CN104498599A - Microsporidium molecule universal detection primers and kit thereof - Google Patents
Microsporidium molecule universal detection primers and kit thereof Download PDFInfo
- Publication number
- CN104498599A CN104498599A CN201410755669.1A CN201410755669A CN104498599A CN 104498599 A CN104498599 A CN 104498599A CN 201410755669 A CN201410755669 A CN 201410755669A CN 104498599 A CN104498599 A CN 104498599A
- Authority
- CN
- China
- Prior art keywords
- primer
- microsporidium
- dna
- hmg1f
- hmg1r
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a group of microsporidium molecule universal detection primers and a kit thereof. The universal detection primers include an upstream primer HMG1F and a downstream primer HMG1R; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.4. The detection primers target at the gene HMG1 and can be applied to detecting a plurality of microsporidia simultaneously, and the detection results are reliable, easy to operate and high in sensitivity; especially, the universal detection primers have extremely important practical application significance to early detection of various microsporidia in a sample in practical quarantine work.
Description
Technical field
The invention belongs to entomopathogen field of molecular detection.More specifically, one group of microsporidium molecule universal detector primer and test kit thereof is related to.
Background technology
The research of nosematosis starts from the popular pebrine in the whole nation occurring in France for 1845, and pasteur determines that " particulate " that he observes is the causative factor of pebrine, and its cause of disease comprises the microsporidium pathogen such as nosema bombycis and Nosema antheraeae worm.Especially nosema bombycis has horizontal transmission and vertical transmission two kinds of route of infection, wherein vertical transmission is produced the silkworm egg in sericultural production and is caused huge harm, very large negative impact is brought to raw cocoon production cocoon yield and quality simultaneously, have a strong impact on silk industry chain downstream expanding economy (Cai Shunfeng etc., 2011).Since the national pebrine outburst of France, nosema bombycis is the important detected object of various countries' silkworm egg production and foreign trade all the time.19 end of the centurys, in the period that Japanese sericulture is the most flourishing, " female moth Microscopical Method For Detection ", " flacherie preventive treatment " were once written into constitution (Takeshi Kawarabata, 2003), China is also classified as Imported and exported animals and is quarantined two class epidemic diseases ［ " People's Republic of China (PRC) enter the territory animal one, two class transmissible disease, parasitosis register ", No. 12nd, (1992) agriculture (quarantine) word ］.
Initial people differentiate that microsporidium mainly carries out visual inspection according to the characteristics of incidence of pebrine.After microscope invention, people carry out sediments microscope inspection according to the form of microsporidium and size, improve sensitivity and the efficiency of detection to a certain extent, and have therefore contained French pandemic pebrine.But sediments microscope inspection has obvious shortcoming, as to the technology of operator and skill requirement higher, and microsporidium is individual and small, conventional sediments microscope inspection detection method specificity and sensitivity lower, be difficult to distinguish microsporidium analogue.
Along with popularizing of round pcr, people bring into use PCR method to detect microsporidium and to reach higher sensitivity." molecular clock " is the effective means during molecular level analysis of biological system is evolved, SSU rRNA(16S rDNA) be conventional " molecular clock " (Pei A Y, et al., 2010) in microbial evolution research.Primer designed in the research of pebrine disease PCR detection technique for target gene majority be also SSU rRNA, the primer for other microsporidium gene design is less or sensitivity is poor, is thus seldom in the news.Baker et al(1995) and Terry et al(1999) according to the PCR primer V1f/530r of close kind microsporidium SSU rRNA high conservative region design, can differentiate that the DNA profiling of the microsporidium of multiple kind increases the special object band of about 450bp, but susceptibility is barely satisfactory, and the present inventor studies discovery, when using this primer to detect silkworm seed microsporidium, the sensitivity detected is extremely low, may there is certain restraining factors and disturb pcr amplification to nosema bombycis (N.b) DNA in hint silkworm seed extract.
And in real work, especially quarantine, detection for the various microsporidium cause of diseases of sample is very important, and undetected situation can not be there is, therefore a kind of multiple microsporidium of detection that can either be general is sought, there is again good detection sensitivity, and with silkworm seed DNA for also having the primer sets of good susceptibility during template, be with a wide range of applications and meaning in the actual detection application of microsporidium.
Summary of the invention
The technical problem to be solved in the present invention is the deficiency overcoming the general detection technique of existing microsporidium, with nosema bombycis
hMG1gene detects primer for target gene designs, and provides a kind of method of reliable results, easy handling (simple and quick), the highly sensitive multiple microsporidium of general detection.
The object of this invention is to provide a kind of microsporidium molecule universal detector primer.
Another object of the present invention is to provide described microsporidium molecule universal detector primer and is preparing the application in microsporidium universal testing kit.
Another object of the present invention is to provide a kind of microsporidium universal testing kit.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
One group of microsporidium universal detector primer, described universal detector primer comprises upstream primer HMG1F and downstream primer HMG1R, the nucleotide sequence of upstream primer HMG1F is as shown in SEQ ID NO.3, and the nucleotide sequence of downstream primer HMG1R is as shown in SEQ ID NO.4.
The present invention is obtaining nosema bombycis
hMG1on the basis of gene (
hMG1gene DNA full length nucleotide sequence is as shown in SEQ ID NO.1, and its cDNA full length nucleotide sequence is as shown in SEQ ID NO.2), with
hMG1gene is target gene, devises above-mentioned primer, and the multiple microsporidium of detection that this primer can either be general, has again good detection sensitivity, is with a wide range of applications and meaning in the actual detection application of microsporidium.Described primer is particularly useful for detecting nosema bombycis, Nosema antheraeae worm and Pyrausta nubilalis (Hubern). microsporidium simultaneously.
Present invention also offers described microsporidium universal detector primer and prepare the application in microsporidium universal testing kit.Provide a kind of microsporidium universal testing kit, comprise upstream primer HMG1F and downstream primer HMG1R, the nucleotide sequence of upstream primer HMG1F is as shown in SEQ ID NO.3, and the nucleotide sequence of downstream primer HMG1R is as shown in SEQ ID NO.4.
Preferably, the using method of described test kit is as follows:
With sample DNA or cDNA for template, utilize primer HMG1F and HMG1R to carry out PCR reaction, reaction terminates rear detected through gel electrophoresis amplified production, according to the size result of determination of amplification of DNA fragments; The standard of described result of determination is: DNA fragmentation product sepharose occurring 561bp specifically, namely this sample has infected nosema bombycis.
Preferably, the reaction system of described PCR reaction is:
2 × reaction buffer 10 μ L
10 μMs of upstream primer HMG1F 0.5 μ L
10 μMs of downstream primer HMG1R 0.5 μ L
Template DNA 1 μ L
DdH
2o mends to 20 μ L;
Wherein, the component of 2 × reaction buffer is Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
Preferably, the response procedures of described PCR reaction is: 94 DEG C of 5 min; 94 DEG C of 30 s, 58.5 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
The present invention has following beneficial effect:
The invention discloses one group of microsporidium universal detector primer, is according to nosema bombycis (Guangdong Strain)
hMG1the primer of gene order design, the PCR that this primer can be used for microsporidiosis detects, there is good versatility and susceptibility, the multiple microsporidium of detection that can either be general, there is again good detection sensitivity, be with a wide range of applications and meaning in the actual detection application of microsporidium.
In addition, primer of the present invention and related reagent can be assembled into test kit, easy to use, and the template of pcr amplification is unrestricted, applied widely, can be DNA or cDNA of sample, can directly with silkworm seed DNA for template, considerably increase the scope of detected object.
Importantly, what detection primer of the present invention and test kit can infect at microsporidium just can detect in early days, and the early detection for microsporidiosis provides a kind of simple and quick method.
Accompanying drawing explanation
Fig. 1 is the detected result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 2 is the detected result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 3 is the detected result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1: poisonous silkworm seed DNA, 2: nosema bombycis (N.b) DNA, the 3:(of purifying are normal) nontoxic silkworm seed DNA, 4:ddH
2o.
Fig. 4 is the specific detection result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 5 is the specific detection result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 6 is the specific detection result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1:N.b(nosema bombycis) DNA; 2:N.a(Nosema antheraeae worm) DNA; 3:N.f(Pyrausta nubilalis (Hubern). microsporidium) DNA; 4: water contrasts.
Fig. 7 is the susceptibility detected result of HMG1F/ HMG1R primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Fig. 8 is the susceptibility detected result of HMG1-sF/ HMG1-sR primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Fig. 9 is the susceptibility detected result of HMG1-xF/ HMG1-xR primer; Swimming lane: M:DL1000; 1 ~ 7 is respectively 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6the N.b DNA of ng/ μ L, 8 is water contrast.
Figure 10 be HMG1F/ HMG1R primer pair N.b infect four age silkworm different time cDNA template PCR result; Swimming lane: M is DL1000; 1:6h; 2:12h; 3:18h; 4:24h; 5:36h; 6:48h; 7:60h; 8:72h; 9:84h; 10:96h; 11:108h; 12: the N.b cDNA of purifying; 13: normal Midgut of Silkworm, Bombyx Mori cDNA; 14:ddH
2o.
Figure 11 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (before pickling) different time cDNA template; Swimming lane: M is DL1000; 1:2h; 2:8h; 3:10h; 4:12h; 5:17h; 6: the cDNA of the N.b spore of purifying; 7: normal Eggs of Silkworm cDNA; 8:ddH
2o.
Figure 12 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (not pickling) different time cDNA template; Swimming lane: M is DL1000; 1:24h; 2:48h; 3:72h; 4:96h; 5:120h; 6:144h; 7:168h; 8:192h; 9:216h; 10:240h; 11: the cDNA of the N.b of purifying; 12: normal Eggs of Silkworm cDNA; 13:ddH
2o.
Figure 13 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (pickling) different time cDNA template; Swimming lane: M is DL1000; 1:24h; 2:48h; 3:72h; 4:96h; 5:120h; 6:144h; 7:168h; 8:192h; 9:216h; 10:240h; 11: the cDNA of the N.b of purifying; 12: normal Eggs of Silkworm cDNA; 13:ddH
2o.
Embodiment
Further illustrate the present invention below in conjunction with Figure of description and specific embodiment, but embodiment does not limit in any form to the present invention.Unless stated otherwise, the present invention adopts reagent, method and apparatus are the art conventional reagent, method and apparatus.
Unless stated otherwise, following examples agents useful for same and material are commercial.
embodiment 1 nosema bombycis
hMG 1gene
1, according to the method for DNA homolog clone in molecular biological gene clone technology, clone obtains nosema bombycis
hMG 1cDNA and the DNA full length sequence of gene.
2, the acquisition of cDNA total length, concrete grammar is as follows:
(1) use Primer premier 5.0 software, in conjunction with comprehensively analyzing, devise primer HMG1F/ HMG1R, sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.4.
Upstream primer HMG1F(SEQ ID NO.3):
5’ ATGACTGCTCAAAAAGACGATAC 3’
Downstream primer HMG1R(SEQ ID NO.4):
5’ TTATTCATCACTATCTCCTACTTCT 3’。
(2) with the nosema bombycis of purifying (N.b) spore DNA for template, carry out pcr amplification with primer HMG1F/ HMG1R.
(3) PCR primer is through purifying, is connected in pMD19T, and is transformed in E.coli DH-5 α and cultivates.
(4) extract recombinant plasmid, and check order, obtain
hMG1the cDNA total length of gene, as shown in SEQ ID NO.2.
3, the acquisition of DNA total length
Utilize the method for genome high-flux sequence, and through a large amount of predictive genes comparative analyses, finally by PCR sequence verification, obtain nosema bombycis
hMG 1the DNA full length sequence of gene, as shown in SEQ ID NO.1.
4, according to the repeatedly confirmation of sequencing result, nosema bombycis is drawn
hMG 1the DNA full length sequence of gene, as shown in SEQ ID NO.1, its cDNA full length nucleotide sequence is as shown in SEQ ID NO.2.
embodiment 2 detects the foundation of design of primers and PCR amplification method
1, design of primers
Acquisition nosema bombycis
hMG 1on the basis of gene, application Primer premier 5.0 software design, is devised multipair primer, is detected, finally have chosen 3 pairs of representational primer sets of primer by a large amount of resistance, specificity and susceptibility, and each group primer sequence is as follows:
(1) first is right:
Upstream primer HMG1F(SEQ ID NO.3):
5’ ATGACTGCTCAAAAAGACGATAC 3’
Downstream primer HMG1R(SEQ ID NO.4):
5’ TTATTCATCACTATCTCCTACTTCT 3’。
(2) second is right:
Upstream primer HMG1-sF(SEQ ID NO.5):
TTCCGAAATAATCTTCTTTTAATTG
Downstream primer HMG1-sR(SEQ ID NO.6):
TTGTGCACCGAATCGTAAATAG
(3) the 3rd is right:
Upstream primer HMG1-xF(SEQ ID NO.7):
TCCCTAGGAACTTTTAAAGAGAAG
Downstream primer HMG1-xR(SEQ ID NO.8):
TCCTTTTATTCATCACTATCTCCT
2, the foundation of PCR amplification method
(1) example is extracted as, the DNA extraction of interpret sample with the STb gene of silkworm or Eggs of Silkworm:
(method only makes reference, not any limiting meaning of tool, extracts sample DNA by any method in this area)
Adopt the little extraction reagent kit of DNA of plants (DNeasy Plant mini kit test kit) the extracting silkworm seed genomic dna that QIAGEN company produces, step following (carrying out to specifications):
Get 20 silkworm seeds and put into mortar, liquid nitrogen fully grinds, by the powder collection after grinding in the centrifuge tube of 1.5mL.Add 400 μ L lysis buffer AP1 and 4 μ L Rnase A, vortex mixing (400 μ L lysis buffer AP1 and 4 μ L Rnase A do not mix before use); Solution after mixing, 65 DEG C, turn upside down during hatching 10 min(test tube 2 ~ 3 times); Add 130 μ L buffer A P2, ice bath 5 min after mixing; Then 14,000 rpm, centrifugal 5 min; Draw the collection tube of supernatant in Filter column (QIAshredder spin column), 14,000rpm, centrifugal 2min; Supernatant liquor in centrifuge tube is moved to new pipe (not stirring the residue of appearance), add the AP3/E of 1.5 times of volumes, pipettor mixes; 650 μ L mixed solutions are moved in adsorption column (DNeasy Mini spin column), 4200 rpm, centrifugal 1 min; Remaining liquid repeats this step; Adsorption column is put into new collection tube, adds 500 μ L buffer A W, 4200 rpm, centrifugal 1 min; Abandon supernatant; Add 500 μ L buffer A W again, 14000 rpm, centrifugal 2 min(ensure that collection tube does not touch bottom supernatant); Move in collection tube to 1.5 mL or 2 mL centrifuge tubes; Add 40 μ L buffer A E wash-outs, room temperature places 5 min; Centrifugal 1 min of 4200 rpm; Repeat previous step (namely add 40 μ L buffer A E wash-outs, room temperature places 5 min, centrifugal 1 min of 4200 rpm); The STb gene extracted is placed in-20 DEG C of Refrigerator stores for subsequent use.
(2) PCR amplification method
Take sample total DNA as template, carry out pcr amplification with three pairs of primers described in embodiment 1.
Described PCR reaction system (cumulative volume 20 μ L):
2 × Taq Master Mix(reaction buffer) 10 μ L
10 μMs of upstream primer HMG1F 0.5 μ L
10 μMs of downstream primer HMG1R 0.5 μ L
Template DNA 1 μ L;
DdH
2o mends to 20 μ L.
Wherein, 2 × Taq Master Mix(reaction buffer) component be Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
PCR reaction conditions is: 94 DEG C of 5 min; 94 DEG C of 30 s, 58.5 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
(3) result judges
Pair of primers HMG1F/HMG1R:PCR reacts and terminates laggard row agarose gel electrophoresis, judges whether silkworm seed sample has infected nosema bombycis according to the DNA fragmentation of 561 bp that whether increase.When the DNA fragmentation product of 561 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
The second couple of primer HMG1-sF/HMG1-sR:PCR reacts and terminates laggard row agarose gel electrophoresis, and the DNA fragmentation according to 684 bp that whether increase judges whether silkworm seed sample has infected nosema bombycis.When the DNA fragmentation product of 684 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
The 3rd couple of primer HMG1-xF/HMG1-xR:PCR reacts and terminates laggard row agarose gel electrophoresis, and the DNA fragmentation according to 251 bp that whether increase judges whether silkworm seed sample has infected nosema bombycis.When the DNA fragmentation product of 251 bp can be amplified specifically, can judge that this silkworm or silkworm seed have infected nosema bombycis.
(4) get the nosema bombycis sample of 50 " poisonous " silkworm seeds (i.e. the silkworm of infected silkworm microsporidium produce silkworm seed), healthy silkworm seed and purifying respectively, extract DNA respectively, carry out pcr amplification according to above-mentioned PCR method.
Agarose gel electrophoresis detected result is respectively as shown in accompanying drawing 1 ~ 3, and the three pairs of primers all can detect specific DNA fragmentation in the nosema bombycis of " poisonous " silkworm seed and purifying, and do not detect specific fragment in healthy silkworm seed.Show that the PCR method of three pairs of primers and foundation all can well be used for the rapid detection of nosema bombycis.
embodiment 3 primer specificity detects
1, respectively with the DNA of nosema bombycis (N.b), Nosema antheraeae worm (N.a), Pyrausta nubilalis (Hubern). microsporidium (N.f) for template, with primer HMG1F/ HMG1R, HMG1-sF/ HMG1-sR, HMG1-xF/ HMG1-xR, carry out pcr amplification with the method for embodiment 2, amplification terminates rear agarose gel electrophoresis detected result.
2, the amplification of three pairs of primers is respectively as shown in accompanying drawing 4 ~ 6.Result shows, and primer HMG1F/ HMG1R and primer HMG1-xF/ HMG1-xR all can detect multiple microsporidium, has good general detection.And primer HMG1-sF/ HMG1-sR can only be special detection nosema bombycis.
embodiment 4 primer susceptibility detects
1, extract the DNA of nosema bombycis (N.b), original concentration is 5.0 ng/ μ L.
By above-mentioned N.b DNA ddH
2o dilutes, and dilutes 10 respectively
0, 10
1, 10
2, 10
3, 10
4, 10
5, 10
6doubly.Namely obtaining concentration gradient is 5.0 × 10
0, 5.0 × 10
-1, 5.0 × 10
-2, 5.0 × 10
-3, 5.0 × 10
-4, 5.0 × 10
-5, 5.0 × 10
-6ng/ μ L.
2, with the N.b DNA of above-mentioned each concentration for template, with primer HMG1F/ HMG1R, HMG1-sF/ HMG1-sR, HMG1-xF/ HMG1-xR, carries out pcr amplification with the method for embodiment 2, amplification terminate rear agarose gel electrophoresis detected result.
3, the amplification of three pairs of primers is respectively as shown in accompanying drawing 7 ~ 9.Result shows, and primer HMG1F/ HMG1R and primer HMG1-sF/ HMG1-sR all can detect 5.0 × 10
-4the N.b DNA of ng/ μ L concentration, has good detection sensitivity.And the susceptibility of primer HMG1-xF/ HMG1-xR has differed from 1 order of magnitude, can 5.0 × 10 be detected
-3the N.b DNA of ng/ μ L concentration.
Therefore, in sum, consider to only have the multiple microsporidium of detection that primer HMG1F/ HMG1R can either be general from the angle of specificity and susceptibility, there is again good detection sensitivity, be with a wide range of applications and meaning in the actual detection application of microsporidium.
Following examples are tested the detection suitability of primer HMG1F/ HMG1R and susceptibility further.
embodiment 5 infect N.b different time sections four age Midgut of Silkworm, Bombyx Mori and infect N.b silkworm seed detect
1, the extraction of total serum IgE
Use and operate according to the EASYspin plant RNA rapid extraction test kit specification sheets of Ai Delai biotech firm, extract respectively infect N.b different time sections four age Midgut of Silkworm, Bombyx Mori and infect the RNA of silkworm seed of N.b, concrete steps are as follows:
(1) get 500 μ L lysate RLT, proceed in 1.5mL centrifuge tube, add 50 μ L plant RNA extraction aids (PLANTaid is combined with polysaccharide polyphenol) and mix for subsequent use;
(2) grind after Tissues of Silkworm Bombyx Moril becomes fine powder in liquid nitrogen, get 50 mg fine powders and proceed to the above-mentioned centrifuge tube that lysate RLT and PLANTaid is housed, use hand thermal agitation 20 s immediately, abundant cracking;
(3) by centrifugal for lysate 13000rpm 5 ~ 10min, precipitation can not cracking fragment and be combined with the PLANTaid of polysaccharide polyphenol;
(4) get lysate supernatant and forward a new centrifuge tube to.Add the dehydrated alcohol of supernatant volume half, now may occur precipitation, but not affect leaching process, blow and beat mixing immediately, not centrifugal;
(5) add in an adsorption column RA by mixture (be less than 720 μ L, how can add at twice) at every turn, centrifugal 2 min of (adsorption column puts into collection tube) 13000 rpm, discard waste liquid;
(6) add 700 μ L protein liquid removal RW1, room temperature places the centrifugal 30s of 1min, 13000rpm, discards waste liquid;
(7) add 500 μ L rinsing liquid RW, the centrifugal 30s of 13000 rpm, discards waste liquid.Add 500 μ L rinsing liquid Rw, come again;
(8) put back in sky collection tube by adsorption column RA, the centrifugal 2min of 13000 rpm, removes rinsing liquid as far as possible, in order to avoid residual ethanol suppresses downstream reaction in rinsing liquid;
(9) adsorption column RA is taken out, put into a RNase centrifuge tube, add in the middle part of adsorption film sterilized water (the RNase free water that 30 ~ 50 μ L remove RNA enzyme according to expection RNA output, heat in 70 ~ 90 DEG C of water-baths in advance, output can be improved), room temperature places the centrifugal 1min of 1min, 12000rpm.
2, RNA reverse transcription becomes cDNA
The RNA extracted is carried out reverse transcription reaction, uses the PrimeScript RT reagent Kit with gDNA Eraser(Perfect Real Time that TAKARA company produces) test kit, step is as follows:
(1) genomic dna reaction is removed
Reaction system (20 μ L):
5×gDNA Eraser Buffer 4.0μL
gDNA Eraser 1.0μL
Total serum IgE≤2.0 μ g
RNase Free dH
2o adds to 20 μ L
Remove genomic dna reaction conditions: 42 DEG C, 2min(or room temperature 5min can process 30min at most).
(2) reverse transcription reaction
Reverse transcription system (40 μ L)
The reaction solution 20 μ L of step (1)
5×PrimeScript Buffer2 4.0μL
PrimeScript RT Enzyme MixⅠ 2.0μL
RT Primer Mix 2.0μL
RNase Free dH
2o adds to 40 μ L
Reverse transcription reaction condition: 37 DEG C, 15min; 85 DEG C, 5s; 4 DEG C/-20 DEG C save backup.
3, PCR detects
The each cDNA obtained with step 2, for template, carries out RT-PCR reaction with Auele Specific Primer HMG1F/HMGR.
As shown in Figure 10, in N.b infected silkworm, before intestines, 12 h do not detect reaction result
hMG1gene, illustrates that now microsporidium does not also start breeding, and from 18h
hMG1gene has transcriptional activity, and now microsporidium may start to carry out fissiparity.And the life history that this conclusion and nosema bombycis in prior art infect silkworm is consistent, also confirm that detection primer of the present invention has good specificity and susceptibility from the side.
embodiment 6 N.b infects the detection of silkworm seed different time cDNA template
1, the present embodiment infects silkworm seed and normal Eggs of Silkworm for detected object with N.b respectively, after infecting with the N.b before not pickling, pickling, after pickling respectively, the cDNA of the silkworm seed of different time is for template, with normal Eggs of Silkworm DNA for contrast, carry out PCR detection with HMG1F/ HMG1R primer.
2, experimental technique
(1) sampling before pickling: after nosema bombycis infected silkworm, get silkworm seed respectively when silkworm moth mating 2h, 8h, 10h, 12h, 17h, be placed in-80 DEG C of Refrigerator stores for subsequent use.
(2) pickling process: an ovum circle is divided into two parts, about 20h after laying eggs, pickling (hydrochloric acid proportion is 1.075), pickling condition is: 46 DEG C of pickling 5min, and clear water rinses 20min, and being placed in temperature is 25 DEG C, humidity is cultivate, to newly-hatched silkworm in the artificial climate incubator of 85%.
(3) by the silkworm seed of pickling and not pickling by 24h, 48h, 72h, 96h, 120h, 144h, 168h, 192h, 216h, 240h(newly-hatched silkworm after laying eggs) sample, be placed in-80 DEG C of Refrigerator stores for subsequent use.
3, result is as shown in accompanying drawing 11 ~ 13.
Figure 11 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (before pickling) different time cDNA template; Swimming lane: M is DL1000; 1:2h; 2:8h; 3:10h; 4:12h; 5:17h; 6: the cDNA of the N.b spore of purifying; 7: normal Eggs of Silkworm cDNA; 8:ddH
2o.
Figure 12 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (not pickling) different time cDNA template; Swimming lane: M is DL1000; 1:24h; 2:48h; 3:72h; 4:96h; 5:120h; 6:144h; 7:168h; 8:192h; 9:216h; 10:240h; 11: the cDNA of the N.b of purifying; 12: normal Eggs of Silkworm cDNA; 13:ddH
2o.
Figure 13 is the PCR result that HMG1F/ HMG1R primer pair N.b infects silkworm seed (pickling) different time cDNA template; Swimming lane: M is DL1000; 1:24h; 2:48h; 3:72h; 4:96h; 5:120h; 6:144h; 7:168h; 8:192h; 9:216h; 10:240h; 11: the cDNA of the N.b of purifying; 12: normal Eggs of Silkworm cDNA; 13:ddH
2o.
The detected result of accompanying drawing 11 ~ 13 shows, when silkworm seed gives birth to 2 h, can detect
hMG1gene has transcriptional activity, and in the whole growth course of after this silkworm seed (pickling and not pickling)
hMG1gene has transcriptional activity, therefore can be by
hMG1gene, as a molecular target, detects early stage silkworm seed and whether has infected nosema bombycis.
In sum, detection primer of the present invention and test kit whether containing nosema bombycis, especially can detect silkworm seed nosema bombycis by judgement sample exactly, for silkworm egg produce in the detection of " poisonous " silkworm egg and safety send out and kind provide guarantee.Experimental result also shows,
hMG1gene is a molecular target well detecting microsporidium.
SEQUENCE LISTING
<110> Agricultural University Of South China
<120> mono-group of microsporidium molecule universal detector primer and test kit thereof
<130>
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 1136
<212> DNA
<213> HMG1 gene DNA sequence
<400> 1
ttccgaaata atcttctttt aattgattta aattattttt gaccttttgt gaattagatc 60
ttaaattttc atcatccttg tatttttcct gtaaaaaatc agaccatttc tttaacggtt 120
tgatttcaaa accgttttta attaaaagct tgataatttt ggttggagct tcgtaaaatt 180
ttctataatt ggcgtctttg ttcattttta aggaaggagg ggggaggggc attctataag 240
aaaaattctt ataacgggcg tcttgcatat tattatttga aataacgggc acacgaacag 300
taggataatg aaggagttta taaaaacaac cgacaaaaat attactgcct tttttaagtt 360
aaataacata cattcgggtc ttcttataag attcgtttaa atctactctt cctacctttt 420
ttgttatatt ttttcttact acgtatttgt ttcatctctt tttattaacc aatcctttta 480
ctctaattct tttactttcc ccatacacat ctttttatta cttcattcgt cattttttta 540
actgtttttc agattttttt tctcccctaa atgactgctc aaaaagacga tacggctatt 600
aagaagagac agacggccaa aaagccaaag gacaaaaatg caccaaaacc cccattaacc 660
ccctatttac gattcggtgc acaacaaagg gcagccgata aaactataac agctcttcct 720
gttgctaaac aagggaaagt tcttgctgaa atgtggagta aattaagtga tgaagcaaaa 780
aataaattta aagaagaata cactgaagag aaagcgattt atgataaaaa ttatgaagaa 840
tacaagaaga cggatgatta taaaaagtat caagaccttc ttaaatccct aggaactttt 900
aaagagaaga aaaccaaaag acaatcagct tataatgtgt attataaaga acagtacggg 960
ataatagcca gtaaaactaa aggacttgag atgaaagata taacggctat tattgtaaaa 1020
aactggaagg agattgatga accaaccaaa aagatttatg ctgaaaaagc gaaaaaagct 1080
aatgatctta ataaggaaaa taaaggagaa gtaggagata gtgatgaata aaagga 1136
<210> 2
<211> 561
<212> DNA
<213> HMG1 gene cDNA sequence
<400> 2
atgactgctc aaaaagacga tacggctatt aagaagagac agacggccaa aaagccaaag 60
gacaaaaatg caccaaaacc cccattaacc ccctatttac gattcggtgc acaacaaagg 120
gcagccgata aaactataac agctcttcct gttgctaaac aagggaaagt tcttgctgaa 180
atgtggagta aattaagtga tgaagcaaaa aataaattta aagaagaata cactgaagag 240
aaagcgattt atgataaaaa ttatgaagaa tacaagaaga cggatgatta taaaaagtat 300
caagaccttc ttaaatccct aggaactttt aaagagaaga aaaccaaaag acaatcagct 360
tataatgtgt attataaaga acagtacggg ataatagcca gtaaaactaa aggacttgag 420
atgaaagata taacggctat tattgtaaaa aactggaagg agattgatga accaaccaaa 480
aagatttatg ctgaaaaagc gaaaaaagct aatgatctta ataaggaaaa taaaggagaa 540
gtaggagata gtgatgaata a 561
<210> 3
<211> 23
<212> DNA
<213> upstream primer HMG1F
<400> 3
atgactgctc aaaaagacga tac 23
<210> 4
<211> 25
<212> DNA
<213> downstream primer HMG1R
<400> 4
ttattcatca ctatctccta cttct 25
<210> 5
<211> 25
<212> DNA
<213> upstream primer HMG1-sF
<400> 5
ttccgaaata atcttctttt aattg 25
<210> 6
<211> 22
<212> DNA
<213> downstream primer HMG1-sR
<400> 6
ttgtgcaccg aatcgtaaat ag 22
<210> 7
<211> 24
<212> DNA
<213> upstream primer HMG1-xF
<400> 7
tccctaggaa cttttaaaga gaag 24
<210> 8
<211> 24
<212> DNA
<213> downstream primer HMG1-xR
<400> 8
tccttttatt catcactatc tcct 24
Claims (8)
1. one group of microsporidium universal detector primer, it is characterized in that, described universal detector primer comprises upstream primer HMG1F and downstream primer HMG1R, and the nucleotide sequence of upstream primer HMG1F is as shown in SEQ ID NO.3, and the nucleotide sequence of downstream primer HMG1R is as shown in SEQ ID NO.4.
2. described in claim 1, microsporidium molecule universal detector primer is preparing the application in microsporidium universal testing kit.
3. apply according to claim 2, it is characterized in that, described microsporidium is nosema bombycis, Nosema antheraeae worm or Pyrausta nubilalis (Hubern). microsporidium.
4. a microsporidium universal testing kit, it is characterized in that, comprise upstream primer HMG1F and downstream primer HMG1R, the nucleotide sequence of upstream primer HMG1F is as shown in SEQ ID NO.3, and the nucleotide sequence of downstream primer HMG1R is as shown in SEQ ID NO.4.
5. test kit according to claim 4, it is characterized in that, the using method of described test kit is as follows:
With sample DNA or cDNA for template, utilize primer HMG1F and HMG1R to carry out PCR reaction, reaction terminates rear detected through gel electrophoresis amplified production, according to the size result of determination of amplification of DNA fragments.
6. test kit according to claim 5, is characterized in that, the reaction system of described PCR reaction is:
2 × reaction buffer 10 μ L
10 μMs of upstream primer HMG1F 0.5 μ L
10 μMs of downstream primer HMG1R 0.5 μ L
Template DNA 1 μ L
DdH
2o mends to 20 μ L;
Wherein, the component of 2 × reaction buffer is Taq archaeal dna polymerase, 160 mM Tris-HCl, 40 mM (NH
4)
2sO
4, 3.0 mM MgCl
2, 400 μMs of dNTP.
7. test kit according to claim 5, is characterized in that, the response procedures of described PCR reaction is: 94 DEG C of 5 min; 94 DEG C of 30 s, 58.5 DEG C of 45 s, 72 DEG C of 45 s, 32 circulations; 72 DEG C of 10 min.
8. test kit according to claim 5, it is characterized in that, the standard of described result of determination is: DNA fragmentation product sepharose occurring 561 bp specifically, namely this sample has infected nosema bombycis.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410755669.1A CN104498599B (en) | 2014-12-11 | 2014-12-11 | One group of microsporidian molecule universal detector primer and kit thereof |
| US15/310,783 US10435759B2 (en) | 2014-12-11 | 2015-08-28 | HMG1 gene and uses thereof in microsporidium molecular detection |
| PCT/CN2015/088443 WO2016090965A1 (en) | 2014-12-11 | 2015-08-28 | Hmg1 gene and uses thereof in microsporidium molecular detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410755669.1A CN104498599B (en) | 2014-12-11 | 2014-12-11 | One group of microsporidian molecule universal detector primer and kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104498599A true CN104498599A (en) | 2015-04-08 |
| CN104498599B CN104498599B (en) | 2016-06-29 |
Family
ID=52940049
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410755669.1A Active CN104498599B (en) | 2014-12-11 | 2014-12-11 | One group of microsporidian molecule universal detector primer and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104498599B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104946747A (en) * | 2015-05-29 | 2015-09-30 | 中国水产科学研究院东海水产研究所 | Nested primer for early warning of cultured and wild Portunus trituberculatus microsporidium infection, and application thereof |
| CN105331697A (en) * | 2015-11-04 | 2016-02-17 | 江苏省淡水水产研究所 | PCR primer set and kit for detecting microsporidium of eriocheir sinensis |
| WO2016090965A1 (en) * | 2014-12-11 | 2016-06-16 | 华南农业大学 | Hmg1 gene and uses thereof in microsporidium molecular detection |
| CN106222297A (en) * | 2016-10-09 | 2016-12-14 | 辽宁省农业科学院大连生物技术研究所 | One group of fluorescence quantification PCR primer for quick diagnosis Nosema antheraeae worm and application thereof |
| CN107034284A (en) * | 2017-05-15 | 2017-08-11 | 华南农业大学 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
| CN107400719A (en) * | 2017-09-07 | 2017-11-28 | 辽宁省农业科学院大连生物技术研究所 | One group of Nosema antheraeae worm detection primer and its application |
| CN111269999A (en) * | 2020-02-09 | 2020-06-12 | 西南大学 | Universal primer, kit, test strip and application for simultaneously detecting four kinds of human microsporidia |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967512A (en) * | 2009-07-27 | 2011-02-09 | 浙江大学 | Fluorescence PCR detection method of pebrine disease and kit thereof |
| CN102260737A (en) * | 2011-05-30 | 2011-11-30 | 华南农业大学 | Primers and application thereof in quick detection of nosema bombycis |
| WO2012162161A1 (en) * | 2011-05-20 | 2012-11-29 | Phthisis Diagnostics | Microsporidia detection system and method |
-
2014
- 2014-12-11 CN CN201410755669.1A patent/CN104498599B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967512A (en) * | 2009-07-27 | 2011-02-09 | 浙江大学 | Fluorescence PCR detection method of pebrine disease and kit thereof |
| WO2012162161A1 (en) * | 2011-05-20 | 2012-11-29 | Phthisis Diagnostics | Microsporidia detection system and method |
| CN102260737A (en) * | 2011-05-30 | 2011-11-30 | 华南农业大学 | Primers and application thereof in quick detection of nosema bombycis |
Non-Patent Citations (1)
| Title |
|---|
| 向恒等: "微孢子虫系统进化研究的变迁与展望", 《微生物学通报》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016090965A1 (en) * | 2014-12-11 | 2016-06-16 | 华南农业大学 | Hmg1 gene and uses thereof in microsporidium molecular detection |
| US10435759B2 (en) | 2014-12-11 | 2019-10-08 | South China Agricultural University | HMG1 gene and uses thereof in microsporidium molecular detection |
| CN104946747A (en) * | 2015-05-29 | 2015-09-30 | 中国水产科学研究院东海水产研究所 | Nested primer for early warning of cultured and wild Portunus trituberculatus microsporidium infection, and application thereof |
| CN104946747B (en) * | 2015-05-29 | 2018-05-01 | 中国水产科学研究院东海水产研究所 | A kind of nested primer and its application for infecting early warning with Wild Portunus trituberculatus microsporidian for China's cultivation |
| CN105331697A (en) * | 2015-11-04 | 2016-02-17 | 江苏省淡水水产研究所 | PCR primer set and kit for detecting microsporidium of eriocheir sinensis |
| CN106222297A (en) * | 2016-10-09 | 2016-12-14 | 辽宁省农业科学院大连生物技术研究所 | One group of fluorescence quantification PCR primer for quick diagnosis Nosema antheraeae worm and application thereof |
| CN107034284A (en) * | 2017-05-15 | 2017-08-11 | 华南农业大学 | Sang Sheng ball pin shells ITS sequence and its application in Sang Sheng ball pin shell Molecular Detections |
| CN107400719A (en) * | 2017-09-07 | 2017-11-28 | 辽宁省农业科学院大连生物技术研究所 | One group of Nosema antheraeae worm detection primer and its application |
| CN111269999A (en) * | 2020-02-09 | 2020-06-12 | 西南大学 | Universal primer, kit, test strip and application for simultaneously detecting four kinds of human microsporidia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104498599B (en) | 2016-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104498599A (en) | Microsporidium molecule universal detection primers and kit thereof | |
| CN106636471B (en) | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN104017891B (en) | Application of septin1 gene to detection of nosema bombycis | |
| CN104017890B (en) | The application in detection nosema bombycis of the EB1 gene | |
| CN102719531B (en) | Macrobrachium rosenbergii sex specific molecular marker, screening method and application | |
| CN103602738B (en) | Multiple PCR (Polymerase Chain Reaction) primer and method for quickly identifying variety of scallops | |
| CN104017899A (en) | Verification method of sea horses | |
| CN110358816B (en) | Primer set and kit for chicken-derived cell PCR detection and application | |
| CN103555847B (en) | A kind of method of Tilapia mossambica paternity test | |
| CN104498509B (en) | HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection | |
| CN107365766B (en) | Method for extracting RNA of mould spore by mechanical crushing method | |
| CN107043830A (en) | It is a kind of while detecting double PCR primer and the application of grouper NNV and SGIV virus | |
| CN104120170B (en) | Target bacterium detection kit and detection method | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN102134600B (en) | PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| WO2016090965A1 (en) | Hmg1 gene and uses thereof in microsporidium molecular detection | |
| CN104651375B (en) | Nosema bombycis Met AP2 genes and its application | |
| CN104313163B (en) | Method and kit for triple PCR detection of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 and application of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 | |
| CN105039331A (en) | Peronophythora litchi LAMP primer as well as rapid detection method and application thereof | |
| CN101597645B (en) | Specificity detection primer, detection kit and detection method for schistosoma japonicam sex | |
| CN104450967A (en) | Specific primer for detecting Aleutian disease virus of minks and application of specific primer in screening healthy minks | |
| CN108676900A (en) | A kind of composite PCR parting kit and its application for distinguishing eight kinds of Serotyping of Actinobacilus pleuropneumoniae | |
| CN108546784A (en) | A kind of quantitative detecting method of prawn infectious subcutaneous and haematopoietic necrosis virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |