 18sRNA etc. (Radonica et al., 2004).It is to offset Total RNAs extraction and cDNA reverse transcriptions effect using reference gene The difference of rate.This research uses the technology of Real-Time PCR, and GAPDH is selected to carry out relative quantification point as reference gene Analysis, while constructing the expression of TFAM genes.It is tried from can be seen that in the figure of this experiment melting curve and amplification curve It is accurate to test result.

Differential tissue expression shows TFAM bases the results show that TFAM genes have expression in the tissue of the heart, liver, spleen etc. 8 Because being widely present in Jiaxing Black Pig is respectively organized.Certain expression of the gene in each tissue is influenced by many factors, TFAM It is unexceptional.TFAM genes expression quantity highest in spleen tissue, the expression quantity in leg flesh are minimum.The amount of embodying sequence is spleen ＞ stomaches ＞ liver ＞ heart ＞ sebum ＞ abdominal fat ＞ lung ＞ leg fleshes.Experiments have shown that TFAM genes have higher expression in sebum and abdominal fat, this Show that TFAM genes have certain regulating and controlling effect in the formation of fat to a certain extent.Spleen is the immune organ of body, body Liquid is immune and cellular immunity is regulated and controled by spleen, and research finds that the lymphocyte number in fatty liver hepatic tissue is reduced, and shows The main reason for it generates certain influence to body's immunity, and fatty liver is formed is aliphatic acid beta-oxidation in liver mitochondrion Reduction, it is one tailor-made that height of the TFAM genes in spleen shows that TFAM genes may to a certain extent have the regulation and control of fat With.

2.3.2 the correlative study of TFAM gene expression amounts and Meat Quality and carcass trait

Largely research shows that TFAM and TFB2M genes may have the meat and carcass trait of domestic animal certain regulation and control to make With.Up to the present, about the expression quantity of TFAM genes and the meat of Jiaxing Black Pig and carcass trait correlative study there is not yet Report.Therefore, the relationship of expression quantity and meat, carcass trait that TFAM genes are studied in transcript profile level is a big innovation, This is to it is expected that meat and carcass trait from molecular level improvement Jiaxing Black Pig are of great significance.

Have at present about the research of correlation analysis between gene expression amount and Meat Quality and carcass trait index Report.Liu Jiying etc. has detected 4 mrna expression of muscle melanocyte skin hormone receptor by real-time PCR, and adopts Its relevance (Liu Jiying, 2011) with IMF is analyzed with Biological Statistic Analysis Software.Sun Yanyan (2015) is to Guizhou White Goat TFAM Gene expression, the polymorphic influence to meat, slaughter trait are studied, and find expression quantity and carcass weight of the TFAM genes in lung In notable positive correlation, expression quantity in hypophysis and be waterpower in significantly negatively correlated.It can be visited by regulating and controlling the expression quantity of the gene Study carefully its influence to Guizhou White Goat meat and slaughter trait.Table of the TFAM genes in Jiaxing Black Pig lung and leg flesh in this experiment It is in notable positive correlation (P ＜ 0.05) with yellowish pink up to amount, expression quantity in liver and marble grain are waterpower and triadic mean Fat thickness is in notable positive correlation (P ＜ 0.05), with percentage of water loss, 6-7 rib fat thickness in significantly negatively correlated (P ＜ 0.05)；TFAM genes exist Expression quantity and marble grain, 6-7 rib fat thickness are in significant difference in sebum and leg flesh, belong to positive correlation (P ＜ 0.05) in sebum Expression quantity and triadic mean fat thickness in extremely significant negatively correlated (P ＜ 0.05), expression quantity in leg flesh and 6-7 ribs fat thickness and Sebum rate is in notable positive correlation (P ＜ 0.05)；Expression quantity and sebum rate in Jiaxing Black pig stomach are in notable negative correlation (P ＜ 0.05), expression quantity in the heart and Slaughter weight are in extremely significant positive correlation (P ＜ 0.01), are in notable positive with 6-7 rib fat thickness It closes (P ＜ 0.05).Expression quantity of the TFAM genes in Jiaxing Black pig spleen has negatively correlated significant difference (P ＜ with linoleic acid content 0.05), expression quantity under one's belt has negatively correlated significant difference (P ＜ 0.05), the expression in liver with content of glutamic acid Amount is in notable positive correlation (P ＜ 0.05) with intramuscular fat content, and the expression quantity in the heart, sebum manifests work with inosine acid content Positive correlation (P ＜ 0.05), the expression quantity in sebum and leg flesh is respectively with intramuscular fat content in extremely significantly (P ＜ 0.01) and aobvious The positive correlation (P ＜ 0.05) of work.These are the result shows that TFAM genes have weight in terms of Jiaxing Black Pig meat and carcass trait The influence wanted.

Expression quantity of the TFAM genes in each tissue and its influence to meat and carcass trait, to carry out from now on The functional study of TFAM genes and the improvement of Jiaxing Black Pig meat quality provide theoretical foundation.

2.3.3 TFAM gene expression amounts and intramuscular fat, inosinicacid, glutamic acid, linoleic acid in Jiaxing Black Pig longissimus dorsi muscle The correlation analysis of content

Inosinicacid (Inosinic acid, IMP), i.e. inosinic acid are the important substances for influencing muscle freshness, The height of its content can reflect the quality of meat product flavor indirectly.Intramuscular fat is then to influence Meat Tenderness and meat-like flavor Main matter.An important factor for inosinicacid and intramuscular fat are reflection meat qualities, content directly affects the edible valence of muscle Value especially influences the tenderness of muscle and cooks the fragrance generated.Inosinicacid and intramuscular fat are the main objects for influencing muscle flavor Matter, content also become the important indicator for weighing meat products matter.Glutamic acid in amino acid is the important object for determining pork delicate flavour Matter also has the special efficacy for forming the disagreeable tastes such as meat delicate flavour and buffering acid, alkali.It is people in unsaturated fatty acid Linoleic acid The essential fatty acid of body, it is necessary to be obtained from diet, serum cholesterol and blood viscosity can be reduced, inhibit cardiovascular and cerebrovascular disease And anticancer, it is significant on nutrition and health care.At present about intramuscular fat in TFAM genes and Jiaxing Black Pig longissimus dorsi muscle, The article of the relevance of inosinicacid, glutamic acid, linoleic acid content has not been reported.TFAM genes in this experiment are in Jiaxing Black Pig Expression quantity in spleen has negatively correlated significant difference (P ＜ 0.05), expression quantity under one's belt to contain with glutamic acid with linoleic acid content Amount has negatively correlated significant difference (P ＜ 0.05), and the expression quantity in liver is in notable positive correlation (P with intramuscular fat content ＜ 0.05), the expression quantity in the heart, sebum manifests the positive correlation (P ＜ 0.05) of work with inosine acid content, in sebum and leg flesh Expression quantity respectively with intramuscular fat content in extremely significantly (P ＜ 0.01) and significant positive correlation (P ＜ 0.05).This illustrates this Gene may influence the meat of pig by flavor substance such as inosinicacid, intramuscular fat, glutamic acid and the linoleic acid of regulation and control Meat Character, the association analysis for research gene and character later provide foundation.

2.4 brief summary

2.4.1 TFAM genes have expression, table of the TFAM genes in spleen, stomach and liver in Jiaxing Black Pig is respectively organized It is relatively high up to measuring.

2.4.2 can by regulate and control TFAM genes expression quantity, probe into its to Jiaxing Black Pig Meat Quality, carcass trait and The influence of flavor substance in longissimus dorsi muscle.

Sequence table

<110>Zhejiang University

<120>Jiaxing Black Pig TFAM gene expression characteristics sequence, primer and detection kit

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 943

<212> DNA

<213>Unknown (Unknown)

<400> 1

catgcgctcg ggagctgcac aagattgggg cctggtcagt gctttgtcta cgggtgcaat 60

ggcgcttctc cggggcgtgt ggggcgtgct gagtgccctg ggaaagtcag gagcggacct 120

ctgtgcggtt tgtggaagtc gactgcgctc tccgttcagt tttgcgtatg taccaagatg 180

gttttcatcc accctgagtg gttttccaaa gaagcctatg acttcatacg ttcgattttc 240

taaagaacag ctacccatat ttaaagctca gaacccagat gcaaaaaatt cagaactaat 300

taaaaaaatt gctgagctgt ggagggaact tcctgattca gagaaaaaga tatatgaaga 360

tgcttatagg gcagactggc aggtgtacaa agaagaggta aacagaattc aagaacagct 420

aactccaagt caaatggtat ctttggaaaa agaaatcatg cagaaacgtt taaaaaagaa 480

agcgttaatc aaaaagagag aattaacaat gcttggaaaa ccaaaaagac ctcgatcagc 540

ttataacatt tttattgctg aacgctttca ggaagctaag gatggtccat cacaggtaaa 600

gctgaaaact ataaatgaaa actggaaaaa tctctctagt tctcaaaagc aagtatatat 660

tcaacttgct gaagatgata aagttcgtta ttataatgaa atgaaatctt gggaagaaca 720

aatggttgaa gttgggcgaa acgatcttat acgtcgctca atgaaacatt cagcaaagaa 780

agacactgag gagtgttgaa atagaaggtt gagctatgtt cgtatggtac cccccaaaaa 840

aaacacaatt tataaaaaaa accccccaaa aacaaaccat ccaaaaaaaa aacttcccca 900

ccatattata tttccaaaaa taaaattttt ataaaaacca ata 943

<210> 2

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 2

ttgcgagttc aagtcgtcat 20

<210> 3

<211> 20

<212> DNA

<213>Unknown (Unknown)

<400> 3

ggtttctcgt gtctatccat 20

Claims (4)

1. Jiaxing Black Pig TFAM gene expression characteristics sequences, nucleotide sequence is as shown in SEQ ID No.1.

2. the specificity amplification primer of Jiaxing Black Pig TFAM genes, primer sequence are as follows：

Sense primer：5’-TTGCGAGTTCAAGTCGTCAT-3’；

Downstream primer：5’-GGTTTCTCGTGTCTATCCAT-3’.

3. a kind of Jiaxing Black Pig meat correlated traits detection kit includes mainly Jiaxing Black Pig TFAM gene expression characteristics sequences, praises The specificity amplification primer and PCR reaction reagents of emerging black pig TFAM genes；It is characterized in that：The Jiaxing Black Pig TFAM bases Because the nucleotide sequence of characteristic sequence is as shown in SEQ ID No.1, the specificity amplification primer sequence is as follows：

Sense primer：5’-TTGCGAGTTCAAGTCGTCAT-3’；

Downstream primer：5’-GGTTTCTCGTGTCTATCCAT-3’.

4. application of the kit in Jiaxing Black Pig breeding described in claim 3.