CN109182568A - A kind of salmonella Rapid identification and classifying method and kit - Google Patents

A kind of salmonella Rapid identification and classifying method and kit Download PDF

Info

Publication number
CN109182568A
CN109182568A CN201811191746.XA CN201811191746A CN109182568A CN 109182568 A CN109182568 A CN 109182568A CN 201811191746 A CN201811191746 A CN 201811191746A CN 109182568 A CN109182568 A CN 109182568A
Authority
CN
China
Prior art keywords
salmonella
pcr
stn
bcf
gly
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811191746.XA
Other languages
Chinese (zh)
Inventor
乐敏
方维焕
潘航
李芳�
李渊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Jiutian Yingnuo Animal Pharmaceutical Co Ltd
Original Assignee
Anhui Jiutian Yingnuo Animal Pharmaceutical Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Jiutian Yingnuo Animal Pharmaceutical Co Ltd filed Critical Anhui Jiutian Yingnuo Animal Pharmaceutical Co Ltd
Priority to CN201811191746.XA priority Critical patent/CN109182568A/en
Publication of CN109182568A publication Critical patent/CN109182568A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to veterinary biologics and food microorganisms technical field, especially a kind of salmonella Rapid identification and classifying method and kit, the salmonella in production of poultry meat chain sample or separation strains bacterium solution is quickly detected using multiple PCR method, while indicating wherein whether contain Kentucky serotype.A kind of method of salmonella Rapid identification and parting, which comprises the following steps: step 1, pcr template is prepared in the bacterium solution based on S.Kentucky 1C1；Step 2, primer sets are prepared, are made of stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；Step 3, the pcr template obtained based on step 1, the reaction system of multiplex PCR detection is established using the primer sets that step 2 obtains, and the reaction system of multiplex PCR detection obtains pcr amplification product under predetermined reaction condition；Step 4, electrophoresis detection is carried out to the amplified production that step 3 obtains, whether salmonella is contained according to electrophoresis detection result judgement.

Description

A kind of salmonella Rapid identification and classifying method and kit
Technical field
The present invention relates to veterinary biologics and food microorganisms technical field, especially a kind of salmonella Rapid identification With classifying method and kit, it is Kentuckian to be mainly used for salmonella and its serotype in animals and animal product industrial chain sample Multiplex PCR detection.
Background technique
Salmonella is a kind of important Zoonosis pathogen, is mainly lodged in the enteron aisle of humans and animals, and table is studied Bright by salmonellal food poisoning is ratio highest in all food posionings, the most wide one kind of harm.The world Health organization (WHO) investigation, which shows that there are more than one hundred million human gastrointestinal inflammation in the whole world every year, to be caused by salmonella infection, wherein dead Case is up to 3,000,000.
Nontyphoidal Salmonella (nontyphoidal Salmonella, NTS) can cause enterogastritis (food poisoning), Bacteremia and secondary focal infection etc. are the public health problems for threatening the whole world.It is reported that the bacillary enterogastritis in China In common pathogen, NTS is only second to vibrio parahaemolytious, occupies the 2nd of spectrum of causing a disease.The infection of most of NTS is attributed to food With contaminated animal food, cause the gastroenteritis symptoms such as enterogastritis, high fever and the diarrhea with cramp, although greatly More prognosis bonas, but for elderly and infirm or immunocompromised person, still have fatal danger.
The case where carrying or pollution salmonella are widely present in animal and animal's products industry, especially Poultry industry Weight, birds food is the para-infectious important carrier.Salmonella is a kind of poultry intestines for making host that non-evident sympton often be presented Road is colonized bacterium.Stress or disease condition under poult provide chance for the horizontal transmission of salmonella high frequency.From the U.S. It is salmonella-polluted that USDA-FSIS data show that every four pieces of live chickens tissue is just very likely to appearance 1.Moreover, advantage Sramana's serotype can travel to renewable tissue, lead to the vertical transmission of thallus salmonellosis related to birds, beasts and eggs.
Fluoroquinolones and third generation cephalosporin class antibiotic are the preferred medications of current treatment salmonella infection.Due to above-mentioned Two class drugs are also widely used in poultry cultivation industry, therefore chicken farm and commercially available chicken have become containing super wide spectrum β-interior acyl The important repository of amine enzyme (extended spectrum β-lactamases, ESBLs) and mediated quinolone resistance salmonella. Accurately, it is very crucial quickly, economically to detect common and with important public health meaning Salmonella serogroup.
Kentucky serotype salmonella, earliest identification were isolated from cultivation chicken body in 1937, and Kaufman antigen formula is 8,20 i: z6, which is acknowledged as related to birds.Salmonella kentucky is popular in the areas such as north African, Europe, North America, Multiple, high-level drug resistance is presented to antibiotic such as Ciprofloxacin and third-generation cephalosporins, therefore is also known as by European and American areas " super Drug resistance " salmonella kentucky.Have Epidemiological Evidence confirm " super drug resistance " salmonella kentucky system by traveller from North African travels to Europe and north America region, thus the food and agricultural management department of Europe and north America region are detected and propagated to it It pays high attention to, is one of the serotype of above-mentioned regional nontyphoidal Salmonella emphasis monitoring.Four kinds of sramana in China's Poultry industry Salmonella serotype is main harm: Kentucky, enteritis, Indiana, white diarrhea.Rank the states such as China and U.S. family chicken in Kentucky The front three of most common serotype in meat product, and be also the bacterial strain seriously polluted in retail poultry product.In the serotype Serious consequence can be caused after carrying the sequence type ST198 bacterial strain propagation of Ciprofloxacin (CIP) patience.
The detection method of traditional food-borne pathogens usually requires to take a long time, many quick, sensitive molecule lifes Object method has been applied to the detection of food microorganisms, identification, overcomes the defect of traditional detection method, wherein polymerase chain Formula reaction (polymerase chain reaction, PCR) has become most common food microorganisms molecular Biological Detection Method.Multiplex PCR (multiplex PCR, MPCR) technology is developed on the basis of PCR in recent years, it is one kind at one Multipair primer is added in reaction system while detecting the technology of multiple target fragments, can for single template be also possible to it is several not Same template, reaction principle, reaction reagent and operating process are identical as general PCR.Inspection of the multiplex PCR in food-borne pathogens It has been well used in survey, a kind of multiple genes of pathogenic bacteria can be detected simultaneously, a variety of cause a disease can also be detected simultaneously Bacterium.Traditional PCR method mostly uses invA, fimH, stn gene design primer, and sensitivity is often preferable, but false positive often occurs The specificity of rate or the high phenomenon of false negative rate, a weight PCR method itself can not be convincing.Currently without towards entire dynamic The detection scheme of salmonella and Kentucky serotype in object and products thereof industrial chain (including commercially available meat) sample.
Summary of the invention
The purpose of the present invention is design the species specificity primer and Kentucky serotype of salmonella enteron aisle kind I type subspecies Serotype specificity primer, and PCR reaction condition is optimized, establishes while expanding the same of the multipair gene of salmonella One PCR reaction condition.The salmonella in production of poultry meat chain sample or separation strains bacterium solution is quickly detected using multiple PCR method, It indicates simultaneously and wherein whether contains Kentucky serotype.
Technical purpose of the invention is achieved in that
A kind of kit of salmonella Rapid identification and parting, it is characterised in that the kit includes:
1) blank control: dd H20；
2) positive referring to product: the DNA of S. Kentucky 1C1 is extracted by RNA isolation kit or water-boiling method and is obtained, as PCR mould Plate；
3) primer sets are made of primer stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；The nucleotide sequence of each primer It is respectively as follows:
Stn-F:5 '-CTTTGGTCGTAAAATAAGGCG -3 '；
Stn-R:5 '-TGCCCAAAGCAGAGAGATTC -3 '；
Gly-F:5 '-TTCCAATTGAAACGAGTGCGG -3 '；
gly-R: 5′-ACTAACCGCTTGGGTTGTTGCTGT-3′；
Bcf-F:5 '-GGGTGGGCGGAAAACTATTTC -3 '；
bcf-R: 5′-CGGCACGGCGGAATAGAGCAC -3′；
4) reaction enzymes: 2xM5 Taq PCR Mix；
6) DNA molecular amount standard: DL2000 DNA Marker；
7) nucleic acid dye；
8) agarose.
The water-boiling method comprises the steps of: that vortex oscillation mixes the sample enrichment liquid of S. Kentucky 1C1, takes 1ml It is managed in 2 ml EP, 13000 rpm are centrifuged 1.5 min, abandon supernatant, and 1ml distilled water washs one time, 13000 rpm centrifugation 1.5 Min abandons supernatant；The distilled water that 70 μ l are added is resuspended, boiling water boiling 30-35 min, then 5 ~ 10 min of ice bath immediately, 11000 rpm 3 min are centrifuged, taking supernatant is pcr template.
The pcr template carries out the reaction system of multiplex PCR detection are as follows: 10 μ L of reaction enzymes 2xM5 Taq PCR Mix； Stn-F, stn-R primer each 0.34 μ L, 170 nmol/L of final concentration；Each 0.48 μ L of gly-F, gly-R primer, final concentration 240 nmol/L；Bcf-F, bcf-R primer each 0.2 μ L, 100 nmol/L of final concentration；Pcr template 4 μ L, ddH20 3.96 μL。
The pcr template carries out the reaction condition of multiplex PCR detection: 95 DEG C of 5 min of initial denaturation；95 DEG C of 25 s of denaturation, 59.4 DEG C of annealing 25 s, 72 DEG C of 60 s of extension are recycled 35 times；72 DEG C of 8 min of extension.
A kind of another technical solution of the invention: method of salmonella Rapid identification and parting, which is characterized in that packet Include following steps:
Step 1, pcr template is prepared in the bacterium solution based on S. Kentucky 1C1；
Step 2, primer sets are prepared, are made of stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；The nucleotide of each primer Sequence is respectively as follows:
Stn-F:5 '-CTTTGGTCGTAAAATAAGGCG -3 '；
Stn-R:5 '-TGCCCAAAGCAGAGAGATTC -3 '；
Gly-F:5 '-TTCCAATTGAAACGAGTGCGG -3 '；
gly-R: 5′-ACTAACCGCTTGGGTTGTTGCTGT-3′；
Bcf-F:5 '-GGGTGGGCGGAAAACTATTTC -3 '；
bcf-R: 5′-CGGCACGGCGGAATAGAGCAC -3′；
Step 3, the pcr template obtained based on step 1 establishes the reactant of multiplex PCR detection using the primer sets that step 2 obtains The reaction system of system, multiplex PCR detection obtains pcr amplification product under predetermined reaction condition；
Step 4, electrophoresis detection is carried out to the amplified production that step 3 obtains, whether sramana is contained according to electrophoresis detection result judgement Salmonella.
The preparation method of the pcr template is: genome DNA extracting reagent kit is mentioned from the bacterium solution of S. Kentucky 1C1 DNA is obtained as pcr template or water-boiling method and extracts to obtain DNA as pcr template from the bacterium solution of S. Kentucky 1C1.
The water-boiling method comprises the steps of: that vortex oscillation mixes the sample enrichment liquid of S. Kentucky 1C1, takes 1ml It is managed in 2 ml EP, 13000 rpm are centrifuged 1.5 min, abandon supernatant, and 1ml distilled water washs one time, 13000 rpm centrifugation 1.5 Min abandons supernatant；The distilled water that 70 μ l are added is resuspended, boiling water boiling 30-35 min, then 5 ~ 10 min of ice bath immediately, 11000 rpm 3 min are centrifuged, taking supernatant is pcr template.
The pcr template carries out the reaction system of multiplex PCR detection are as follows: 10 μ L of reaction enzymes 2xM5 Taq PCR Mix； Stn-F, stn-R primer each 0.34 μ L, 170 nmol/L of final concentration；Each 0.48 μ L of gly-F, gly-R primer, final concentration 240 nmol/L；Bcf-F, bcf-R primer each 0.2 μ L, 100 nmol/L of final concentration；Pcr template 4 μ L, ddH20 3.96 μL。
The pcr template carries out the reaction condition of multiplex PCR detection: 95 DEG C of 5 min of initial denaturation；95 DEG C of 25 s of denaturation, 59.4 DEG C of annealing 25 s, 72 DEG C of 60 s of extension are recycled 35 times；72 DEG C of 8 min of extension.
The method of the electrophoresis detection are as follows: amplified production is detected through 1.2 % agarose gel electrophoresis, if salmonella Occur belonging to specific band in 993 bp, enteron aisle kind I type subspecies specific band, and only 993 bp, 260 occurs at 260 bp Two specific bands of bp occur simultaneously, are determined as the salmonella positive；On this basis, if salmonella kentucky exists Also occur serotype specificity band at 170bp, tri- 993 bp, 260 bp, 170bp specific bands occur simultaneously at this time, Then it is judged to the salmonella kentucky positive；Salmonella feminine gender is judged to if having no specific band.
The invention has the advantages that: in order to quickly detect important detection of Salmonella serotype (salmonella kentucky), Detection of Salmonella whole genome sequence known to this experimental evidence goes out salmonella enteron aisle kind I type subspecies and willing tower by Analysis and Screening The different parting level specific sequences of base serotype further design multiplex PCR primer, establish multiplex PCR inspection Survey method.
By the detection of specific test, sensitivity tests and clinical sample, show that the multiple PCR method established can Specificity quickly detection for salmonella (including salmonella kentucky) in animals and animal product industrial chain sample, is scientific research And the detection in production work and parting provide accurate, quick, economic new method.
This kit uses multiple PCR method, detects the intestines in animals and animal product industry chain (supply chain) by specific band Road kind I type subspecies salmonella, and Kentucky serological type strain therein can be indicated simultaneously, being suitable for a variety of samples, (such as anus is wiped Son, nose swab, musculature, internal organs, cloacal swab etc.) in salmonella especially Kentucky serological type strain detection.
Detailed description of the invention
The optimum results of Fig. 1 multi-PRC reaction system primer concentration group composition and division in a proportion.
The optimum results of Fig. 2 multi-PRC reaction system annealing temperature.
The specific test testing result of Fig. 3 salmonella kentucky multiplex PCR.
The multiplex PCR sensitivity tests result of Fig. 4 DNA profiling Dilution.
Specific embodiment
With reference to the accompanying drawings of the specification, the invention will be further described, but the invention is not limited to following embodiments.
One, the kit of salmonella Rapid identification and parting provided by the invention, comprising:
1, reference substance:
Blank control: dd H2O；
Positive reference product: the DNA of bacterial strain S. Kentucky 1C1 utilizes RNA isolation kit or water-boiling method to extract DNA, DNA concentration 200ng/uL, as pcr template；
2, reagent；
It is commercially available for extracting the bacterial genomes DNA extraction kit of above-mentioned DNA；
Reaction enzymes 2xM5 Taq PCR Mix, it is commercially available；
DNA molecular amount standard: DL2000 DNA Marker, it is commercially available；
Nucleic acid dye, it is commercially available；
Agarose, it is commercially available；
3, primer sets are designed by the present invention, and by Shanghai, Shang Ya Bioisystech Co., Ltd is synthesized, the primer and its nucleosides of primer sets Acid sequence is as follows:
Stn-F:5 '-CTTTGGTCGTAAAATAAGGCG -3 '；
Stn-R:5 '-TGCCCAAAGCAGAGAGATTC -3 '；
Gly-F:5 '-TTCCAATTGAAACGAGTGCGG -3 '；
gly-R: 5′-ACTAACCGCTTGGGTTGTTGCTGT-3′；
Bcf-F:5 '-GGGTGGGCGGAAAACTATTTC -3 '；
bcf-R: 5′-CGGCACGGCGGAATAGAGCAC -3′。
The water-boiling method comprises the steps of: that vortex oscillation mixes the sample enrichment liquid of S. Kentucky 1C1, takes 1ml It is managed in 2 ml EP, 13000 rpm are centrifuged 1.5 min, abandon supernatant, and 1ml distilled water washs one time, 13000 rpm centrifugation 1.5 Min abandons supernatant；The distilled water that 70 μ l are added is resuspended, boiling water boiling 30-35 min, then 5 ~ 10 min of ice bath immediately, 11000 rpm 3 min are centrifuged, taking supernatant is pcr template.
Two, the method for salmonella Rapid identification and parting provided by the invention, which comprises the following steps:
Step 1, pcr template is prepared in the bacterium solution based on S. Kentucky 1C1；
Step 2, primer sets are prepared, are made of stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；
Step 3, the pcr template obtained based on step 1 establishes the reactant of multiplex PCR detection using the primer sets that step 2 obtains The reaction system of system, multiplex PCR detection obtains pcr amplification product under predetermined reaction condition；
Step 4, electrophoresis detection is carried out to the amplified production that step 3 obtains, whether sramana is contained according to electrophoresis detection result judgement Salmonella.
Three, the reaction system of multiplex PCR detection is established as follows:
The DNA extracted using bacterial strain S. Kentucky 1C1 uses ddH as pcr template2O carries out multiplex PCR as blank control Reaction, by the successive optimization to primer concentration group composition and division in a proportion and annealing temperature, optimum results are shown in Fig. 1, Fig. 2.
The reaction system of final choice are as follows:
Predetermined reaction condition:
95 DEG C of 5 min of initial denaturation；95 DEG C of denaturation 25 s, 59.4 DEG C of annealing 25 s, 72 DEG C of 60 s of extension, follow for 35 times Ring；72 DEG C of 8 min of extension.
In Fig. 1: the concentration of bcf primer 1-10 is respectively as follows: 240,240,240,240,170,170,170,100,100, 100(nmol/L)；The concentration of gly primer 1-10 is respectively as follows: 240,240,170,100,240,170,100,240,170,100 (nmol/L)；The concentration of stn primer 1-10 is respectively as follows: 30,30,170,100,100,30,170,170,170,30.
In Fig. 1 to Fig. 4, M is DNA standard molecular weight.
Four, the specific assay of multiplex PCR:
By 6 plants of salmonella kentuckies (separate sources separation strains), 7 plants of other serotype salmonellas (from 5 different serum Type) and other 6 plants of nonsalmonella (for the major criterion or reference strain not belonged to from 5) extraction genomic DNA, it is multiple The specific outcome of PCR method shows such as Fig. 3.4 plants of salmonella kentuckies (S. Kentucky 3B1, S. Kentucky 1F1, S. Kentucky 1E1, S. Kentucky SK, 2 salmonella kentucky artificial contamination samples (use S. Kentucky bD8, S. Kentucky bB6 establish pollution chicken meat sample), 7 plants of other serotype salmonella (S. Enteritidis 50335、S. Pullorum 15820、S. Newport 13282、S. Heidelberg S116、S. Enteritidis CGMCC50760, (salmonella typhimurium is used for by S. Pullorum JXA-Yangzl and ATCC14028 Establish pollution chicken meat sample) band map meets expection, while other 6 plants of nonsalmonella (ATCC25923 (golden yellow grapes Coccus), ATCC27853 (Pseudomonas aeruginosa), ATCC25922 (Escherichia coli), ATCC7982 (Aeromonas), Streptococcus suis ZYH33 (Streptococcus suis Type II), (the Streptococcus suis II of Streptococcus suis 9801 Type)) have no obvious band, illustrate that the multiple PCR method has good specificity.
In Fig. 3, negative control；1, Streptococcus suis 9801 (Streptococcus suis Type II)；2, Streptococcus suis ZYH33 (Streptococcus suis Type II)；3, ATCC7966 (Aeromonas)；4, ATCC25922 is (big Enterobacteria)；5, ATCC27853 (Pseudomonas aeruginosa)；6, ATCC25923 (staphylococcus aureus)；7,S. Dublin 8D (as PCR positive control)；8, S. Kentucky bB6 (the detection pollution pre- enrichment liquid of chicken meat sample)；9,S. Kentucky BD8 (the detection pollution pre- enrichment liquid of chicken meat sample)；10, (salmonella typhimurium detection pollutes chicken sample to ATCC14028 The pre- enrichment liquid of product)；11,S. Pullorum JXA-Yangzl；12,S. Kentucky SK；13,S. Enteritidis CGMCC50760；14,S. Heidelberg S116；15,S. Newport 13282；16,S. Pullorum 15820；17, S. Enteritidis 50335；18,S. Kentucky 1E1；19,S. Kentucky 1F1；20,S. Kentucky 3B1。
Five, the sensitivity testing of multiplex PCR:
Sensitivity tests is carried out to bacterial strain Kentucky 1C1 using the multi-PRC reaction system of above-mentioned optimization.By the DNA of extraction Template 2uL(about 200ng/uL) 10 times of gradient dilutions are carried out, use ddH2O as blank control, choose final reaction system and Reaction condition carries out multiplex PCR detection.Sensitivity tests is as the result is shown such as Fig. 4, the minimum detectable 10-4 ng/ of multiplex PCR UL DNA is fully applicable in detection practice.Operating for this method is further demonstrated to the detection of different isolated strains Property and applicability, can be used for the inspection of a variety of source samples such as Commercial Food, livestock organisations excrement, wild animal.
Six, the application of multiplex PCR detection technique:
The acquisition of 6.1 samples:
6.1.1 cotton swab subsample；
Sampling equipment used through high pressure sterilization and must dry；
If sample is live-bird, it is proposed that take cloacal swab: swab being goed deep into cloaca turn around to pick excrement.Then by swab one Rise be put into it is spare in the centrifuge tube for filling 1ml 10mM PBS buffer solution (commercially available)；
6.1.2 foodstuff samples
If sample is muscle or internal organs, take 2 ~ 20g of measuring samples in cleaned, sterilizing sampling pipe (or sampler bag), it is spare；
6.1.3 water sample；
Take 1-5ml water sample in sterile 10ml centrifuge tube with pipettor, it is spare；
The storage of 6.2 samples and transport；
The sample of preparation saves under the conditions of 2 ~ 8 DEG C should be no more than for 24 hours；Transport: it is carried out using curling stone or bubble chamber sealing on the rocks Transport；
The pretreatment of 6.3 samples；
BPW buffered peptone water (Zengjing Granule for salmonella): 5 g of NaCl, peptone 10 g, Na2HPO4 12H2O 9.0 g, KH2PO4 1.5g(is commercially available), PH is adjusted to 7.2 ± 0.2, and pure water is added, is settled to 1L, high pressure sterilization It is saved backup afterwards at 4 DEG C；
Cotton swab increment water sample: taking the circumstances into consideration addition 10mM PBS buffer solution (commercially available) in the centrifuge tube containing acquisition sample makes For liquid convenient for drawing, shaken well is spare；
Foodstuff samples or its hetero-organization: classifying by position, be placed in sterile sealing bag (or homogenizing bag) and number, and addition 50 ~ 100ml BPW(buffered peptone water), when conditions permit, answers first homogenization, after in 37 DEG C, 120rpm vibrates 30min；
1ml liquid increases 3 ~ 4h of bacterium in 37 DEG C of shaking tables in the test tube for filling 9ml BPW after taking above-mentioned steps to handle；
6.4 identification with multi-plex PCR；
About 1.0 ml bacterium solutions are taken to propose DNA(PCR template) and identification with multi-plex PCR, multiplex PCR is carried out using stn, gly and bcf primer Reaction reacts 20 μ L of total volume, reaction system:
Reaction condition:
95 DEG C of 5 min of initial denaturation；95 DEG C of denaturation 25 s, 59.4 DEG C of annealing 25 s, 72 DEG C of 60 s of extension, follow for 35 times Ring；72 DEG C of 8 min of extension；
6.5 result Quality Controls；
Positive strain S. Kentucky 1C1 template PCR product should see three purpose bands and negative control should not occur purpose Otherwise band is judged to result and reforms without effect；
6.6 result judgement；
Amplified production is detected through 1.2 % agarose gel electrophoresis, and salmonella occurs belonging to specific band in 993 bp There is enteron aisle kind I type subspecies specific band (stn gene amplification product) at 260 bp in (bcf gene amplification product), if only should Two bands occur simultaneously, are judged to the salmonella positive (non-salmonella kentucky), salmonella kentucky occurs at 170bp Serotype specificity band is judged to the salmonella kentucky positive if three bands occur simultaneously；Sand is judged to if having no band Door Salmonella is negative.
The above description is only a preferred embodiment of the present invention, and for those skilled in the art, the present invention can have Various modifications and variations.All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on, should all It is included within protection scope of the present invention.
Sequence table
University of Zhejiang University
A kind of salmonella Rapid identification and classifying method
6
SIPOSequenceListing 1 .0
1
21
DNA
Primer (primer)
1
CTTTGGTCGT AAAATAAGGC G 21
2
20
DNA
Primer (primer)
2
TGCCCAAAGC AGAGAGATTC 20
3
21
DNA
Primer (primer)
3
TTCCAATTGA AACGAGTGCG G 21
4
24
DNA
Primer (primer)
4
ACTAACCGCT TGGGTTGTTG CTGT 24
5
21
DNA
Primer (primer)
5
GGGTGGGCGG AAAACTATTT C 21
6
21
DNA
Primer (primer)
6
CGGCACGGCG GAATAGAGCA C 21
Stn gene target fragment (the accession number:L16014 (489-748) in genbank)
CTTTGGTCGTAAAATAAGGCGTAAAAATCGCCTCCAGCTGATCCGGGGCGATCCCTTTCCCGCTATCGGTAAC AGTGATGATAACGCGGTCGGTCCCACTTTCTTTTGCCTCTACGCTAATCGTTCCCTGGCGGCCAATCGCATGAATAG CGTTCAGGTACAGATTCAACAGCACCTGAGTCAGCCTGTCCGGGTCAGCCTGAATACGCTTAAGCGTCTCATTCGCC GTGAATCTCAACTGAATCTCTCTGCTTTGGGCA
BcfC gene target fragment (the accession number:AM933172 (25665-26657) in genbank)
GGGTGGGCGGAAAACTATTTCAACCCGGCATTTCTGTCTGACGACCCGTCTGCGGTGGCCGACCTATCGACCT TTTCCCGTAATGCCCAGGCGGCAGGGATGTATCGCGTTGACGTTTACCTGAACAATACGTTTCTCGCGACCAGAGAC ATTGCCTTCCAGGCGGTGAAAACGACGGGAAAAAGCGCGCCCACCGATGACAGCGGATTACGCGCCTGCCTGACGCC TGAAATGCTTAAAAATATGGGGGTAAACACCGGGGCGTTTCCACTGTTGGCGAAGGCGGCGGCGGGAAGTTGCCCTG ATCTCGCCAGTGCGATACCGGCCGCCCGGACCCGCTTTGATTTTGCGCAGCAACGTCTCGACATTAGCATCCCGCAG GCGGCGATGGTTGCCAGCGCCAGAGGCTATATCCCACCGAAATACTGGGATGAAGGTATTAATGCGTTGCTATTGAA TTACACCTTTACCGGCGCGAATAGTCAGGATCGGAGCCCAGGCGGCAGTGCGGAGAACAGCTATTTTCTTGGATTGA ATAGCGGCCTTAATCTGGGGGCCTGGCGGTTACGCGACTACTCCACATGGAACGCGAATAGCGGCGATCAGAATAGC GACAGCGACTGGCAGCACATCAGTACTTATCTGGAACGTGATGTGGTCTTTTTGCAGGGAGAACTGACGGCAGGCGA TAGTTATACCCCCTCCGCATTATTCGACAGCCTTCCTTTTCGTGGGCTACAACTGGCGTCTGACGACAATATGTTGC CAGACAGCATGAAGGGCTTCGCACCGACCATTCACGGCATTGCCAGAAGCAACGCGCAAGTGACCATTCGGCAAAAC GGCTACATCATTAATCAGCGCTATGTGCCGCCCGGGGCATTTACTATTAATGATCTCTATCCTACCGCCGCCAGCGG CGATTTGACTGTGGAAGTCAAAGAGTCCGACGGTTCTATTAATCGCTATAACGTGCCCTATTCCGCCGTGCCG
Gly gene target fragment (the accession number:ABEI01000007 (116981-117150) in genbank)
TTCCAATTGAAACGAGTGCGGTTGCTGAATATTTAAAAGCTGGTTGGACTTGTTCTATTAGGTAATTTAATAC GCTTAATGTGCCATATATATCAAGTGAGCCAGAACCAAGGCTGGCAGCCCTTCCACCGTTGGCCTCATAAATCACAG CAACAACCCAAGCGGTTAGT

Claims (10)

1. a kind of kit of salmonella Rapid identification and parting, it is characterised in that the kit includes:
1) blank control: dd H20；
2) positive referring to product: the DNA of S. Kentucky 1C1 is extracted by RNA isolation kit or water-boiling method and is obtained, as PCR mould Plate；
3) primer sets are made of primer stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；The nucleotide sequence of each primer It is respectively as follows:
Stn-F:5 '-CTTTGGTCGTAAAATAAGGCG -3 '；
Stn-R:5 '-TGCCCAAAGCAGAGAGATTC -3 '；
Gly-F:5 '-TTCCAATTGAAACGAGTGCGG -3 '；
gly-R: 5′-ACTAACCGCTTGGGTTGTTGCTGT-3′；
Bcf-F:5 '-GGGTGGGCGGAAAACTATTTC -3 '；
bcf-R: 5′-CGGCACGGCGGAATAGAGCAC -3′；
4) reaction enzymes: 2xM5 Taq PCR Mix；
6) DNA molecular amount standard: DL2000 DNA Marker；
7) nucleic acid dye；
8) agarose.
2. a kind of kit of salmonella Rapid identification and parting as described in claim 1, it is characterised in that: the water-boiling method It comprises the steps of: that vortex oscillation mixes the sample enrichment liquid of S. Kentucky 1C1,1ml is taken to manage in 2 ml EP, 13000 Rpm is centrifuged 1.5 min, abandons supernatant, and 1ml distilled water washs one time, and 13000 rpm are centrifuged 1.5 min, abandons supernatant；70 μ l are added Distilled water be resuspended, boiling water boiling 30-35 min, then 5 ~ 10 min of ice bath immediately, 11000 rpm are centrifuged 3 min, take the supernatant to be Pcr template.
3. a kind of kit of salmonella Rapid identification and parting as claimed in claim 1 or 2, it is characterised in that: the PCR The reaction system of template progress multiplex PCR detection are as follows: 10 μ L of reaction enzymes 2xM5 Taq PCR Mix；Stn-F, stn-R primer Each 0.34 μ L, 170 nmol/L of final concentration；Gly-F, gly-R primer each 0.48 μ L, 240 nmol/L of final concentration；bcf-F, Bcf-R primer each 0.2 μ L, 100 nmol/L of final concentration；Pcr template 4 μ L, ddH20 3.96 μL。
4. a kind of kit of salmonella Rapid identification and parting as claimed in claim 3, it is characterised in that: the PCR mould The reaction condition of plate progress multiplex PCR detection: 95 DEG C of 5 min of initial denaturation；95 DEG C of denaturation 25 s, 59.4 DEG C of annealing 25 s, 72 DEG C extend 60 s, recycle 35 times；72 DEG C of 8 min of extension.
5. a kind of method of salmonella Rapid identification and parting, which comprises the following steps:
Step 1, pcr template is prepared in the bacterium solution based on S. Kentucky 1C1；
Step 2, primer sets are prepared, are made of stn-F, stn-R, gly-F, gly-R, bcf-F, bcf-R；The nucleotide of each primer Sequence is respectively as follows:
Stn-F:5 '-CTTTGGTCGTAAAATAAGGCG -3 '；
Stn-R:5 '-TGCCCAAAGCAGAGAGATTC -3 '；
Gly-F:5 '-TTCCAATTGAAACGAGTGCGG -3 '；
gly-R: 5′-ACTAACCGCTTGGGTTGTTGCTGT-3′；
Bcf-F:5 '-GGGTGGGCGGAAAACTATTTC -3 '；
bcf-R: 5′-CGGCACGGCGGAATAGAGCAC -3′；
Step 3, the pcr template obtained based on step 1 establishes the reactant of multiplex PCR detection using the primer sets that step 2 obtains The reaction system of system, multiplex PCR detection obtains pcr amplification product under predetermined reaction condition；
Step 4, electrophoresis detection is carried out to the amplified production that step 3 obtains, whether sramana is contained according to electrophoresis detection result judgement Salmonella.
6. a kind of method of salmonella Rapid identification and parting according to claim 5, it is characterised in that: the PCR mould The preparation method of plate is: genome DNA extracting reagent kit extracts to obtain DNA as PCR mould from the bacterium solution of S. Kentucky 1C1 Plate or water-boiling method extract to obtain DNA as pcr template from the bacterium solution of S. Kentucky 1C1.
7. a kind of method of salmonella Rapid identification and parting according to claim 6, it is characterised in that: the water-boiling method It comprises the steps of: that vortex oscillation mixes the sample enrichment liquid of S. Kentucky 1C1,1ml is taken to manage in 2 ml EP, 13000 Rpm is centrifuged 1.5 min, abandons supernatant, and 1ml distilled water washs one time, and 13000 rpm are centrifuged 1.5 min, abandons supernatant；70 μ l are added Distilled water be resuspended, boiling water boiling 30-35 min, then 5 ~ 10 min of ice bath immediately, 11000 rpm are centrifuged 3 min, take the supernatant to be Pcr template.
8. a kind of method of salmonella Rapid identification and parting according to claim 6, it is characterised in that: the PCR mould The reaction system of plate progress multiplex PCR detection are as follows: 10 μ L of reaction enzymes 2xM5 Taq PCR Mix；Stn-F, stn-R primer are each 0.34 μ L, 170 nmol/L of final concentration；Gly-F, gly-R primer each 0.48 μ L, 240 nmol/L of final concentration；bcf-F,bcf- R primer each 0.2 μ L, 100 nmol/L of final concentration；Pcr template 4 μ L, ddH20 3.96 μL。
9. a kind of method of salmonella Rapid identification and parting according to claim 6, it is characterised in that: the PCR mould The reaction condition of plate progress multiplex PCR detection: 95 DEG C of 5 min of initial denaturation；95 DEG C of denaturation 25 s, 59.4 DEG C of annealing 25 s, 72 DEG C extend 60 s, recycle 35 times；72 DEG C of 8 min of extension.
10. according to a kind of any one of claim 5-9 method of salmonella Rapid identification and parting, feature exists In: the method for the electrophoresis detection are as follows: amplified production is detected through 1.2 % agarose gel electrophoresis, if salmonella is 993 Bp occurs belonging to specific band, enteron aisle kind I type subspecies specific band, and only 993 bp, 260 bp two occurs at 260 bp Specific band occurs simultaneously, is determined as the salmonella positive；
On this basis, if serotype specificity band also occurs at 170bp in salmonella kentucky, 993 bp, 260 at this time Tri- specific bands of bp, 170bp occur simultaneously, then are judged to the salmonella kentucky positive；Sentence if having no specific band For salmonella feminine gender.
CN201811191746.XA 2018-10-12 2018-10-12 A kind of salmonella Rapid identification and classifying method and kit Pending CN109182568A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811191746.XA CN109182568A (en) 2018-10-12 2018-10-12 A kind of salmonella Rapid identification and classifying method and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811191746.XA CN109182568A (en) 2018-10-12 2018-10-12 A kind of salmonella Rapid identification and classifying method and kit

Publications (1)

Publication Number Publication Date
CN109182568A true CN109182568A (en) 2019-01-11

Family

ID=64948363

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811191746.XA Pending CN109182568A (en) 2018-10-12 2018-10-12 A kind of salmonella Rapid identification and classifying method and kit

Country Status (1)

Country Link
CN (1) CN109182568A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116337986A (en) * 2022-12-16 2023-06-27 南京市食品药品监督检验院 Quick identification method of salmonella kentucky based on MALDI-TOF MS

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101955993A (en) * 2010-06-13 2011-01-26 中华人民共和国珠海出入境检验检疫局 Compound gene chip for detecting salmonella serotype and detection method thereof
CN103131784A (en) * 2013-03-08 2013-06-05 扬州大学 Multiple PCR (polymerase chain reaction) method for identifying salmonella enteritidis, salmonella typhimurium, salmonella pullorum and salmonella gallinarum
CN103266179A (en) * 2013-05-28 2013-08-28 上海交通大学 Multiplex PCR (Polymerase Chain Reaction) detection method for salmonella typhimurium and serum variants of salmonella typhimurium
CN104087654A (en) * 2013-04-01 2014-10-08 中国农业大学 Multiple PCR identification kit of salmonella and five serotypes of salmonella
CN104774969A (en) * 2015-05-08 2015-07-15 江苏省家禽科学研究所 Multi-PCR detection kit and method for identifying poultry salmonella

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101955993A (en) * 2010-06-13 2011-01-26 中华人民共和国珠海出入境检验检疫局 Compound gene chip for detecting salmonella serotype and detection method thereof
CN103131784A (en) * 2013-03-08 2013-06-05 扬州大学 Multiple PCR (polymerase chain reaction) method for identifying salmonella enteritidis, salmonella typhimurium, salmonella pullorum and salmonella gallinarum
CN104087654A (en) * 2013-04-01 2014-10-08 中国农业大学 Multiple PCR identification kit of salmonella and five serotypes of salmonella
CN103266179A (en) * 2013-05-28 2013-08-28 上海交通大学 Multiplex PCR (Polymerase Chain Reaction) detection method for salmonella typhimurium and serum variants of salmonella typhimurium
CN104774969A (en) * 2015-05-08 2015-07-15 江苏省家禽科学研究所 Multi-PCR detection kit and method for identifying poultry salmonella

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
查华 等: "华东地区禽源沙门菌的分布及血清型分析", 《畜牧兽医学报》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116337986A (en) * 2022-12-16 2023-06-27 南京市食品药品监督检验院 Quick identification method of salmonella kentucky based on MALDI-TOF MS
CN116337986B (en) * 2022-12-16 2023-11-14 南京市食品药品监督检验院 Quick identification method of salmonella kentucky based on MALDI-TOF MS

Similar Documents

Publication Publication Date Title
Zandi et al. Typing of toxigenic isolates of Clostridium perfringens by multiplex PCR in ostrich.
Tartor et al. Virulotyping and genetic diversity of Aeromonas hydrophila isolated from Nile tilapia (Oreochromis niloticus) in aquaculture farms in Egypt
Wei et al. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks
Alexander et al. A multiplex polymerase chain reaction assay for the identification of Mannheimia haemolytica, Mannheimia glucosida and Mannheimia ruminalis
García-Alvarez et al. Ovine Mannheimia haemolytica isolates from lungs with and without pneumonic lesions belong to similar genotypes
CN107365869B (en) Method and primer for detecting Klebsiella pneumoniae by loop-mediated isothermal amplification technology
Xin et al. Rapid detection and differentiating of the predominant Salmonella serovars in chicken farm by TaqMan multiplex real-time PCR assay
Zhanabayeva et al. Pcr diagnosis for the identification of the virulent gene of salmonella in poultry meat
El Baaboua et al. Prevalence and antimicrobial profiling of Campylobacter spp. isolated from meats, animal, and human feces in Northern of Morocco
Ataei et al. First report of Gallibacterium isolation from layer chickens in Iran
Qi et al. Identification of atypical enteropathogenic Escherichia coli O98 from golden snub-nosed monkeys with diarrhea in China
Laroucau et al. A pmp genes-based PCR as a valuable tool for the diagnosis of avian chlamydiosis
Jamshidi et al. Isolation and identification of Campylobacter spp. and Campylobacter coli from poultry carcasses by conventional culture method and multiplex PCR in Mashhad, Iran
CN109182568A (en) A kind of salmonella Rapid identification and classifying method and kit
Sedeek et al. Molecular epidemiology and sequencing of avian pathogenic Escherichia coli APEC in Egypt
CN102936625B (en) Molecular motor biosensor kit used in vibrio parahaemolyticus molecular typing
Shayegh et al. POTENTIAL OF PASTEURELLA MULTOCIDA ISOLATED FROM HEALTHY AND DISEASED CATTLE
Thongphueak et al. Development of the rapid test kit for the identification of Campylobacter spp. Based on Loop-mediated Isothermal Amplification (LAMP) in combination with a Lateral Flow Dipstick (LFD) and Gold Nano-DNA Probe (AuNPs)
Hassan et al. Detection and identification of Helicobacter pullorum in poultry species in upper Egypt
K Ibraheim et al. Conventional and molecular detection of Pasteurella multocida in outbreak of respiratory tract infection of sheep and goats in Basrah Province
Nefedchenko et al. Detection and genotyping Pasteurella multocida of five capsular groups in real time polymerase chain reaction
Mirhaghgoye Jalali et al. LPS-PCR typing of ovine Pasteurella multocida isolates from Iran based on (L1 to L8) outer core biosynthesis loci
El-Feky et al. Detection of invA gene in non typhoidal Salmonellae isolated from food products and clinical cases
Barua et al. Detection of porcine cysticercosis in Nagaland of North East, India
SZ et al. Detection of Salmonella spp. in gastrointestinal tract of broiler chickens by polymerase chain reaction

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190111