CN108676806A - Jiaxing Black Pig TFB2M gene expression characteristics sequence, primer and detection kit - Google Patents

Abstract

The invention relates to a characteristic sequence of the TFB2M gene of Jiaxing black pig and specific amplification primers, and a detection kit for quality-related traits of Jiaxing black pork including the characteristic sequence of the TFB2M gene and the specific amplification primer. The present invention discusses the correlation analysis of TFB2M gene expression and Jiaxing black pork quality traits and carcass traits, and explores the genetic mechanism of genes related to Jiaxing black pork quality traits from the molecular level, in order to improve the meat quality of local pigs and protect Jiaxing black pig germplasm resources It provides a corresponding theoretical basis for its development and utilization, and is of great significance for improving and improving the fecundity of low-yield varieties and improving meat quality.

Description

Jiaxing Black Pig TFB2M Gene Characteristic Sequence, Primers and Detection Kit

(1) Technical field

The invention relates to a characteristic sequence of the TFB2M gene of Jiaxing black pig and specific amplification primers, and a detection kit for quality-related traits of Jiaxing black pork including the characteristic sequence of the TFB2M gene and the specific amplification primer.

(2) Background technology

Jiaxing black pig is an excellent local breed in my country. After a long period of domestication and long-term selection by farmers in the production area, it has formed excellent characteristics of high fecundity, good meat quality, strong stress resistance, and good hybrid combination ability, especially fecundity. The high characteristic has attracted the attention of the world, and it is a precious pig breed resource in our country.

However, due to the slow growth rate, low slaughter rate, low slaughter rate, low lean meat rate, and low feed conversion rate of local pig breeds in my country, they cannot adapt to the industrial development of the pig industry, nor can they meet the growing demand for lean pork in the market. demand, resulting in a shrinking group size (Liu Yingying et al., 2015). The practice of pig breeding in the 20th century showed that excessive growth rate and excessive lean meat rate lead to the decline of pork quality and the reduction of individual viability. The direction of modern pig breeding has thus shifted to focus on high-quality pig breeding, and tends to use local black pig breeds. In order to meet the market's demand for high-quality and diversified pork quality, and to better protect, develop and utilize Jiaxing black pig, a famous and excellent local pig breed in Zhejiang Province, it is necessary to carry out the breeding of high-quality black pig matching lines.

Berkshire pig is the oldest bred pig breed in the UK, with a history of more than 300 years and a pure breeding record of more than 200 years. Due to the excellent quality of Berkshire pork and rich snowflake lean meat, Japan bred Kagoshima black porpoise. In particular, the superiority of the front shoulder snowflake meat of the Berkshire pig makes it occupy an important position in the breed pattern of the world's pigs (Zhang Weili et al., 2008). With the improvement of living standards, people's consumption of top-quality pork is increasing, and the demand for top-quality black pork in the international and domestic markets is increasing day by day. Berkshire pigs have made a comeback after half a century of sluggishness. Therefore, it is of great practical significance and broad prospects for development and utilization to select the Berkshire pig as the maternal paternal breed of the high-quality black pig mating line for specialized breeding, and to develop the mating line of Jiaxing black pig as the female parent (Zhang Weili et al. year 2010). While pursuing quantity, improving the meat quality traits and carcass performance of breeding breeds has always been one of the goals of breed selection, and will receive more and more attention.

Up to now, there are few reports on the molecular mechanism of Jiaxing black pig and its hybrid combination on meat quality traits and carcass traits, especially the effect of TFB2M gene on Jiaxing black pork quality traits and carcass traits has not been reported.

Mitochondrial transcription factor B2 (TFB2M) is a bifunctional protein encoded and synthesized by nuclear genes that regulates mitochondrial transcription. TFB2M belongs to rRNA methyltransferase, but its activity is lower compared with TFB1M. TFB2M is expressed under the regulation of nuclear transcription factors such as nuclear respiratory factors 1 and 2 (NRF-1, NRF-2), peroxisome proliferator-activated receptor gamma coactivator 1 (PGC-1α) and other nuclear transcription factors (Rebelo et al., 2011 ).

People are increasingly demanding the quality of pork. In order to achieve this goal, improving the quality of pork from the perspective of breeding is one of the main goals of many breeders. The current research hotspots are mainly focused on studying the mechanism of meat quality traits-related genes regulating fat deposition and meat quality traits through molecular biology techniques.

The lipid metabolism of eukaryotes requires the participation of mitochondria, and the key mitochondrial gene TFB2M regulates mtDNA replication and transcription. It has been documented that the TFB2M gene regulates muscle fat metabolism and has a significant effect on marbling. Numerous research results provide a solid theoretical support for the study of TFB2M gene on pork quality traits and fat metabolism. But so far, the reports on TFB2M and TFB2M genes related to quality traits of Jiaxing black pork are still blank.

(3) Contents of the invention

The purpose of the present invention is to provide the characteristic sequence of Jiaxing black pig TFB2M gene and specific amplification primers, to explore the correlation analysis between the expression of TFB2M gene and the quality traits and carcass traits of Jiaxing black pork, and to explore the genetic mechanism of genes related to quality traits of Jiaxing black pork from the molecular level , to provide a corresponding theoretical basis for improving the meat quality of local pigs, protecting the germplasm resources of Jiaxing black pigs, and developing and utilizing them.

The technical scheme adopted in the present invention is:

The characteristic sequence of Jiaxing black pig TFB2M gene, its nucleotide sequence is shown in SEQ ID No.1:

5'-GCCTTGTGGGTCGTCCTGTATGGAGTTCGTCACGTTGTAACGAGCCCGGGTGACTTTGGGACGAACCTTAGAGGGGGACAATGTGGGTCCCATGGGCGGGGCTTCCACCACGGCTAACGCTCTCAGCCTTGACCGTCCCTGGGCGCTTTTGCACTTTGAGGTCCGGAGCGGCAAGGAGGAAGGATGTTCCGGCGGGGCACCGCCGTGCCTTGTCTGATTTCCAACCGAAGCTGGTGCCCTGTGTGGGTTTCGGGAAGTCGCGTGTGTACAAGCACAACTCAGAACCCAAGCGGTACATAACTAATCCGAGAGTGGCTGAGAACTTGGTGCGGATCCTGCGAAGAAAACGAAAATCTGGCCAGCTCTTCCTGGAATGCAATCCGGGTCCTGGATTCCTGACACGAGCATTACTTGAAAGTGGTGCCAGAGTGATTGCCTGTGAAAGTGACAAAGCTTTTATTCCACAATTGGAGGATCTAGGACAGAAGCTGGGTGGAAAACTAAAAGTGGTCTACTGTGACTTCTTTAAACTGGATCCTAGAGGTCATGGAGCCCTAACACCTCCGATCATGACTGCAGAGACACTTTTTCGGAATTTGGGAATAGGACCAAATCCTTGGTCAAAAGGTGCCGCTTTTAAAGTAGTTGGCGTCCTACCAACTAGAAATGAGAGAAATACACTTTGGAAACTCTTACATGATCTGTATTCTTGTACTTCTATATATGAATATGGACGGGTAGAAGTAAACATGTTTGTTACCGAAAAAGAATGCCGGAAAATAATGGCAAATCCTCAAAATCCAAACTTATATCAAGCACTAAGTGTACTCTGTCAGTTAGCTTGTGGGATTAAGGTCCTGCATACGGAGCCTTGCTCATCATTCAGAACATTTATCCAAAATGGGCAGCTGGAAAAGAAGCAGCATAGGGAATCAGAACAAAACCTGTGTTTTATTCAATTGAGTCCTCATAGAAATTTATTTGCAAGAACCTTAAC ACCTTTTAACTATGATGTGTTTTTTCACATGGTAAGGCAGTGTTTTATGAAACGCAACGCCATGCTAATAGACCATTTACGTTCATTGAGTCCAATTGATGCATTGCATATAATGAACCAAATGAGAAAAAAACACAGTATGAAAATAGTAGATATGTACCCTGAAGACTTTCAGCGTCTCTTTGAAATTATAGAATGTTCCAAAGATGGTGCCTGTAGGTGGCTATATGATGACTTCATGGAAGATACACTCACATAGGAAGTGGACTGCTAAGCCATTTATTGGAGCTTTTTGTTTATTTGGAAATTATGACACAAATGAAAAAGAACCGAGCTGGAAAAGCTCACAGCCTTTCAACAGAAGATAACTTCTTGTTTTGCGCAACTGAGCAGATAATTTCTTCTGCAGTCGATACCATTAGTGTATTGGATGAAATAATAGCTGCTGTTTTATTTAAACTGAATAAAATGAAGACTTCAGTTCATTGTGGATTTGATCAAATTAGATTTGTCTTGGAGTTCCCAACATGGCTCAATGGAAACGAATCTGACTAGCATCCATGAGGATGTAGGTTTGATCCCTGGACTTGCTCAGTAGGTTAAGGATCTAGTGTTGCCATGAACTGTGATGTAGGTCACAGATGAGGCTTGGATTTGGCGTCGCTGTGGCTGTGGTGTATGCCAGCGGCTATAGCTCCAACTCAGCTCCTAGCCCAGGAATCTCCC-3'。

The invention clones the coding region sequence of the TFB2M gene of Jiaxing black pig and analyzes the biological information, which is of great significance for in-depth understanding of the biological function and mechanism of action of the TFB2M gene.

The present invention also relates to the specific amplification primer of Jiaxing black pig TFB2M gene, and its primer sequence is as follows:

Upstream primer: 5'-GTGGGTCGTCCTGTATGG-3';

Downstream primer: 5'-ACACATGGCACAGGGAGA-3'.

The present invention also relates to a detection kit for quality-related properties of Jiaxing black pork, which mainly includes the characteristic sequence of Jiaxing black pig TFB2M gene, specific amplification primers for Jiaxing black pig TFB2M gene, and PCR reaction reagents;

The nucleotide sequence of the characteristic sequence of the Jiaxing black pig TFB2M gene is shown in SEQ ID No.1, and the sequence of the specific amplification primer is as follows:

Upstream primer: 5'-GTGGGTCGTCCTGTATGG-3';

Downstream primer: 5'-ACACATGGCACAGGGAGA-3'.

The invention also relates to the application of the kit in Jiaxing black pig breeding. The invention screens out molecular markers that are beneficial to improving pork quality, which can provide references for improving pork quality and accelerating breeding selection.

The present invention discusses the regulation mechanism of the key mitochondrial gene TFB2M gene on the fat metabolism of Jiaxing black pork, and provides a theoretical basis for screening out molecular markers or candidate genes that are beneficial to the quality of Jiaxing black pork in the future. Breeding and further developing its germplasm genetic potential are of great significance.

(4) Description of drawings

Fig. 1 is the electrophoresis detection pattern of the tissue sample total RNA that extracts;

Fig. 2 is the RT-PCR product that agarose detects TFB2M gene;

Figure 3 is a partial sequence sequence of Jiaxing black pig TFB2M gene;

Figure 4 is the nucleotide and amino acid sequence of Jiaxing black pig TFB2M;

Figure 5 is the prediction of the tertiary structure of TFB2M protein;

Fig. 6 is the fluorescent quantitative amplification result of TFB2M gene;

Fig. 7 is the fluorescence quantification melting curve of TFB2M gene;

Figure 8 shows the expression of Jiaxing black pig TFB2M gene in different tissues.

(5) Specific implementation methods

The present invention is further described below in conjunction with specific embodiment, but protection scope of the present invention is not limited thereto:

Example 1:

1.1 Materials and methods

1.1.1 Experimental materials

1.1.1.1 Experimental animals

A healthy Jiaxing black pig of about 72kg was selected, provided by Zhejiang Qinglian Food Co., Ltd. After slaughtering, the livers were taken out, placed in cryopreservation tubes and put into liquid nitrogen tanks for quick freezing. After returning to the laboratory, they were taken out of the liquid nitrogen tanks and stored in a -80°C refrigerator for later use as test samples.

1.1.1.2 Main instruments and reagents

1.1.1.2.1 Main instruments

1.1.1.2.2 Main reagents

Trizol A ⁺ reagent, plasmid small extraction kit (No.DP103), DH5α competent cells (No.CB101), DL2000 Marker DL1000 Marker were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Prime Script RTreagent Kit with gDNA Eraser ( No.DRR037A), EX Taq (No.DR001A), Gel Extraction Kit (gel recovery kit) were purchased from Treasure Bioengineering (Dalian) Co., Ltd. Tris base, yeast extract, agar powder, tryptone, IPTG (Isopropyl β-D-1-Thiogalactopyranoside) isopropyl-β-D-thiogalactopyranoside, X-Ga (5-Bromo-4-chloro- 3-indolyl β-D-galactopyranoside) 5-bromo-4-chloro-3-indole-β-D galactoside, Amp (Ampicillin) ampicillin were all from the laboratory. Specific primers, general primers for vectors, and pMD19-TSimple Vector vectors were provided by Hangzhou Qingke Zixi Biotechnology Co., Ltd., dissolved in deionized water, and stored at -20°C.

1.1.1.2.3 Preparation of reagents

1) LB solid medium (calculated according to 1L volume preparation)

Preparation method: Dissolve the weighed solute in 960mL ultrapure water, add about 900μL 5mol/L NaOH to adjust the pH to 7.2, set the volume to 1000mL, autoclave for 1.5h, and wait to cool to 60°C. Add 1.0 μL of 100 mg/mL Kan stock solution to a final concentration of 100 μg/mL, shake the culture medium crosswise, take a glass petri dish that has been autoclaved, add an appropriate amount of culture medium to each petri dish to spread the plate, and cool it at room temperature for later use .

2) LB liquid medium (calculated according to 1L volume preparation)

Material: tryptone for bacterial experiment 10g

Special Yeast Extract for Bacterial Experiments 5g

NaCl 10g for bacterial experiments

Preparation method: Dissolve the weighed solute in 960mL ultrapure water, add about 700μL 5mol/L NaOH to adjust the pH to 7.2, set the volume to 1000mL, autoclave for 1.5h, and store at 4°C for later use.

3) 50×TAE buffer master solution formula (calculated according to 1L volume preparation)

Material: Tris 242g

Na2EDTA. 2H2O 37.2g

CH3COOH 57.1mL

Preparation method: Dissolve the weighed solute in 600mL ultrapure water, stir to dissolve, dilute to 1000mL, store at room temperature for later use.

Preparation of 1×TAE working solution: Take 20mL of the above-mentioned 50×TAE mother solution and add 980mL of deionized water to obtain 1×TAE working buffer.

4) 1mol/L CaCl2: Weigh 14.7g CaCl2·2H2O and dissolve in sufficient water, dilute to 100mL, autoclave for 20min, and store at 4°C for later use. Commonly used 0.1mol/L CaCl2 solution.

5) 0.1mol/L CaCl2 solution containing 15% glycerol: add 15mL pure glycerol to 10mL 1mol/L CaCl2, add water to make up to 100mL, autoclave for 20min, and store at 4°C for later use.

6) 75% alcohol: Take 75mL of 100% pure alcohol, add water to make up to 100mL, store at 4°C for later use.

7) 1% agarose gel: Weigh 0.2g agarose and dissolve it in 20mL 1×TAE electrophoresis buffer, heat it in a microwave oven for about 1 minute until it is completely dissolved, put it on the table and cool it until it is not hot on the back of your hand, then add 1 microliter of nucleic acid dye, mix well and pour it into a small electrophoresis tank with an electrophoresis comb, and place it on the table for about 20 minutes.

1.1.2 Method

1.1.2.1 Primer design

The primers were synthesized by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The primer sequence information is shown in Table 1:

Table 1: Primers for TFB2M gene cDNA cloning

1.1.3 Extraction and detection of total RNA

1.1.3.1 Extraction of total RNA

The total RNA of Jiaxing black pig liver tissue was extracted with Trizol reagent, and the specific operation was as follows:

(1) Take out the frozen liver tissue from the -80°C refrigerator, cut about 50-100mg of the sample, add it to a 1.5ml centrifuge tube with steel balls and 1mL Trizol, and put it into the grinder ( Frequency 70HZ, time 120s) After grinding, let it rest on the ultra-clean workbench for 5 minutes to fully crack it;

(2) Put the centrifuge tube with the fully lysed sample into the centrifuge, centrifuge at 12000rpm at 4°C for 10min, then take the supernatant into another new centrifuge tube, discard the precipitate, so that the cell membrane, Impurities such as organelle membranes are all poured out;

(3) Add 0.2ml of chloroform to the centrifuge tube, mix well on the vortex mixer and let stand for 15min;

(4) Centrifuge at 12000rpm at 4°C for 15min, and suck the upper aqueous phase into another centrifuge tube;

(5) Add about 0.5ml of isopropanol, mix well, place at room temperature for 10min, then centrifuge at 12000rpm at 4°C for 10min, discard the supernatant, and a gelatinous RNA precipitate will be seen at the bottom of the tube;

(6) Add 1ml of 75% ethanol pre-cooled at 4°C, shake gently or pipette several times to make the precipitate appear in a suspended state, centrifuge the centrifuge tube at 8000rpm at 4°C for 10min, and discard the supernatant;

(7) Dry at room temperature or vacuum dry for 5-10 minutes, remember not to be too dry;

(8) Dissolve the RNA sample with 50 μL ddH2O, and bathe in water at 55-60°C for 5-10 minutes;

(9) Measure the OD value to quantify the RNA concentration and detect the quality of the RNA by gel electrophoresis.

1.1.3.2 Quality detection of total RNA

Quality detection of total RNA: take about 10 μL of RNA, and after 1% agarose gel electrophoresis, if you can see three clear bands of RNA, starting from the gel hole, they are 28S, 18S, and 5S respectively, and the 28S band is The brightness of 18S is about twice that of 18S, and the 5S band is the weakest, indicating that the extracted RNA is of good quality and can be used for subsequent experiments. Then, the OD260/OD280 value and concentration of the intact total RNA without degradation were determined. Take about 2 μL of total RNA, and measure the value and concentration of A260 and A280 in a nucleic acid protein analyzer. The OD260/OD280 value between 1.8-2.0 indicates that the quality is good, which meets the concentration requirements of reverse transcription for total RNA.

1.1.4 Reverse transcription reaction

The reverse transcription reaction uses RNA as a template to synthesize cDNA under the action of reverse transcriptase.

1) Genomic DNA removal reaction

Prepare the reaction mixture on ice, aliquot into each reaction tube, and finally add the RNA sample.

After 2 minutes in a water bath at 42°C, store at 4°C.

2) Reverse transcription reaction

The reaction mixture was prepared on ice, dispensed into each of the above 10 μL reaction tubes, mixed gently, and immediately carried out the reverse transcription reaction.

37°C water bath for 15 minutes, then 85°C metal bath for 5 seconds, and finally stored at 4°C.

1.1.5 PCR reaction

Using cDNA as a template, the designed primers are used for PCR reaction to complete the amplification.

(1) Reaction system

(2) Reaction conditions

After amplification, take 3 μL of the PCR product and perform electrophoresis detection on 1% agarose gel. If the target band appears in the electrophoresis result, send the sample for sequencing to determine the optimal annealing temperature. Then carry out PCR amplification at the optimal annealing temperature of 54° C. to obtain the desired target fragment.

1.1.6 Purification and recovery of PCR products

The kit used for PCR product recovery is Gel Extraction Kit, and the operation steps are as follows:

(1) Under the voltage of 150V, electrophoresis the PCR product in 1% agar gel for about 30min;

(2) Cut off the agar block containing the target band, chop it up, and put it into a 1.5ml centrifuge tube;

(3) Add the dissolving solution Buffer GM to the rubber block, and the dosage is as follows:

(4) After mixing evenly, dissolve the glue block at 37°C, and mix it upside down every few minutes;

(5) When the glue block is completely dissolved, it can be observed that the color of the glue block is yellow;

(6) Move the dissolved gel solution to the adsorption column placed on the collection tube, centrifuge at 12000rpm for 1min, and discard the liquid in the collection tube;

(7) Add 700 μL of Buffer WB to the adsorption column, centrifuge at 12,000 rpm for 1 min, and discard the liquid in the collection tube;

(8) Repeat step 7;

(9) Centrifuge the empty collection tube with the adsorption column at room temperature at 12000rpm for 1min;

(10) Put a clean 1.5ml centrifuge tube in the adsorption column and let it stand for 30 minutes, then add 30 μL ddH ₂ O to the center of the adsorption column membrane;

(11) centrifuge at 12000rpm for 1min to elute DNA;

(12) Then measure the concentration and run the gel to confirm whether there is a target fragment.

1.1.7 RT-PCR product cloning

1.1.7.1 Connection of target gene and vector

The following is the connection system between pMD19-T Simple Vector and the recovered PCR product. It should be noted that the vector should be melted on ice.

After mixing, incubate overnight at 16°C.

1.1.7.2 Conversion of linkers

(1) Add 100 μL of DH5α competent cells to the full amount (10 μL) of the connection, mix well and place in ice for 30 minutes.

(2) After heat shock at 42°C for 90s, immediately place in ice for 5min.

(3) Add 890 μL of preheated LB liquid medium, shake and incubate at 37° C. for 60 minutes.

(4) Aspirate 200 μL of bacterial liquid, spread evenly on the LB agar plate medium containing X-Gal, IPTG, and Amp with coated beads, incubate at room temperature for about 30 min, and incubate overnight at 37°C.

(5) Observe the growth of the colonies the next day, and then screen with blue and white spots. Blue is negative and white is positive. Select a single white colony for verification.

1.1.7.3 Identification of recombinant plasmids

Bacterial fluid PCR identification: Pick white colonies and inoculate them in Amp/LB liquid medium, and shake the bacteria overnight at 37°C. Using 0.5 μL bacterial liquid as a template, carry out PCR amplification.

The reaction system is as follows:

The reaction conditions are the same as 2.2.4(2). Then take 3 μL of the reaction product and carry out 1% agarose gel electrophoresis identification.

1.1.7.4 Sequence determination

After the PCR reaction, the electrophoresis results showed that the target band was sent to Hangzhou Qingke Zixi Biotechnology Co., Ltd. for sequencing.

1.2 Results and analysis

1.2.1 Results of total RNA extraction

Figure 1 is the electrophoresis detection pattern of the total RNA extracted from tissue samples, from which we can see that there are three obvious bands, the brightness of the 28S band from top to bottom is about twice that of the 18S band, and the 5S band is the weakest Yes, indicating that the total RNA in the tissue sample has good integrity, good quality, and less degradation.

According to the actual results of the nucleic acid protein detector, the OD260/OD280 value of the extracted total RNA is between 1.80-1.95, which meets the requirements of 1.8<OD260/OD280<2.0, indicating that the RNA is not polluted by protein or chemical reagents, and can be for subsequent experiments.

1.2.2 PCR amplification of cDNA

Using cDNA as a template, RT-PCR amplification was carried out with specific primers, and then detected by 1% agarose gel electrophoresis. Figure 2 shows the RT-PCR product of TFB2M gene with a length of 1723bp, which is consistent with the expected length.

1.2.3 Sequencing results of target fragments

After sequencing, the cDNA sequence sequence diagram of Jiaxing black pig TFB2M gene was obtained, and Fig. 3 is a partial sequencing result diagram of TFB2M gene.

1.2.4 Sequence analysis of TFB2M gene

1.2.4.1 cDNA sequence analysis of Jiaxing black pig TFB2M gene

The target fragment of 1723bp was successfully amplified, and the TFB2M gene sequence of Jiaxing black pig was analyzed using the ORF Finder program on NCBI, and a CDS region with a length of 1176bp was obtained, encoding 391 amino acids (Figure 4).

1.2.4.2 Analysis of physical and chemical properties of Jiaxing black pig TFB2M

Through the analysis of the online software ExPASy ProtParam, it is concluded that the TFB2M protein of Jiaxing black pig contains 20 kinds of amino acids, of which the highest proportion of Leu is 11.3%, and the lowest proportion of Trp is 1.3%. The molecular formula of TFB2M protein is C ₂₀₀₉ H ₃₁₇₆ N ₅₇₂ O ₅₄₅ S ₂₆ , the molecular weight is 6328, and the theoretical isoelectric point PI is 9.54. The instability coefficient is 44.78, the half-life of mammalian reticulocytes in vitro is 30h, the fat coefficient is 82.79, and the average hydrophobicity coefficient is -0.303.

The hydrophobicity of TFB2M protein was analyzed by ProtScale program, and the hydrophobicity of TFB2M encoded protein had a maximum value of 4.071 at the 118th amino acid position, and a minimum value of -4.414 at the 33rd and 88th amino acid positions. The transmembrane structure of TFB2M protein was predicted by TMHMM, and it was found that there was no transmembrane helical structure in the amino acid sequence of TFB2M. Table 2 shows the subcellular localization of TFB2M obtained after PSORTⅡPrediction analysis. According to the prediction analysis of NetPhos 3.1, TFB2M protein has 14 Ser, 14 Thr and 3 Tyr which may be potential phosphorylation sites. According to the conserved domain analysis, it is found that TFB2M is a ribosomal RNA adenine methyltransferase at the 78-275 amino acid residue position, and the rest are unknown domains. Ribosomal RNA adenine methyltransferase has both rRNA methyltransferase activity and rRNA (adenine, N6-)-methyltransferase activity. Ribosome carries the translation function of protein, and its main component rRNA is the main carrier of protein translation function. Meanwhile, RNA6-methyladenine demethylase FTO regulates the differentiation of adipocytes. These all confirm that TFB2M plays an important role in mitochondrial protein translation and fat metabolism.

Table 2: Subcellular localization of TFB2M

1.2.4.3 Prediction and analysis of Jiaxing black pig TFB2M secondary and tertiary structure

Using the online software SOPMA software to predict the secondary structure of TFB2M protein, α-helix (h) accounted for 31.97%, a total of 125; extended chain (e) accounted for 22.51%, a total of 88; β-turn (t) Accounting for 13.04%, 51 in total; 127 irregular curly (c), accounting for 32.48%

The prediction results of the tertiary structure model of TFB2M protein are shown in Fig. 5. The tertiary structure of TFB2M protein is composed of alpha helix and random coil, which is consistent with the protein secondary structure.

Example 2: Analysis of differential expression of TFB2M gene in different tissues of Jiaxing black pig

2.1 Materials and methods

2.1.1 Sample material

2.1.1.1 Test sample

Choose 10 Jiaxing black pigs that are healthy and reach the market slaughter weight, 5 Berkshire x Jiaxing black pigs, 5 Landrace x Jiaxing black pigs, 5 Du x Bajia pigs, 5 Du x Changjia pigs, and 5 Berkshire pigs. The scissors and tweezers used for tissue collection were sterilized at high temperature before being used for later use. After slaughtering, 8 tissues including heart, liver, spleen, lung, sebum, abdominal fat, stomach, and leg muscles were collected quickly, put them into cryopreservation tubes, quickly put them into a liquid nitrogen tank, and bring them back to the laboratory. Store in -80°C refrigerator for later use.

2.1.1.2 Test equipment

Scissors, tweezers, freezing tubes, liquid nitrogen, freezing boxes, real-time fluorescent quantitative PCR instrument (ABI700Real-TimeSystem, USA), liquid nitrogen tank (CK509X4, USA), reverse transcription kit, and SYBR Premix Ex Taq II were purchased from Treasure Bioengineering (Dalian) Co., Ltd., etc.

2.1.2 Method

2.1.2.1 Primer design for fluorescent quantitative PCR

According to the cloned TFB2M and the GAPDH gene sequence registered in GenBank, under the principle of fluorescent primer design, the primer design software Primer5.0 was used to design primers, which were synthesized by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The primer information is as follows:

Table 3: Primer information for real-time quantitative PCR

2.1.2.2 RT-qPCR reaction

Real-time quantitative PCR, using GAPDH as an internal reference gene, was used to determine the expression level of TFB2M gene in eight tissues of Jiaxing black pig and its hybrid combinations and foreign breed Berkshire in heart, liver, spleen, lung, sebum, abdominal fat, stomach and leg muscle . The reaction system of RT-qPCR is as follows:

Table 4: RT-qPCR 20μL Reaction System

Reaction conditions for relative quantification: pre-denaturation at 94°C for 2 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 40 cycles. Check the reaction results after the reaction to check whether the specificity of the primers is good. Both the standard curve and the melting curve meet the requirement to take the average value of Ct.

2.1.3 Data analysis

Relative quantitative 2- ^△△Ct method was used to analyze the differential expression of TFB2M gene in different tissues of Jiaxing black pig and its hybrid combination and foreign breed Berkshire, where △△Ct=(△△Cttarget _gene- △△C _{t internal reference gene} ) test group-(△△Ct _target gene-△△Ct _{internal reference gene} ) control group. According to the results, the mRNA expression levels of TFB2M gene in different varieties and tissues were analyzed. Then the correlation analysis was carried out between the obtained TFB2M gene mRNA expression in different varieties and different tissues and the meat quality traits and carcass traits.

2.2 Results and discussion

2.2.1 RT-PCR melting curve and amplification curve

It can be seen from Figure 6 that the amplification curve is a smooth S-shaped curve with flat baseline, clear inflection point, obvious exponential phase, and good overall parallelism of the amplification curve. It can be seen from Figure 7 that the melting curves are all single peaks with good coincidence, indicating that the amplification product is single and the primer specificity is strong, which can be used for further analysis. It shows that the specificity and repeatability of the fluorescent quantitative PCR reaction in this experiment are good, and the expression quantitative detection results are reliable.

2.2.2 Expression of TFB2M gene in different tissues of Jiaxing black pig

Using GAPDH as an internal reference gene, real-time fluorescent quantitative PCR was used to detect the mRNA expression level of TFB2M gene in Jiaxing black pig heart, liver, spleen, lung, sebum, abdominal fat, stomach and leg muscle. The expression results are shown in Figure 8. The expression levels of TFB2M gene in various tissues of Jiaxing black pigs are as follows: spleen>stomach>liver>heart>sebum>abdominal fat>lung>leg muscle, and the expression level of TFB2M gene in lung and leg muscle There is a significant difference (P<0.01) from that in the spleen, stomach, liver, and heart, and a significant difference from that in sebum (P<0.05); the expression of TFB2M gene in the spleen is significantly different from that in sebum (P<0.05) , the expression level in abdominal fat was significantly higher than that in stomach (P<0.05).

2.2.3 Correlation analysis of TFB2M gene expression and meat quality and carcass traits

2.2.3.1 Correlation analysis of TFB2M gene expression and quality traits of Jiaxing black pork

The correlation in SPSS software was used to analyze the correlation between the expression level of TFB2M gene in various tissues of Jiaxing black pig and the meat quality traits. From the results in the table, it can be known that the expression level of TFB2M gene in lung and leg muscle of Jiaxing black pig Both were significantly positively correlated with flesh color (P<0.05), and their expression in the liver was significantly positively correlated with marbling and water retention (P<0.05), and significantly negatively correlated with water loss rate (P<0.05); TFB2M The gene expression in sebum and leg muscle was significantly different from marbling, and was positively correlated (P<0.05). The expression level of TFB2M gene in spleen of Jiaxing black pig was significantly negatively correlated with marbling (P<0.05), the expression level in stomach was significantly negatively correlated with meat color (P<0.05), and the expression level in sebum was significantly negatively correlated with marble pattern (P<0.05). There is a significant difference in positive correlation (P<0.05) between grain and system water strength, and there is a significant difference in positive correlation between the expression level in leg muscle and tenderness (P<0.05). There were no significant positive and negative correlations between the expression levels of other tissues and meat quality traits.

Table 5: Correlation analysis between TFB2M gene expression and meat quality traits in each tissue

Note: **, significant correlation at 0.01 level (both sides); *, significant correlation at 0.05 level (both sides)

2.2.3.2 Correlation analysis of TFB2M gene expression and carcass traits of Jiaxing black pigs

According to SPSS software, the correlation between the expression level of TFB2M gene in various tissues of Jiaxing black pig and its carcass traits was analyzed, and the results were as follows: the expression level of TFB2M gene in the liver and heart was significantly different from the leg-to-hip ratio, showing a positive Correlation (P<0.05), while the expression in sebum was significantly positively correlated with sebum rate (P<0.05), while the expression in abdominal fat was significantly positively correlated with leg-to-hip ratio (P<0.05), The expression level in the lung was significantly positively correlated with the eye muscle area (P<0.05). There was no significant positive or negative correlation between the expression levels of other tissues and the carcass traits of Jiaxing black pigs.

Table 6: Correlation coefficient between TFB2M gene expression and carcass traits in each tissue

Note: **, significant correlation at 0.01 level (two-sided); *, significant correlation at 0.05 level (two-sided).

2.2.3.3 Correlation analysis between the expression of TFB2M gene and the content of intramuscular fat, inosinic acid, glutamic acid and linoleic acid in longissimus dorsi muscle of Jiaxing black pig

Analyze the correlation between the expression level of TFB2M gene in each tissue of Jiaxing black pig and the content of intramuscular fat, inosinic acid, glutamic acid, and linoleic acid. There is a significant difference (P<0.05) in the positive correlation between the acid content in the liver, sebum and leg muscle, and a significant difference in the positive correlation (P<0.05) between the expression in the liver, sebum and leg muscle and the fat content in the muscle (P<0.05). Amino acid content has a very significant positive correlation (P<0.01). There was no significant positive or negative correlation between the expression levels of other tissues and the contents of intramuscular fat, inosinic acid, glutamic acid, and linoleic acid in Jiaxing black pigs.

Table 7: Correlation analysis between TFB2M gene expression and main flavor substances in various tissues

Note: **, significant correlation at 0.01 level (two-sided); *, significant correlation at 0.05 level (two-sided).

2.3 Discussion

2.3.1 Expression difference of TFB2M gene in Jiaxing black pigs

With the rapid development of biotechnology, quantitative analysis has become indispensable in the process of scientific research. Using real-time fluorescent quantitative PCR technology to perform quantitative analysis from the mRNA level expression of genes has become a relatively extensive research in the biological field. (Zhong Jianghua et al., 2011). The principle of real-time fluorescent quantitative PCR technology is that the fluorescent dye binds to the small groove of the DNA double strand, resulting in the insertion of the fluorescent substance to enhance the fluorescent signal. Of course, when using this method, attention should be paid to the generation of non-specific products and primer-dimers. (Chen Xu et al., 2010). The present invention is to study the relative expression of genes in individual tissues, and the relative expression needs to select genes that are stably expressed in different cells and conditions. Commonly used internal reference genes include β-actin, GAPDH, 18sRNA, etc. (Radonica et al. ,2004). The use of internal reference genes is to offset the difference in total RNA extraction and cDNA reverse transcription efficiency. In this study, Real-Time PCR technology was used, and GAPDH was selected as an internal reference gene for relative quantitative analysis, and an expression method of TFB2M gene was constructed. It can be seen from the graphs of the melting curve and amplification curve of this test that the test results are accurate.

The results of tissue expression differences showed that the TFB2M gene was expressed in 8 tissues including heart, liver, and spleen, indicating that the TFB2M gene widely existed in various tissues of Jiaxing black pigs. Of course, the expression of genes in various tissues is affected by many factors, and TFB2M is no exception. The highest expression level of TFB2M gene was in the spleen, but the lowest expression level was in the lung. The specific expression levels are spleen>sebum>abdominal fat>heart>stomach>liver>leg muscle>lung. Experiments have shown that the TFB2M gene is highly expressed in sebum and abdominal fat, which to some extent indicates that the TFB2M gene has a certain regulatory effect on the formation of fat. The spleen is the immune organ of the body, and both humoral immunity and cellular immunity are regulated by the spleen. Studies have found that the number of lymphocytes in the liver tissue of fatty liver is reduced, and the high expression of TFB2M gene in the spleen indicates that TFAM and TFB2M genes may be to some extent Fat regulation plays a role. Studies have found that TFB2M gene is highly expressed in human heart and liver tissues. However, in this experiment, the TFB2M gene was also expressed in the heart and liver, but the expression levels in the heart and liver were not very high. It indicated that TFB2M gene may play different roles in Jiaxing black pig and human liver.

2.3.2 Correlation between TFB2M gene expression and meat quality traits and carcass traits

A large number of studies have shown that the TFB2M gene may have a certain regulatory effect on the meat quality and carcass traits of livestock. So far, there is no report on the correlation between the expression level of TFB2M gene and the meat quality and carcass traits of Jiaxing black pigs. Therefore, it is a great innovation to study the relationship between the expression level of TFB2M gene and meat quality and carcass traits at the transcriptome level, which is of great significance for improving the meat quality and carcass traits of Jiaxing black pigs at the molecular level.

At present, studies on the correlation analysis between gene expression and meat quality traits and carcass traits have been reported. Cui Zhilong et al. (2015) studied the expression of mitochondrial transcription factor B2 gene in Guizhou white goat tissues, and speculated that TFB2M gene may play a role in fat deposition based on Jiang Zhihua's research. Sun Yanyan (2015) studied the effect of TFB2M gene expression and polymorphism on meat quality and slaughter traits of Guizhou white goats, and found that the expression level of TFB2M gene was correlated with water loss rate in the lung, flesh color and live weight in the spleen, and meat color and live weight in the kidney. Dehydration rate and marbling were significantly positively correlated with marbling in the pituitary gland. By regulating the expression of this gene, its effect on the meat quality and slaughter traits of Guizhou white goats can be explored.

In this experiment, the expression level of TFB2M gene in Jiaxing black pig spleen was significantly negatively correlated with marbling (P<0.05), the expression level in stomach was significantly negatively correlated with meat color (P<0.05), and the expression level in sebum There is a positive correlation between the amount of marbling, water retention and sebum rate (P<0.05), there is a significant difference between the expression level in the leg muscle and the tenderness (P<0.05), and the expression level in the liver and heart is significantly different from that of The leg-to-hip ratio has a significant difference and is positively correlated (P<0.05), while the expression level in abdominal fat is significantly positively correlated with the leg-hip ratio (P<0.05), and the expression level in the lung is significantly correlated with the eye muscle area Positive correlation (P<0.05). These results indicated that the TFB2M gene has an important influence on the quality and carcass traits of Jiaxing black pork.

The expression of TFB2M gene in various tissues and its effect on meat quality and carcass traits will provide a theoretical basis for the future research on the function of TFB2M gene and the improvement of pork quality in Jiaxing black pigs.

2.3.3 Correlation analysis between the expression of TFB2M gene and the content of intramuscular fat, inosinic acid, glutamic acid and linoleic acid in longissimus dorsi muscle of Jiaxing black pig

Inosinic acid (IMP), that is, inosinic acid, is an important substance that affects the freshness of muscle, and its content can indirectly reflect the quality of meat food flavor. Intramuscular fat is the main substance that affects muscle tenderness and meat flavor. Inosinic acid and intramuscular fat are important factors that reflect the quality of muscle, and their content directly affects the edible value of muscle, especially the tenderness of muscle and the aroma produced by cooking. Inosinic acid and intramuscular fat are the main substances that affect the flavor of muscle, and their content has also become an important indicator to measure the quality of meat products. Glutamic acid in amino acids is an important substance that determines the umami taste of pork. It also has the special effect of forming meat umami and buffering bad tastes such as acid and alkali. Among the unsaturated fatty acids, linoleic acid is an essential fatty acid for the human body and must be obtained from the diet. It can reduce serum cholesterol and blood viscosity, inhibit cardiovascular and cerebrovascular diseases and fight cancer, and is of great significance in nutrition and health care. At present, there is no report on the correlation between TFB2M gene and the content of intramuscular fat, inosinic acid, glutamic acid and linoleic acid in longissimus dorsi muscle of Jiaxing black pig. In this experiment, the expression level of TFB2M gene in the stomach has a significant positive correlation with the content of linoleic acid (P<0.05), and the expression level in the liver, sebum, and leg muscles has a significant positive correlation with the content of intramuscular fat. There is a significant positive correlation (P<0.01) between the expression level in sebum and the glutamic acid content. This shows that these two genes may affect the meat quality traits of pigs by regulating the flavor substances of pork quality, such as inosinic acid, intramuscular fat, glutamic acid and linoleic acid, and provide a basis for future research on the association analysis between genes and traits.

2.4 Summary

2.4.1 TFB2M gene is expressed in every tissue of Jiaxing black pig, and the expression level of TFB2M gene is relatively high in spleen, sebum and abdominal fat.

2.4.2 By regulating the expression of TFB2M gene, explore its influence on quality traits, carcass traits and flavor substances in longissimus dorsi muscle of Jiaxing black pork.

sequence listing

<110> Zhejiang University

<120> Jiaxing black pig TFB2M gene signature sequence, primers and detection kit

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1723

<212>DNA

<213> Unknown (Unknown)

<400> 1

gccttgtggg tcgtcctgta tggagttcgt cacgttgtaa cgagcccggg tgactttggg 60

acgaacctta gagggggaca atgtgggtcc catgggcggg gcttccacca cggctaacgc 120

tctcagcctt gaccgtccct gggcgctttt gcactttgag gtccggagcg gcaaggagga 180

aggatgttcc ggcggggcac cgccgtgcct tgtctgattt ccaaccgaag ctggtgccct 240

gtgtgggttt cgggaagtcg cgtgtgtaca agcacaactc agaacccaag cggtacataa 300

ctaatccgag agtggctgag aacttggtgc ggatcctgcg aagaaaacga aaatctggcc 360

agctcttcct ggaatgcaat ccgggtcctg gattcctgac acgagcatta cttgaaagtg 420

gtgccagagt gattgcctgt gaaagtgaca aagcttttat tccacaattg gaggatctag 480

gacagaagct gggtggaaaa ctaaaagtgg tctactgtga cttctttaaa ctggatccta 540

gaggtcatgg agccctaaca cctccgatca tgactgcaga gacacttttt cggaatttgg 600

gaataggacc aaatccttgg tcaaaaggtg ccgcttttaa agtagttggc gtcctaccaa 660

ctagaaatga gagaaataca ctttggaaac tcttacatga tctgtattct tgtacttcta 720

tatatgaata tggacgggta gaagtaaaca tgtttgttac cgaaaaagaa tgccggaaaa 780

taatggcaaa tcctcaaaat ccaaacttat atcaagcact aagtgtactc tgtcagttag 840

cttgtgggat taaggtcctg catacggagc cttgctcatc attcagaaca tttatccaaa 900

atgggcagct ggaaaagaag cagcataggg aatcagaaca aaacctgtgt tttattcaat 960

tgagtcctca tagaaattta tttgcaagaa ccttaacacc ttttaactat gatgtgtttt 1020

ttcacatggt aaggcagtgt tttatgaaac gcaacgccat gctaatagac catttacgtt 1080

cattgagtcc aattgatgca ttgcatataa tgaaccaaat gagaaaaaaa cacagtatga 1140

aaatagtaga tatgtaccct gaagactttc agcgtctctt tgaaattata gaatgttcca 1200

aagatggtgc ctgtaggtgg ctatatgatg acttcatgga agatacactc acataggaag 1260

tggactgcta agccattatt tggagctttt tgtttattg gaaattatga cacaaatgaa 1320

aaagaaccga gctggaaaag ctcacagcct ttcaacagaa gataacttct tgttttgcgc 1380

aactgagcag ataatttctt ctgcagtcga taccattagt gtattggatg aaataatagc 1440

tgctgtttta tttaaactga ataaaatgaa gacttcagtt cattgtggat ttgatcaaat 1500

tagatttgtc ttggagttcc caacatggct caatggaaac gaatctgact agcatccatg 1560

aggatgtagg tttgatccct ggacttgctc agtaggttaa ggatctagtg ttgccatgaa 1620

ctgtgatgta ggtcacagat gaggcttgga tttggcgtcg ctgtggctgt ggtgtatgcc 1680

agcggctata gctccaactc agctcctagc ccaggaatct ccc 1723

<210> 2

<211> 18

<212>DNA

<213> Unknown (Unknown)

<400> 2

gtgggtcgtc ctgtatgg 18

<210> 3

<211> 18

<212>DNA

<213> Unknown (Unknown)

<400> 3

acacatggca cagggaga 18

Claims (4)

1. The characteristic sequence of TFB2M gene of Jiaxing black pig, the nucleotide sequence of which is shown in SEQ ID No.1. 2. The specific amplification primers of Jiaxing black pig TFB2M gene, the primer sequence is as follows: Upstream primer: 5'-GTGGGTCGTCCTGTATGG-3'; Downstream primer: 5'-ACACATGGCACAGGGAGA-3'. 3. A detection kit for quality-related traits of Jiaxing black pork, mainly comprising the characteristic sequence of Jiaxing black pig TFB2M gene, specific amplification primers of Jiaxing black pig TFB2M gene, and PCR reaction reagent; it is characterized in that: said Jiaxing black pig The nucleotide sequence of the TFB2M gene characteristic sequence is shown in SEQ ID No.1, and the sequence of the specific amplification primer is as follows: Upstream primer: 5'-GTGGGTCGTCCTGTATGG-3'; Downstream primer: 5'-ACACATGGCACAGGGAGA-3'. 4. the application of kit described in claim 3 in Jiaxing black pig breeding.